CN1331748A

CN1331748A - Method of recombination and agents useful for same

Info

Publication number: CN1331748A
Application number: CN99814800A
Authority: CN
Inventors: P·艾欧安诺; K·纳拉亚南
Original assignee: MURDOCH INST
Current assignee: MURDOCH INST
Priority date: 1998-10-30
Filing date: 1999-09-29
Publication date: 2002-01-16
Also published as: JP2002528129A; AUPP684998A0; EP1127152A4; WO2000026396A1; EP1127152A1

Abstract

The present invention relates generally to a method for the recombination of at least two nucleic acid sequences and agents useful for same. More particularly, the present invention contemplates a method of recombining, in a host cell which expresses the recBCD nuclease or a functional derivative thereof, a circular nucleic acid sequence with a linear nucleic acid sequence. The method of the present invention is useful, inter alia, for the modification of bacterial artificial chromosomes by homologous recombination with a linear DNA sequence.

Description

Recombination method and agents useful for same thereof

Invention field

The method and the agents useful for same thereof of at least two nucleotide sequences the present invention relates generally to recombinate.More specifically, the present invention relates to the method for reorganization ringed nucleus acid sequence and linear nucleotide sequence in the host cell of expressing recBCD ribozyme or its functional deriv.Method of the present invention can be used for especially by modifying bacterial artificial chromosome with linear dna sequence dna homologous recombination.

Background of invention

The inventory of having listed umerical reference in this specification sheets is concentrated at the specification sheets end.

Be necessary further to understand genomic structure of higher eucaryote and composition.Genome sequence is often long a lot of than encoding sequence.Although still do not know most of non--function of encoding sequence, they are obviously expressed in regulatory gene, stability and evolution aspect play an important role.With uncorrelated or cDNA construct that viral promotors drove forms contrast is, the transgenosis of big genomic fragment demonstrates correct time-and tissue-expression of specific gene 1-7.

Yeast artificial chromosome (YAC) provides the genomic clone 8-10 of a lot of disease genes.Transgenic models with various human locus YAC is illustrated: this big genomic fragment can be used for producing the accurate model of multiple disease ^11-14In the yeast high efficiency homologous recombination for genetic manipulation YAC to carry out functional analysis ^3,8,15, YAC is cyclized into PAC or BAC ^16,17With produce bigger YAC by less overlapping YAC and have great importance.

Yet there are several its application limit of serious obstruction in the YAC system.YAC has high-caliber clone's unstable and chimerism ^19,20In addition, be used to produce the YAC transgenics, but still be difficult to the used complete YAC DNA of purifying transgenosis although worked out several different methods ²¹Be used for importing the significant drawbacks of modifying or being used to carry out TAR clone's yeast homologous recombination system at YAC ²²Be: be difficult to regulate the degree of homologous recombination, and need screening a large amount of " reorganization " clone to identify correct product.

Greatly-inset BAC/PAC cloning system ^23,24A lot of difficult problems of YAC system have been overcome.BAC/PAC is used for the physical map of length-scope more and more and draws ^25,26, the positional cloning of disease gene ²⁷, whole genome order-checking plan ^28-30And functional study ^31,32Because the cloning efficiency in the bacterium is higher, therefore for the YAC library, the structure of high quality BAC/PAC genomic library is more prone to.In by the coli strain DH10B of the reorganization-damaged of detailed-definition, can keep the BAC/PAC of 1-2 copy in each cell, in this bacterial strain polybasic reproductive process, BAC/PAC shows higher clone's stability.Although BAC/PAC carries the inset that size is about 300kb, but still bacterial plasmid separation method large-scale purification BAC/PAC that can be by routine is to carry out functional study.The big integrity that must be enough to keep most of people's gene seats of genome inset among these clones, therefore comparatively desirable for functional study.

Although there are these advantages, and BAC/PAC is more and more welcome as carry out the required important tool of genome research in a lot of systems, but still does not have simple technology to carry out genetic manipulation to these clones.The genome inset is bigger among these clones, and this point has hindered the suitable restriction site of discovery on the basis of routine.

1989, people used intestinal bacteria to connect eclipsed fruit bat clay segment to form the 125kb segment based on the homologous recombination in the carrier of F-plasmid first ³⁵At rec ⁺In the bacterial strain, have between the shuttle plasmid of responsive to temperature type replication orgin altogether-integrate, and differentiate altogether-integrate and need rec ^-Second site-specificity recombination event among the host.Sternberg ³⁴Described the method for Eukaryotic selective marker swivel base being inserted big P1 clone, although be difficult to accurately control the swivel base site, this method should also be applicable to PAC and BAC.Successfully use restriction endonuclease (RARE) cracking process in a large amount of P1 and BAC clone, to import modification by means of RecA ³⁵, but this method is very restricted technically.Because PAC and BAC cloning system all comprise the loxP site on the skeleton of each carrier, a lot of researchists insert this site with the cre recombinase with eucaryon selective marker and reporter gene target ^36,37

Yang etc. ³⁸Report the wild-type recA gene target modification 131kb BAC that uses in the shuttle plasmid with responsive to temperature type replication orgin, thereby given the DH10B cell the instantaneous ability of being proficient in reorganization.Yet, evidence suggests that using this method significantly to reset the clone must identify that recombinant clone is to identify correct product by the Southern trace.The another kind of method of intestinal bacteria CBTS bacterial strain of using also is used to import modification in containing the complete genomic 230kbBAC of mouse CMV ³⁹, carry temperature-responsive type amber mutation in the recA gene of wherein said bacterial strain.Yet, be difficult to BAC directly is transferred to condition recA bacterial strain by DH10B.Recently, the someone uses the target construct in the chi site of containing suitable orientation, with the green fluorescence protein gene target to the zebra fish BAC that contains the GATA-2 locus ⁴⁰Yet this must be transferred to BAC the bacterial strain of being proficient in reorganization, and this may cause having the clone's of tumor-necrosis factor glycoproteins unstable.

The somebody has described the method that substitutes colibacillary RecBCD function with the Red-Gam system of phage ⁴¹This at least 70 times of the height making that the incidence of homologous recombination between host chromosome and the short linear DNA segment shown than recBCsbsBC or recD bacterial strain that substitute.Yet, do not illustrate the purposes that BAC/PAC modifies in this system yet.

None is suitable for aforesaid method PAC and BAC are carried out genetic manipulation most.They can not directly use in the host cell (as DH10B) of expressing RecBCD, perhaps also need to make up complicated shuttle vectors.In these methods of great majority, can not control the degree of homologous recombination preferably, therefore unnecessary rearrangement risk can appear.So, need develop and controllably directly in host cell, make two nucleotide sequences, as the method for BAC/PAC and the reorganization of linear DNA sequence.

In causing work of the present invention, the contriver seeks a kind of method that makes two nucleotide sequences (as the annular DNA sequence) and the controlled homologous recombination of linear DNA sequence in vivo of exploitation.Particularly, but the contriver can synthetic recE/recT recombination system and the recBCD ribozyme inhibitor of modulation level by expressing in host cell, makes dna sequence dna and BAC generation homologous recombination and BAC is modified.Expression recBCD ribozyme inhibitor is the functionally active for the recBCD ribozyme that suppresses the endogenous generation.In addition, the modulation and the ability of coordinate expression recE/recT homologous recombination system and recBCD ribozyme inhibitor are convenient to control the homologous recombination incident, and make and minimize with unnecessary recombination event at random.The ability of modulation and coordinate expression homologous recombination system and recBCD ribozyme inhibitor is convenient to induce the homologous recombination incident in vivo under following two kinds of situations, described situation is: at least one nucleotide sequence as the reorganization main body is positioned at F-plasmid (as BAC), and perhaps host cell is to overexpression recombination system molecule or recBCD inhibitor (as gam) sensitivity.

The invention summary

In whole specification sheets and claims thereafter, unless context needs, otherwise, term " contains " and should be understood as that and comprise a mentioned integer or step or one group of integer or step, but does not get rid of any other integer or step or other group integer or step.

The Sequence Identification of the Nucleotide of indication and aminoacid sequence number (SEQ ID No.) will define after bibliography in the specification sheets.

Therefore, the invention provides the method for being convenient between at least two nucleotide sequences, carry out homologous recombination, described method comprises: by cultivate host cell under the condition that enough helps at least two nucleotide sequences of homologous recombination, in host cell, to induce the reorganization between described at least two nucleotide sequences, wherein said host cell can be expressed recBCD and coding exonuclease, the nucleotide sequence of recombinant protein and recBCD inhibitor or derivatives thereof, exonuclease, the expression of recombinant protein and recBCD inhibitor is can be synthetic.

On the other hand, the invention provides the method for being convenient between at least two nucleotide sequences, carry out homologous recombination, described method comprises: by cultivate host cell under the condition that enough helps at least two nucleotide sequences of homologous recombination, in host cell, to induce the reorganization between described at least two nucleotide sequences, wherein said host cell can be expressed recBCD, recE, the nucleotide sequence of recT and coding recBCD inhibitor or its functional deriv, recE, the expression of the nucleotide sequence of recT and coding recBCD inhibitor is can be synthetic.

On the other hand, the invention provides the method for being convenient between at least two nucleotide sequences, carry out homologous recombination, described method comprises: by cultivate host cell under the condition that enough helps at least two nucleotide sequences of homologous recombination, in host cell, to induce the reorganization between described at least two nucleotide sequences, wherein said host cell can be expressed recBCD, recE, recT and gam or its functional deriv, recE, the expression of recT and gam is can be synthetic.

On the other hand, the invention provides the method for being convenient between at least two nucleotide sequences, carry out homologous recombination, described method comprises: by cultivate host cell under the condition that enough helps at least two nucleotide sequences of homologous recombination, in host cell, to induce the reorganization between described at least two nucleotide sequences, wherein said host cell can be expressed recBCD and coding exonuclease, the nucleotide sequence of recombinant protein and recBCD inhibitor or derivatives thereof, exonuclease, the expression of recombinant protein and recBCD inhibitor is can be synthetic.

On the other hand, the invention provides the method for being convenient between ringed nucleus nucleotide sequence and linear kernel nucleotide sequence, carry out homologous recombination, described method comprises: by cultivate host cell under the condition that enough helps homologous recombination ringed nucleus nucleotide sequence and linear kernel nucleotide sequence, in host cell, to induce the reorganization between described ringed nucleus nucleotide sequence and the described linear kernel nucleotide sequence, wherein said host cell can be expressed recBCD and coding exonuclease, the nucleotide sequence of recombinant protein and recBCD inhibitor or derivatives thereof, exonuclease, the expression of recombinant protein and recBCD inhibitor is can be synthetic.

On the other hand, the invention provides the method for being convenient between ringed nucleus nucleotide sequence and linear kernel nucleotide sequence, carry out homologous recombination, described method comprises: by cultivate DH10B cell or its homologue or its mutant under the condition that enough helps homologous recombination ringed nucleus nucleotide sequence and linear kernel nucleotide sequence, in DH10B cell or its homologue or its mutant, to induce the reorganization between described ringed nucleus nucleotide sequence and the described linear kernel nucleotide sequence, wherein said DH10B cell or its homologue or its sudden change physical efficiency are expressed recBCD, recE, recT and gam or its functional deriv, recE, the expression of reeT and gam is can be synthetic.

On the other hand, the invention provides the method for being convenient between at least two nucleotide sequences, carry out homologous recombination, wherein at least one described nucleotide sequence contains F-plasmid part, described method comprises: by cultivate host cell under the condition that enough helps at least two nucleotide sequences of homologous recombination, in host cell, to induce the reorganization between described at least two nucleotide sequences, wherein said host cell can be expressed recBCD and coding exonuclease, the nucleotide sequence of recombinant protein and recBCD inhibitor or derivatives thereof, exonuclease, the expression of recombinant protein and recBCD inhibitor is can be synthetic.

On the other hand, the invention provides the method for being convenient between BAC and linear kernel nucleotide sequence, carry out homologous recombination, described method comprises: by cultivate host cell under the condition that enough helps homologous recombination BAC and linear kernel nucleotide sequence, in host cell, to induce the reorganization between described BAC and the described linear kernel nucleotide sequence, wherein said host cell can be expressed recBCD and coding exonuclease, the nucleotide sequence of recombinant protein and recBCD inhibitor or derivatives thereof, exonuclease, the expression of recombinant protein and recBCD inhibitor is can be synthetic.

On the other hand, the invention provides the method for being convenient at least two nucleotide sequences of homologous recombination in host cell, described method comprises step:

(i) transformed host cell, wherein contained first nucleotide sequence and described at least two nucleotide sequences by transformed host cells, first nucleotide sequence coded exonuclease wherein, recombinant protein and recBCD inhibitor or its functional deriv, and exonuclease, the expression of gene of recombinant protein and coding recBCD inhibitor is can be synthetic; With

(ii) cultivate for some time with described through transformed host cells being enough to express under the condition of described first nucleotide sequence, the expression product of wherein said first nucleotide sequence is convenient to described second nucleotide sequence of homologous recombination and described the 3rd nucleotide sequence.

On the other hand, the invention provides the generation method of microorganism, described microorganism is convenient at least two nucleotide sequences of homologous recombination, described method comprises: host cell is carried out genetic manipulation, make it can express recBCD, but the exonuclease of modulation level, the gene of recombinant protein and coding recBCD inhibitor and described at least two other nucleotide sequences.

On the other hand, the invention provides the cell of being convenient at least two nucleotide sequences of homologous recombination, described cell contains the coding exonuclease, the gene of the nucleotide sequence of recombinant protein and coding recBCD inhibitor, exonuclease, the expression of recombinant protein and recBCD inhibitor is can be synthetic, also contains nucleotide sequence and described at least two nucleotide sequences of the recBCD that encodes.

On the other hand, the invention provides nucleic acid molecule by the inventive method homologous recombination.

On the other hand, the invention provides pharmaceutical composition, it contains the modified nucleic acid molecule that produces by the inventive method, and one or more drug acceptable carriers and/or thinner.

On the other hand, the present invention relates to be convenient to the test kit of at least two nucleotide sequences of homologous recombination in host cell, described test kit contains a plurality of compartments, wherein be fit to comprise any or multiple coding exonuclease, recombinant protein, the nucleotide sequence of recBCD inhibitor or its functional deriv and be convenient to the used reagent of homologous recombination.Also can comprise other compartment, for example be used to accept biological sample, as nucleotide sequence any or multiple to be recombinated, or by the host cell of one or more nucleotide sequence stable conversion to be recombinated.

On the other hand, the present invention relates to be convenient to the test kit of at least two nucleotide sequences of homologous recombination in host cell, described test kit contains a plurality of compartments, wherein be fit to comprise any or multiple exonuclease, recombinant protein, recBCD inhibitor or its functional deriv and be convenient to the used reagent of homologous recombination.Also can comprise other compartment, for example be used to accept biological sample, as nucleotide sequence any or multiple to be recombinated, or by the host cell of one or more nucleotide sequence stable conversion to be recombinated.

The accompanying drawing summary

Fig. 1 illustrates the collection of illustrative plates of pEBAC140 carrier, demonstrates the principal character of this carrier.This carrier is based on F-plasmid pBeloBAC11 ²³Skeleton.Totomycin and thymidine kinase gene allow to select in eukaryotic cell, and the oriP and the EBNA-1 gene that derive from Epstein-Barr virus are convenient to keep episome.Carrier contains unique, rare cutting multiple clone site, the lacZ gene is inserted in this site in the frame, select thereby can carry out blue/white to recon, and can reclaim the genome inset by flank any in a lot of different cleavage sites of BamHI cloning site.With the XhoI site that modified pUC19-Xho inserts the carrier of more recent version, make it become multiple copied and be convenient to and clone.

Fig. 2 illustrates pEBAC/148, and this carrier is to produce by the NotI site of the 185kb genomic fragment of pac clone being inserted the pEBAC140 carrier, and wherein said clone carries complete beta-globin genome area.There is shown the position of the kalamycin resistance gene targeted integration so far being cloned and targeted integration position to original pEBAC140 carrier by homologous recombination.

Fig. 3 illustrates the collection of illustrative plates that demonstrates pGETrec plasmid principal character.The PCR product that will contain the gam gene of phage inserts the pBAD24-recET plasmid ⁴⁵, produce pGETrec.Therefore, the gam gene is under the control of pectinose promotor with recE and recT gene.

Fig. 4 illustrates used Oligonucleolide primers.By producing PCRkan50 (1262bp) with the kanamycin gene among primer kan50F and the kan50R amplification pCYPAC2.Primer kan50F and kan50R also carry 50-aggressiveness target area, the flanking sequence homology in unique Bst1107I site on this zone and the carrier target sequence.The PCRkan50 homologous recombination to the pEBAC140 carrier, is produced PCRkan140 with primer KF and KR.When lacking and having kanamycin gene, the expection size of the PCR product that obtains with primer KF/KR is respectively 288bp and 1450bp.The expection size of the corresponding PCR product that obtains with primer KA/KB is respectively 393bp and 1555bp.

Fig. 5 illustrates " GET reorganization " method, and this method can be used for by homologous recombination the PCR segment being integrated among the intracellular BAC/PAC of DH10B.The PCR primer respectively is designed to carry 50-aggressiveness zone, the target site homology among this zone and PAC or the BAC, and 3 ' end of described primer also contains specific sequence has selective marker with amplification dna segment.Also can comprise other sequence or mark.The PCR segment electroporation that will produce by these primers is to the DH10B cell of electroreception attitude, and described cell carries required BAC or pac clone and pGETrec plasmid, induces described cell with the 0.2%L-pectinose is instantaneous in preparation process.Reorganization between PCR pulsating homology zone and BAC or the pac clone can be integrated the PCR segment.By separating minim DNA and electroporation, perhaps by ruling modified BAC or the pac clone of purifying from pGETrec containing on the antibiotic substratum to the DH10B cell.

Fig. 6 has shown the independent Cm that carries pEBAC/148 ∷ kan140 to 20 with photo ^rKm ^rThe pcr analysis that bacterium colony is done.With each Cm of 1 microlitre ^rKm ^rThe overnight culture of bacterium colony adds in the PCR reaction of carrying out with PCR primer KF and KR.Use 1.5% (w/v) sepharose to differentiate the PCR product.Swimming lane: 1 and 24,1-kb dna ladder standard; Swimming lane 2-21,20 Cm independently ^rKm ^rBacterium colony; Swimming lane 22, parental generation pEBAC/148 clone; Swimming lane 23, negative control (acellular).

Fig. 7 has shown after by homologous recombination PCRkan140 being integrated into pEBAC/148, to the Cm of 4 random chooses with photo ^rKm ^rThe PFGE that bacterium colony (A-D) is done analyzes.With each clone's DNA electroporation again to the DH10B cell.Use double secondary colony trace to extract DNA, carry out Restriction Enzyme digestion with NotI or XhoI.

(a) NotI-digestion: M, low scope PFG mark; Swimming lane 1-8, double pEBAC/148 ∷ kan140 clone; P, parental generation pEBAC/148 clone.PFGE condition: 6V/cm, be 0.1-25.0 second switching time, 14 ℃, 17 hours.

(b) XhoI-digestion: M1, low scope PFG mark; Swimming lane 1-8, double pEBAC/148 ∷ kan140 clone; P, parental generation pEBAC/148 clone; M2, medium range IPEG mark.PFGE condition: 6V/cm, be 0.1-8.0 second switching time, 14 ℃, 18 hours.

DESCRIPTION OF THE PREFERRED

The present invention part based on: but by in host cell, importing the exonuclease of expressing modulation level, the nucleotide sequence of recombinant protein and recBCD ribozyme inhibitor, and the development of the method for at least two nucleotide sequences of homologous recombination in host cell.Must express recBCD ribozyme inhibitor suppressing the linear DNA degrading activity of recBCD ribozyme, described recBCD ribozyme is by such as the host cell endogenous expression of coli strain DH10B.Therefore, method of the present invention based on can modulate and induce the homologous recombination system synergistically and suppress the recBCD ribozyme activity.The appearance of inducible system that can be synthetic and collaborative is for using homologous recombination methodology particularly advantageous in following host cell, described host cell is to one or more recombination system molecules of overexpression or recBCD inhibitor sensitivity.Needing homologous recombination to contain under the nucleotide sequence situation of F-plasmid part, above-mentioned inducible system is also very suitable.

Term " exonuclease " should be understood that to refer to by exposing strand zone on the double-strandednucleic acid sequence is convenient to the molecule of homologous recombination, and described zone is to realize that the reorganization between the complementary region of this zone and another nucleotide sequence is necessary.Exonuclease is suitable for using with selected recombinant protein.

The example that is applicable to exonuclease of the present invention includes but not limited to: is called as the Red λ recombination system exonuclease of exo and is called as the recE/recT recombination system molecule exonuclease of recE, or its functional deriv.Preferred described exonuclease is recE or its functional deriv.Term " recombinant protein " should be understood that to refer to: peptide, polypeptide or the protein of homologous recombination is convenient in the reorganization between the complementary region of the strand zone by mediating a nucleotide sequence (as the strand zone that produces by exonuclease) and another nucleotide sequence.The example of recombinant protein includes but not limited to Red λ recombinant protein bct and recE/recT recombinant protein recT or its functional deriv.To the encode nucleotide sequence of recE and recT of this paper is called recE and recT.

Therefore, the present invention more particularly provides the method for being convenient to carry out homologous recombination between at least two nucleotide sequences, described method comprises: by cultivate host cell under the condition that enough helps at least two nucleotide sequences of homologous recombination, in host cell, to induce the reorganization between described at least two nucleotide sequences, wherein said host cell can be expressed recBCD, recE, the nucleotide sequence of recT and coding recBCD inhibitor or its functional deriv, recE, the expression of the nucleotide sequence of recT and coding recBCD inhibitor is can be synthetic.

Term " expression " refers to transcribes and translates nucleotide sequence, causes peptide, polypeptide or proteinic synthetic.

Term " gene of coding recBCD inhibitor " should be understood that to refer to a kind of nucleotide sequence, the expression product of its coding can suppress or fully reduce the activity of recBCD ribozyme, thereby the linear DNA sequence can not degraded by this ribozyme, and its homologous recombination is taken place.The example that is applicable to recBCD inhibitor of the present invention includes but not limited to gam, P22Aba protein or SSB protein or its functional deriv.Preferred described recBCD inhibitor is gam.To the encode nucleotide sequence of gam of this paper is called gam.

According to this preferred embodiment, the invention provides the method for being convenient between at least two nucleotide sequences, carry out homologous recombination, described method comprises: by cultivate host cell under the condition that enough helps at least two nucleotide sequences of homologous recombination, in host cell, to induce the reorganization between described at least two nucleotide sequences, wherein said host cell can be expressed recBCD, recE, recT and gam or its functional deriv, recE, the expression of recT and gam is can be synthetic.

Term " host cell " should be understood that to refer to and can be transformed by nucleotide sequence or any protokaryon or the eukaryotic cell of transfection.For example, what this paper wished is the host cell that is applicable to the clone and/or expresses nucleotide sequence, for example can be used for producing the host cell in gDNA or cDNA library, perhaps can be used for cloning the host cell of the carrier that contains required dna sequence dna inset.According to the present invention, host cell is preferably the cell of expressing recBCD ribozyme (also being referred to as " exonuclease V "), the described ribozyme linear dsdna of can degrading especially.Host cell can be because of expressing natural recBCD gene, or because of expressing recBCD with nucleic acid molecule conversion or the transfection host cell of coding recBCD.

Need not the present invention is limited to any theory or binding mode, the inventor has measured some host cell bacterial strain to excessive generation (producing as composing type) recBCD inhibitor and/or one or more homologous recombination system molecule sensitivities.It is impaired in some way that " sensitivity " refers to host cell, for example reduces its viability or desirably do not modulate its one or more functionally activies.For example, found that composing type produces recBCD inhibitor gam meeting toxigenicity in the DH10B host cell, promptly the viability of DH10B cell reduces.Can modulation and collaborative wherein the recombination system molecule and the recBCD inhibitor body of expressing in the exploitation of recombination system overcome this toxicity problem.Therefore, in preferred embodiments, host cell is that composing type is produced one or more recBCD inhibitor, the host cell of exonuclease or recombinant protein sensitivity.More preferably described host cell is DH10B or its mutant or its homologue.

The present invention prolongs and uses mutant host cell body and homologue.

According to this most preferred embodiment, the invention provides the method for being convenient between at least two nucleotide sequences, carry out homologous recombination, described method comprises: by cultivate host cell under the condition that enough helps at least two nucleotide sequences of homologous recombination, in host cell, to induce the reorganization between described at least two nucleotide sequences, wherein said host cell can be expressed recBCD and coding exonuclease, the nucleotide sequence of recombinant protein and recBCD inhibitor or derivatives thereof, exonuclease, the expression of recombinant protein and recBCD inhibitor is can be synthetic.

More preferably described exonuclease is recE, and described recombinant protein is recT, and described recBCD inhibitor is gam.

Term " at least two nucleotide sequences " should be understood that to refer to: desire is carried out any two or more nucleotide sequences of homologous recombination by method of the present invention.Described nucleotide sequence can be a nucleic acid molecule independently, as two annular carriers (as two plasmids), plasmid and linear DNA sequence or karyomit(e) and linear DNA sequence.Perhaps, nucleotide sequence can be two parts of single nucleic acid molecule, for example the linearity of the single nucleic acid molecule that produces in the rolling-circle replication process and ringed nucleus nucleotide sequence part.Preferred nucleotide sequence is ringed nucleus nucleotide sequence and linear kernel nucleotide sequence.In this context, " annular " nucleotide sequence should be understood that to refer to the ringed nucleus nucleotide sequence part of any nucleic acid molecule.For example, the ringed nucleus nucleotide sequence can be complete annular, and for example plasmid perhaps also can be part annular, for example annular section of the nucleic acid molecule that produces in the rolling-circle replication process.In this context, " annular " nucleotide sequence is equivalent to the annular section of this molecule.Preferred ringed nucleus acid sequence is BAC or PAC type artificial chromosome." linearity " nucleotide sequence should be understood that to refer to any nucleotide sequence that is essentially linear.Linear order can be linear nucleic acid molecule, or also contains the linear portion of the nucleic acid molecule of non--linear portion (as annular section).The example of linear kernel nucleotide sequence includes but not limited to: PCR product, cleaved products, the linear portion of synthetic DNA or the nucleic acid molecule that produces in the rolling-circle replication process.The reorganization of linear kernel nucleotide sequence and ringed nucleus nucleotide sequence can import for example selective marker or specific sudden change in the ringed nucleus nucleotide sequence.Should understand homologous recombination of the present invention can take place between the nucleotide sequence in being imported into cell, also can take place between the natural nucleotide sequence that is present in nucleotide sequence in the cell and one or more importings.

Therefore, the invention provides the method for being convenient between ringed nucleus nucleotide sequence and linear kernel nucleotide sequence, carry out homologous recombination, described method comprises: by cultivate host cell under the condition that enough helps homologous recombination ringed nucleus nucleotide sequence and linear kernel nucleotide sequence, in host cell, to induce the reorganization between described ringed nucleus nucleotide sequence and the described linear kernel nucleotide sequence, wherein said host cell can be expressed recBCD and coding exonuclease, the nucleotide sequence of recombinant protein and recBCD inhibitor or derivatives thereof, exonuclease, the expression of recombinant protein and recBCD inhibitor is can be synthetic.

Preferred described host cell is the DH10B cell.More preferably described exonuclease is recE, and described recombinant protein is recT, and described recBCD inhibitor is gam or its functional deriv.

According to this preferred embodiment, the invention provides the method for being convenient between ringed nucleus nucleotide sequence and linear kernel nucleotide sequence, carry out homologous recombination, described method comprises: by cultivate DH10B cell or its homologue or its mutant under the condition that enough helps homologous recombination ringed nucleus nucleotide sequence and linear kernel nucleotide sequence, in DH10B cell or its homologue or its mutant, to induce the reorganization between described ringed nucleus nucleotide sequence and the described linear kernel nucleotide sequence, wherein said DH10B cell or its homologue or its sudden change physical efficiency are expressed recBCD, recE, recT and gam or its functional deriv, recE, the expression of recT and gam is can be synthetic.

Nucleotide sequence of the present invention preferably derives from human genome, but also comprises genome and the nucleotide sequence of non-human animal and plant among the present invention.The non-human animal who comprises among the present invention comprises: primate, domestic animal (as sheep, milk cow, pig, goat, horse, donkey), the laboratory test animal is (as mouse, rat, cavy, hamster, rabbit), pet (as dog, cat), and birds (as chicken, goose, duck and other poultry, the bird that can hunt, emu, ostrich) and see foster wild or domesticate animals (as fox, kangaroo, Australia state wild dog).

The inventor has measured homologous recombination of the present invention system and has been suitable at least two nucleotide sequences of reorganization, and wherein at least one described nucleotide sequence contains F-plasmid part.The nucleotide sequence that " contains " F-plasmid part should be understood that to refer to: merge with all or part of F-plasmid, in conjunction with or otherwise the nucleotide sequence that is connected.For example, required nucleotide sequence can be positioned at carrier, and the skeleton of described carrier contains the sequence corresponding to all or part of F-plasmid.For example, contain required genome sequence based on the BAC of F-plasmid, this sequence is positioned at expresses wild-type F-plasmid replication starting point and coding parA, in the carrier of the nucleotide sequence of parB and parC.

Therefore, in a further preferred embodiment, the invention provides the method for being convenient between at least two nucleotide sequences, carry out homologous recombination, wherein at least one described nucleotide sequence contains F-plasmid part, described method comprises: by cultivate host cell under the condition that enough helps at least two nucleotide sequences of homologous recombination, in host cell, to induce the reorganization between described at least two nucleotide sequences, wherein said host cell can be expressed recBCD and coding exonuclease, the nucleotide sequence of recombinant protein and recBCD inhibitor or derivatives thereof, exonuclease, the expression of recombinant protein and recBCD inhibitor is can be synthetic.

The described nucleotide sequence that preferably contains F-plasmid part is BAC.

More preferably described host cell is DH10B or its mutant or its homologue.

The BAC/PAC cloning system is convenient to study the mammalian genes group via the transgenosis of big genomic fragment, and described segment demonstrates correct time and tissue-expression of specific gene.Therefore, big-inset BAC/PAC cloning system has been widely used in the physical map of length-scope and has drawn, the positional cloning of disease gene, whole genome order-checking plan and functional study.Therefore, produced the BAC/PAC intestinal bacteria library of human gene group DNA and other animal and plant (comprising baboon, dog, ox, sheep, goat and paddy rice) genomic dna.In by the coli strain DH10B of the reorganization-damaged of detailed-definition, generally can keep the BAC/PAC of 1-2 copy in each cell.Because people are to the linear DNA section is modified BAC and PAC is very interested by importing, therefore, particularly preferred embodiment of the present invention relates to via linear DNA section homologous recombination is modified BAC or PAC to BAC or PAC.

According to this most preferred embodiment, the invention provides the method for being convenient between BAC and linear kernel nucleotide sequence, carry out homologous recombination, described method comprises: by cultivate host cell under the condition that enough helps homologous recombination BAC and linear kernel nucleotide sequence, in host cell, to induce the reorganization between described BAC and the described linear kernel nucleotide sequence, wherein said host cell can be expressed recBCD and coding exonuclease, the nucleotide sequence of recombinant protein and recBCD inhibitor or derivatives thereof, exonuclease, the expression of recombinant protein and recBCD inhibitor is can be synthetic.

Preferred described host cell is DH10B cell or its mutant or its homologue.More preferably described exonuclease is recE, and described recombinant protein is recT, and described recBCD inhibitor is gam.

In another the most preferred embodiment, the invention provides the method for being convenient between PAC and linear kernel nucleotide sequence, carry out homologous recombination, described method comprises: by cultivate host cell under the condition that enough helps homologous recombination PAC and linear kernel nucleotide sequence, in host cell, to induce the reorganization between described PAC and the described linear kernel nucleotide sequence, wherein said host cell can be expressed recBCD and coding exonuclease, the nucleotide sequence of recombinant protein and recBCD inhibitor or derivatives thereof, exonuclease, the expression of recombinant protein and recBCD inhibitor is can be synthetic.

Method of the present invention comprises with any or multiple recBCD, the nucleotide sequence of coding exonuclease and recombinant protein, and nucleotide sequence and at least two nucleotide sequences of coding recBCD inhibitor transform host cell of the present invention.As for needs how many above-mentioned molecules are imported host cell so that operate method of the present invention, this depends on related specific end use.For example, about the recE/recT recombination system that exemplifies, need to use to derive from the host cell population that is purchased BAC or PACDH10B library.By with BAC or PAC molecule and the reorganization of linear kernel nucleotide sequence, can modify BAC or PAC molecule, described nucleotide sequence is with coding recE, after the nucleic acid molecule of recT and gam transforms and import and be purchased the DH10B library clone.DH10B cell endogenous expression recBCD.Perhaps, expressed recBCD, when recE, the host cell of the nucleotide sequence of recT and coding recBCD inhibitor, only to have needed with non-existent nucleotide sequence transformed host cell in the nucleotide sequence for the treatment of homologous recombination and the host cell when using.These host cells can be expressed recBCD, recE, and the nucleotide sequence of recT and coding recBCD inhibitor, its reason is that cell can be expressed any or multiple these molecules after transforming, perhaps cell can these molecules of endogenous expression.

The method according to this invention, exonuclease, the expression of recombinant protein and recBCD inhibitor is can be synthetic.So just can instantaneous and these protein of coordinate expression." can be synthetic " refers to: these proteinic expression of gene of encoding can transcribe or translation skill on be upward or downward.Modulate by any can the realization in the multiple technologies, described technology includes but not limited to regulate promoter expression or adjusting methylates.For example, exemplify as this paper, with the DH10B cell that derivable expression plasmid pGETrec transfection is transformed by the BAC nucleic acid molecule, pGETrec contains and is under the control of derivable L-arabinose promotor coding recE, the nucleic acid molecule of recT and gam.By in the presence of L-arabinose, cultivating these cells, can induce the expression of pGETrec plasmid.Subsequently, with double-stranded linear DNA (as PCRkan140) electroporation to these cells, the homologous recombination that causes PCRkan140 and pEBAC140, why homologous recombination can take place is because moved recE/recT homologous recombination system, has also suppressed the recBCD ribozyme activity by the gam expression product simultaneously.In case finished homologous recombination, can from the substratum that is rich in L-arabinose, extract the DH10B cell that is tried, the expression of taking this to reduce the pGETrec plasmid.So just can close the activity of recE/recT homologous recombination approach.

Although the present invention for example be that single plasmid is imported host cell, described plasmid contains the nucleotide sequence recE that is under the inducible promoter control, (recE promptly encodes for recT and gam, the nucleic acid molecule of recT and gam can be operated with total promotor and link to each other), but should understand method of the present invention and can extend to the two or more recE that independently contain of use, the carrier of recT and gam.Yet in order to express recE synergistically simultaneously, recT and gam need to utilize recE by for example, and each all identical inducible promoter among recT and the gam guarantees to induce simultaneously recE, the expression of recT and gam.Therefore, recE/recT homologous recombination system has functionally active, and the recBCD ribozyme activity is subjected to the inhibition of gam simultaneously.

Term " is convenient to " homologous recombination and should be understood that to refer to: induce, strengthen or otherwise act on the feature operation of homologous recombination system.For example, recE and recT expression product are induced the reorganization based on recE/recT, and the gam expression product suppresses the recBCD ribozyme activity, the described ribozyme linear DNA of degrading, thus prevent its reorganization.

Need not the present invention is limited to any theory or binding mode, pGETrec can coexist with BAC/PAC is stable in intestinal bacteria DH10B cell.Utilize pGETrec, can between linear nucleic acid fragment and scoring ring forming core acid molecule, carry out efficient homologous recombination.When homology length was 140bp by the 50bp growth, the effectiveness of homologous recombination was improved.In addition, it is believed that by using non--contiguous sequence in the target homology zone that the effectiveness with the BAC/PAC homologous recombination is significantly increased.

The present invention should be understood that and can extend to: import host cell by protein or its functional deriv that will be convenient to homologous recombination, rather than these proteinic nucleic acid molecule of abduction delivering are imported host cell, and induce homologous recombination in vivo.For example, imagination is with recE, and recT and gam albumen or its functional deriv are with the collaborative importing of the nucleotide sequence host cell as the reorganization main body.Also imagined the method for the present invention of implementing, wherein in host cell, expressed some homologous recombination protein mappings, and with remaining with proteinic form transfered cell.For example, imagination is at host cell inner expression recE and recT or its functional deriv, and the collaborative simultaneously gam albumen that imports.Of the present invention should be understood that in this respect to extend to transmit any or multiple exonuclease, recombinant protein or recBCD inhibitor or its functional deriv.

" derivative " comprises natural, the fragment of synthetic or recombinant sources, and part, chemical equivalent, mutant, homologue, analogue, stand-in comprise fusion rotein.Can be by aminoacid insertion, disappearance or replacement obtain derivative.The aminoacid insertion derivative comprises amino and/or C-terminal fusions, and inserts single or multiple amino acid in the sequence.Insert the aminoacid sequence variant and import one or more amino-acid residues and obtain, but insert one or more amino-acid residues at random, and suitably screen products therefrom and also be fine at proteinic predetermined site.The disappearance variant is characterised in that has removed one or more amino acid from sequence.The substituted amino acid variant is at least one residue of removing in the sequence, and inserts different residues in this position and obtain.The interpolation of aminoacid sequence comprises and other peptide that polypeptide or protein merge.

The derivative of described nucleotide sequence and expression product (being called as " component ") comprises the fragment with defined epitope, or and peptide, the part of the complete component that polypeptide or other protein or non--protein molecule merge.For example, described component or derivatives thereof can be convenient to its molecule that enters cell and merge.This paper expects that the analogue of described component includes but not limited to the modification to side chain, at synthetic peptide, mix alpha-non-natural amino acid and/or its derivative in polypeptide or the proteinic process, use linking agent and other protein molecule or its analogue to be applied the method for conformation restriction.Similarly, the derivative of nucleotide sequence can derive from single or multiple Nucleotide and replace, and disappearance and/or interpolation comprise and other nucleic acid molecule merges.The derivative of nucleic acid molecule of the present invention comprises oligonucleotide, the PCR primer, and antisense molecule is applicable to the molecule of common inhibition and integrative nucleic acid molecule.

The example that the desired side chain of the present invention is modified comprises: by for example with aldehyde reaction, then use NaBH ₄Reduction is modified amino to carry out reductive alkylation; With methyl acetimide (methylacetimidate) amidineization; Use acetic anhydride acylation; With cyanate carbamoylation amino; With 2,4,6-trinitro-benzene-sulfonic acid (TNBS) makes amino trinitrobenzeneization; Make amino acidylate with succinyl oxide and tetrahydronaphthalic anhydride; With usefulness pyridoxal 5-phosphate pyridoxal Methionin, then use NaBH ₄Reduction.

Can by with such as 2, the 3-dimethyl diketone, phenyl oxalic dialdehyde and oxalic dialdehyde reagent form the heterocycle condenses and modify the guanidine radicals of arginine residues.

Activate carbodiimide through forming O-acyl group isourea, then deriving for example turns to corresponding amide and can modify carboxyl.

Can modify the sulphydryl group by following method, described method as: with iodoacetic acid or iodo-acid amide carboxymethylation; With performic oxidation is cysteic acid; Mix disulphide with other sulfur alcohol compound formation; With maleimide, the reaction of the maleimide of maleic anhydride or other replacement; Use the 4-chloromercuri-benzoate, the 4-chloromercuribenzene sulfonate, phenylmercuric chloride, 2-chlorine mercury-4-nitrophenols and other mercury compound form the derivative of mercury compound; Under alkaline pH, use the cyanate carbamoylation.

By for example modifying tryptophan residue with the succinimide oxidation of N-bromine or with 2-hydroxyl-5-nitrobenzyl bromine or sulphenyl halogenide alkylated indoles ring.On the other hand, can be by changing tyrosine residues with the nitrated formation of tetranitromethane 3-nitrotyrosine derivative.

By with the alkylation of iodoacetic acid derivative or can modify the imidazole ring of histidine residues with diethyl coke acid N-carbon ethoxyquin.

The alpha-non-natural amino acid that mixes in the process of synthetic protein and the example of derivative include but not limited to: use nor-leucine, the 4-aminobutyric acid, 4-amino-3-hydroxyl-5-phenylpentanoic acid, 6-aminocaprolc acid, t-butyl glycine, norvaline, phenylglycocoll, ornithine, sarkosine, 4-amino-3-hydroxy-6-methylheptanoic acid, 2-thienyl alanine and/or amino acid whose D-isomer.Table 1 shows the desirable alpha-non-natural amino acid of this paper.The unconventional amino acid code of the unconventional amino acid code of table 1 butyrine Abu L-N-methylalanine Nmala alpha-amino group-Alpha-Methyl Mgabu L-N-methylarginine Nmarg butyric acid amino-cyclopropane first Cpro L-N-methylarginine Nmasn acid

The amino normal borneol base of L-N-methylaspartic acid Nmasp aminoisobutyric acid Aib L-N-methyl halfcystine Nmcys Norb L-N-methyl glutamine Nmgln carboxylic acid

The sweet ammonia Nmetg of L-N-methyl glutamic acid N mglu Cyclohexylalanine Chexa L-N-methylhistidin Nmhis cyclopenta alanine Cpen L-N-methyl isoleucine NmileD-alanine Dal L-N-methylleucine NmleuD-arginine Darg L-N-methyllysine NmlysD-aspartic acid Dasp L-N-methylmethionine NmmetD-cysteine Dcys L-N-methyl nor-leucine NmnleD-glutamine Dgln L-N-methyl norvaline NmnvaD-glutamic acid Dglu L-N-methyl ornithine NmornD-histidine Dhis L-N-methylphenylalanine NmpheD-isoleucine Dile L-N-methylproline NmproD-leucine Dleu L-N-methyl serine NmserD-lysine Dlys L-N-methylthreonine NmthrD-methionine Dmet L-N-methyl tryptophan NmtrpD-ornithine Dorn L-N-methyl-tyrosine NmtyrD-phenylalanine Dphe L-N-methylvaline NmvalD-proline Dpro L-N-Methylethyl

Acid D-Serine Dser L-N-methyl-t-butyl Nmtbug

Glycine D-Threonine Dthr L-nor-leucine NleD-tryptophane Dtrp L-norvaline NvaD-tyrosine Dtyr Alpha-Methyl-aminoisobutyric Maib

Acid D-Xie Ansuan Dval Alpha-Methyl-gamma-amino fourth Mgabu

D-α- Dmala α- Mchexa D-α- Dmarg α- Mcpen D-α- Dmasn α--α- Manap D-α- Dmasp α- MpenD-α- Dmcys N- ( 4- ) Nglu D-α- Dmgln N- ( 2- ) Naeg D-α- Dmhis N- ( 3- ) Norn D-α- Dmile N--α- Nmaabu D-α- Dmleu α- AnapD-α-Dmlys N- NpheD-α-Dmmet N- ( 2- Ngln ) D-α-Dmorn N- ( ) Nasn D-α-Dmphe N- ( 2- ) Nglu D-α-Dmpro N- ( ) NaspD-α-Dmser N- NcbutD-α-Dmthr N- NchepD-α-Dmtrp N- NchexD-α-Dmty N- NcdecD-α-Dmval N- Ncdod D-N- Dnmala N- NcoctD-N- Dnmarg N- NcproD-N- Dnmasn N-Ncund D-N- Dnmasp N- ( 2； 2-diphenyl second Nbhm propylhomoserin base) glycine D-N-methyl half Guang Dnmcys N-(3; 3-Nbhe ) D-N- Dnmgln N- ( 3- ) Narg D-N-Dnmglu N- ( 1- ) Nthr D-N-Dnmhis N- ( ) Nser D-N-Dnmile N- ( ) Nhis D-N-Dnmleu N- ( 3- ) Nhtrp D-N-Dnmlys N--γ- Nmgabu N-Nmchexa D-N- DnmmetD-N-Dnmorn N- Nmcpen N-Nala D-N- DnmpheN-Nmaib D-N- DnmproN- ( 1- Nile D-N- Dnmser ) N- ( 2- Nleu D-N- Dnmthr ) D-N-Dnmtrp N- ( 1- ) Nval D-N-Dnmtyr N-- Nmanap D-N-Dnmval N- Nmpenγ- Gabu N- ( p- ) Nhtyr L-t- Tbug N- ( ) Ncys L- Etg PenL- Hphe L-α- MalaL-α-Marg L-α- MasnL-α-Masp L-α--t- Mtbug L-α-Mcys L- MetgL-α-Mgln L-α- MgluL-α-Mhis L-α- Mhphe L-α-Mile N- ( 2- Nmet ) L-α-Mleu L-α- MlysL-α-Mmet L-α- MnleL-α-Mnva L-α- MornL-α-Mphe L-α- MproL-α-Mser L-α- MthrL-α-Mtrp L-α- MtyrL-α-Mval L-N- Nmhphe N- ( N- ( 2； (N-(3 for 2-two Nnbhm N-; 3-diphenyl Nnbhe phenylethyl) ammonia first propyl group) carbamyl formoxyl methyl) sweet amino) glycine acid 1-carboxyl-1-Nmbc (2,2-diphenyl-ethyl amino) cyclopropane

Can use linking agent to come stabilization 3D conformation, for example can use, as have (CH2) with-bi-functional cross-linking agent _nThe difunctional imido-ester of (n=1 to n=6) spacer, glutaraldehyde, N-hydroxy-succinamide ester and different-bifunctional reagent, described reagent contains amino-reactive moiety usually, as N-hydroxy-succinamide and another group specificity-reactive moiety, as maleimide or dithio moiety (SH) or carbodiimide (COOH).In addition, can limit the conformation of peptide by the following method, for example mix C _αAnd N _α-methylamino acid is at amino acid whose C _αAnd C _βImport two keys between the atom,, for example between N and C-terminal, form amido linkage between two side chains or between side chain and N or the C-terminal, and form cyclic peptide or analogue by importing covalent linkage.

Method of the present invention can be used as simple and otherwise effective technique, imports any required modification in any position such as the annular DNA clone of BAC or PAC, and can not cause unnecessary rearrangement.For example, can use this method to modify, maybe can cause the pathological specific sudden change of people as importing selective marker.Method of the present invention makes the circular DNA molecule (as BAC/PAC) that will clone be transferred to other coli strain to carry out the minimizing that needs of homologous recombination.The needs that produce specific shuttle vectors have also been reduced simultaneously.This method is enough simple, makes to reuse this method to form complicated variation to any single clone.Can modify so that reporter gene or any other required sequence are included in the ringed nucleus acid molecule this method.

The accurate cell and the essential minimum degree of the animal model ground that produce specific mutant disturb normal gene structure.Can use recombination method of the present invention, import the specific mutant that gene structure is changed with two-footwork.At first, import the PCR product carry tsiklomitsin at target site, or import contain with second anti--selective marker (as ccdB, the box of the microbiotic selective marker that sacB) is connected, subsequently, in second step, accurately knock out the importing thing of the first step with the genomic fragment that only carries required modification.Lose the clone of tetracycline gene or second selective marker by anti-selection, can easily obtain correct product ^33,39,43According to the target site of integrating in the circular DNA molecule, these methods can make very sensitive detection system can monitor multiple sequential element and sudden change to genetic transcription, montage and the tissue of being expressed by the full functionality locus and the influence of development-specific.These technology are convenient to develop purpose and are with the tissue of increase and the method for pharmacy of locus-specific change genetic expression, and human artificial chromosome's exploitation is become the instrument of alleviating or curing multiple human genetic diseases.The accurate animal model that generation has normal and functional mutant locus also helps gene therapy method, and described gene therapy method comprises that gene is added or the correcting mutant locus.

Another aspect of the present invention provides the method for being convenient at least two nucleotide sequences of homologous recombination in host cell, and described method comprises step:

Preferred described exonuclease is recE, and described recombinant protein is recT, and the gene of described coding recBCD inhibitor is gam.

More preferably described at least two nucleotide sequences are nucleotide sequence and the linear kernel nucleotide sequences that contain F-plasmid part.The nucleotide sequence of the more preferably described F-of containing plasmid part is BAC.

Most preferably described host cell is DH10B or its mutant or its homologue.

More preferably described at least two nucleotide sequences are nucleotide sequence and the linear kernel nucleotide sequences that contain F-plasmid part.The ringed nucleus nucleotide sequence of the more preferably described F-of containing plasmid part is BAC.

More preferably described host cell is DH10B or its mutant or its homologue.

On the other hand, the invention provides the cell of being convenient at least two nucleotide sequences of homologous recombination, described cell contains the coding exonuclease, the gene of the nucleotide sequence of recombinant protein and coding recBCD inhibitor, exonuclease wherein, the expression of recombinant protein and recBCD inhibitor is can be synthetic, and described cell also contains nucleotide sequence and described at least two nucleotide sequences of the recBCD that encodes.

More preferably described host cell is DH10B or its mutant or its homologue.

Preferred described modified nucleic acid molecule is modified BAC or modified PAC.

The present invention also extends to the purposes that described modified nucleic acid molecule is used for the treatment of and/or diagnoses the patient.Methods of treatment comprises the gene therapy scheme.The present invention also extends to the screening method of essential described modified nucleic acid molecule.

Therefore, on the other hand, the invention provides pharmaceutical composition, it contains the modified nucleic acid molecule that produces by the inventive method, and one or more drug acceptable carriers and/or thinner.

In the most preferred embodiment, expression vector is provided, it contains basically as shown in Figure 3 gene construct or its functional deriv.

In this respect test kit should be understood that to extend to according to the present invention: the test kit that contains proteinic nucleotide sequence combination of one or more recombination systems of coding or recombination system protein self combination.

Following non--further feature of the present invention has more completely been described among restrictive figure and/or the embodiment.Yet, should understand and comprise that this detailed description only is in order to demonstrate the invention.

Embodiment 1 in intestinal bacteria DH10B cell with PCR fragment homologous recombination to the derivable recE approach of annular substrate

In sbcA recBC bacterial strain JC8679 and JC9604, the recE approach of the homologous recombination between the linear and annular substrate has activity ^42-45This approach does not rely on recA ⁴⁶, because as if the recT gene can finish recA and the effect of homologous sequence paired ⁴⁷In these cells, the kalamycin resistance (Km of 50bp flank homology arm will be carried ^r) gene (PCRkan50) the PCR fragment accurately homologous recombination to chlorampenicol resistant (Cm ^r) in the skeleton of pEBAC140 carrier, produce pEBAC140 ∷ kan50.Yet, the 200kbpEBAC/148-globin in DH10B cell clone can not be transferred to JC9604 electroreception attitude cell to carry out modification subsequently, suppose that this is due to two host restriction differences between the bacterial strain.Because BAC/PAC can normally keep in the DH10B cell, can directly carry out any modification in carrying the DH10B cell of required BAC/PAC, and need not to have to each BAC/PAC is transferred to another coli strain.Yet, the PCRkan50 electroporation can not produced any Cm to DH10B (pEBAC140) ^rKm ^rRecon.In the DH10B cell, the 1450bp PCR fragment PCR kan140 that carries about 140bp flank homology arm recombinated to the pEBAC140 skeleton also can not obtain recon.

With pBAD24-recET plasmid electroporation to DH10B (pEBAC140) cell, described plasmid carries recE and the recT gene that is under the control of induction type pectinose promotor, selects to carry the clone of two kinds of plasmids on penbritin and paraxin substratum.Use carries the single bacterium colony DH10B of two kinds of plasmids, and (pBAD24-recET pEBAC140) induces with L-arabinose in the process of culturing cell and prepares electroreception attitude cell.The PCRkan50 electroporation is not obtained Cm yet to these cells ^rKm ^rRecombinant clone.

The PCR fragment that carries the gam gene is inserted the pBAD24-recET plasmid, produce plasmid pGETrec (Fig. 3).The gam gene is placed under the control of the L-arabinose-inducible promoter identical with the recT gene, with co-induction recE approach with the recBCD ribozyme activity on the linear dsDNA that suppresses to produce with recE.Derivable expression plasmid pGETrec is imported the electroreception attitude DH10B cell that has carried pEBAC140.Except beginning adds L-arabinose during inoculating cell in growth medium, with the standard method preparation carry two kinds of plasmids electroreception attitude cell DH10B (pGETrec, pEBAC140).The PCRkan140 electroporation to these cells, from twice independently the electroporation, is respectively obtained 300 recons (table 1, experiment 1,2) nearly.Carry out Restriction Enzyme digestion with XhoI or HindIII, the recon of 12 random chooses is carried out pcr analysis, the result shows each Cm ^rKm ^rRecon is all with the correct target site of PCRkan140 homologous recombination to the pEBAC140, and without any the sign of unnecessary rearrangement.The dna sequencing that flank is carried out in the homology zone of kanamycin gene has confirmed this point.Although on paraxin/kantlex substratum, cultivate in the process of these recons, the pGETrec plasmid is not selected, in different clones, the coexistence of the pEBAC140 ∷ kan140 plasmid of this multiple copied plasmid of variable quantity and single copy.

Embodiment 2 clones PCRkan50 and PCRkan140 homologous recombination in the carrier framework of pEBAC/148 to the 200kb beta-globin in the DH10B cell

We attempt using PCRkan140 to modify 200kb beta-globin clone pEBAC/148, and are big to determine whether using same procedure to modify, the BAC clone of single copy.With the pGETrec electroporation to DH10B (pEBAC/148) cell.Use carries clone DH10B (pGETrec, pEBAC/148) the preparation electroreception attitude cell of two kinds of plasmids.With L-arabinose inducing cell 40 minutes, collecting cell then, preparation electroreception attitude cell.To these cells, each electroporation produces and surpasses 1000 Cm with the PCRkan140 electroporation ^rKm ^rRecon (table 1,

experiment

3,4).When before preparation electroreception attitude cell, when when beginning to cultivate, using the L-arabinose inducing cell, with not obtaining Cm after the PCRkan140 electroporation ^rKm ^rRecon.Induce down at L-arabinose, prolong overexpression recE, the time of recT and gam gene is poisonous to the DH10B cell.As if for the cell that carries the pEBAC140 carrier, the cell that carries 200kb BAC is induced responsive more to prolongation.

By directly being carried out PCR, the incubated overnight base analyzes 20 independently Cm ^rKm ^rBacterium colony.Design primer 140KA and 140KB are to produce the 1555bp product by pEBAC/148 ∷ kan140.20 Cm of all that analyzed ^rKm ^rBacterium colony has all produced the PCR product (Fig. 6) of expection.Parental generation pEBAC/148 is cloned with comparing.Contrast PCR is produced the 393bp fragment of expection by pEBAC/148.None produces this fragment recombinant clone, if the integration of PCRkan140 occurs in any other position of bacterial chromosome, should also can detect this fragment.Therefore, pcr analysis shows that recombination event accurately occurs in each of 20 independent clonings.

From 6 these Cm ^rKm ^rDNA isolation in the bacterium colony.Reclaim the pEBAC/148 ∷ kan140 BAC of multiple copied pGETrec plasmid big and variable quantity and single copy simultaneously, the restrictive diges-tion of BAC has hindered this process.With the 1 microlitre DNA that derives from 4 clones again-electroporation is to the DH10B cell, causes each clone to produce much independently secondary Cm ^rKm ^rBacterium colony.DNA isolation from 2 secondary clones of independence of each original clone is with analyzing (Fig. 7) by pulsed field gel electrophoresis after NotI or the XhoI digestion.All 8 secondary clones only contain big BAC, and this shows that the kalamycin resistance mark has been the integrated part of pEBAC/148 in these clones.(Fig. 7 a) demonstrates the 185kb beta-globin inset that all 8 secondary clones discharge expection, can not produce any significant rearrangement in NotI digestion.With respect to parental generation clone pEBAC/148 for the carrier band of NotI-digestion, all 8 clones also have faint but significantly increase through the size of the carrier band of NotI-digestion, be equivalent to PCRkan140 and be integrated into after its target site, the expection of carrier band size changes.After the XhoI restrictive diges-tion, further analyze these 8 clones (Fig. 7 b).Except only in parental generation pEBAC/148 clone observed about 70kb fragment, all clones demonstrate and contrast parental generation pEBAC/148 and clone identical restriction fragment.As if in 8 secondary clones, the fragment of 70kb is cut into and is respectively 30 and two fragments of 40kb.The fragment of 40kb and another are present among the parental generation pEBAC/148 clone, and the fragment that length is about 40kb is total to-migration, and therefore, the 40kb that is produced with respect to parental generation pEBAC/148 clone brings Cm ^rKm ^rBe cloned in this position and produced significantly stronger band.Owing to do not contain the XhoI site on the skeleton of parental generation carrier, the 70kb fragment must derive from carrier framework and with globin sequence contiguous.By homologous recombination PCRkan140 is integrated into after the carrier framework, the single XhoI site that exists in kanamycin gene cuts into two less fragments with the 70kb fragment.

These results confirm: at all 4 original Cm ^rKm ^rAmong the clone, integrate PCRkan140 by homologous recombination and correctly occur in target site on the carrier framework.In addition, obviously, in the process of this method, none clone demonstrates any unstable, this shows in the DH10B cell, the risk minimization of the unnecessary rearrangement in cloning with the instantaneous BAC that induces homologous recombination to make size be at least about 200kb of pGETrec plasmid.Analyze in more detail integrating used homology zone by homologous recombination.In pEBAC/148 ∷ kan140 clone and pEBAC140 ∷ kan50 clone, cross over flank and check order in the homology zone of kanamycin gene, the result does not disclose any expected sequence part that is different from.

The PCR product that has confirmed to mix the homology zone that is as short as 50bp is recombinated to JC8679 or JC9604 coli strain with good efficiency ^42,43This makes can be by synthetic 70-80-aggressiveness any required fragment that increases, and by electroporation described fragment is directly imported target site, and wherein said 70-80-aggressiveness carries 50bp and target site (being positioned at primer 5 ' end) homologous zone.By (pGETrec, pEBAC/148) cell are tested this method in existing system, only used the L-arabinose inducing cell 40 minutes in preparation process to DH10B with the PCRkan50 electroporation.From each electroporation, obtain surpassing 100 Cm ^rKm ^rBacterium colony (table 1,

experiment

5,6).Use primer 140KF and 140KR, directly screen 20 independently Cm by PCR ^rKm ^rThe overnight culture of bacterium colony produces correct 1450bp product.

Although for 140-aggressiveness target site, use the recombination frequency of 50-aggressiveness target site to reduce about 10 times, the accuracy of integrating by homologous recombination does not change.

Although when the shortage L-arabinose is induced, do not obtain recon with the pGETrec plasmid in the DH10B cell, it is poisonous to prolong the obvious pair cell of L-arabinose induction time.In the process of preparation electroreception attitude cell and in the process that after electroporation, reclaims, induce the viability that as if greatly reduces cell more than 4 hours, and can not produce any recon.On the other hand, 10 minutes DH10B (pGETrec, pEBAC/148) Cm that cell produced the PCRkan50 electroporation have extremely only been induced with L-arabinose ^rKm ^rBacterium colony lacks 10 times than the cell of inducing 40 minutes.Efficiently produced recombinant clone in 40 minutes although induce, the instrument that the modulation of parameter can be renderd a service as the modulation reorganization.

Embodiment 3 makes up pEBAC/148

S-generation pEBAC140 BAC/PAC cloning vector (Fig. 1) has compiled first-generation PAC ²⁴And BAC ²³A plurality of features of cloning system, and HAEC system ⁴⁸In derive from the OriP and the EBNA-1 of Epstein-Barr virus.It also contains a plurality of further features, comprises rare cutting polyclone zone.By using the method based on the pac clone scheme, reverse connection carries the 185kb genomic fragment of complete beta-globin locus, and prepares pEBAC/148 (Fig. 2) 49 by pEBAC140.Briefly, by deriving from beta-globin locus 5 '-and the 3 '-terminal total genome PAC of PCR primer screening RPCI 1 people library ⁴⁹Evaluation carries the pac clone (PAC148/ beta-globin) of 185kb genome inset, confirms that this clone contains complete beta-globin locus (about 73kb), and 5 ' and 3 ' other terminal sequence.By NotI digestion 185kb genome inset is separated as individual chip, pulsed field gel electrophoresis (CHEF-DRII, BIORAD Labs, Hercules, CA), and agarase (Epicentre Techologies, Madison, WI) digestion.With NotI digestion pEBAC140 carrier, dephosphorylation and gel-purified, be connected to the 185kb globin fragment of purifying then.Electroporation separates 3 independently pEBAC/148 clones to the DH10B cell.By NotI digestion and pulsed field gel electrophoresis the clone is analyzed, the result demonstrates them and contains complete 185kb beta-globin genomic fragment, does not demonstrate any rearrangement sign.In stable clone, observe the beta-globin expression of gene among the pEBAC/148, wherein keep pEBAC/148 with episomal form ⁵⁰

Embodiment 4 makes up pGETrec induction type recombinant vectors

Use primer gam-F, 5 '-AGGTAGGATCCACCATGGATATTAATACTGAAAC-3 ' (SEQ ID NO:1) and gam-R, 5 '-ACTGAGGATCCTCGTTTTATACCTCTGAATCAATAT-3-(SEQ ID NO:2) is by plasmid pTP223 ⁴¹The gam gene of pcr amplification phage with BamHI digestion, is cloned into the BglII site of pBAD24-recET ⁴³The clone who has gam gene in the right direction for the pectinose promotor is called as pGETrec (Fig. 3).

Embodiment 5 usefulness L-arabinose are induced recE, and recT and λ gam gene also prepare electroreception attitude cell

With the fresh LB substratum of 250ml with DH1OB cell (GIBCO-BRL, Gaithersburg, MD) 50 times of overnight culture dilutions, described cell carries pGETrec and pEBAC140 or pEBAC/148, and described substratum contains 100 μ g/ml penbritins and 12.5 μ g/ml paraxin.When the OD600 of cell reaches 0.40-0.42, add L-arabinose (SIGMA, St.Louis, MO) to final concentration be 0.2% (w/v).The method of using manufacturer to recommend is collected OD ₆₀₀Be that 0.55 to 0.60 cell prepares electroreception attitude cell.Final cell precipitation thing is suspended in 10% glycerine that cumulative volume is 400 to 500 μ l again.With cell five equilibrium (40 μ l/ pipe) to the 1.5ml Eppendorf tube of precooling, freezing in dry ice-ethanol bath.Frozen cell is stored in-70 ℃.

Embodiment 6 preparation target dna fragmentation PCRkan50 and PCRkan140

With following primer amplification carrier pCYPAC2 ⁴⁹Kanamycin gene: kan50F 5 '-ACCACATACGTTCCGCCATTCCTATGCGATGCACATGCTGTATGCCGGTACAAGAA ATCACAGCCGAAGC-3 ', (SEQ ID N0:3) and kan50R 5 '-TGAACTGATGGACTTATGTCCCATCAGGCTTTGCAGAACTTTCAGCGGTAGCGTGA TCTGATCCTTCAACT-3 ', (SEQ ID NO:4).Preceding 50 Nucleotide (underscore) of each primer sequence are corresponding to the sequence that is positioned at unique border, Bst1107I site in the upper and lower chain of pEBAC140 carrier, and 20 Nucleotide correspondences of each primer back in the pCYPAC2 carrier flank in the sequence of kanamycin gene.PCR product P CRkan50 length is 1262bp, and carries kanamycin gene and promoter region, and each end carry 50 aggressiveness sequences with by homologous recombination with the Bst1107I site (Fig. 4) of its targeted integration to the pEBAC140 carrier.By in intestinal bacteria JC8679 cell, the PCRkan50 targeted integration to pEBAC140, can be produced pEBAC140 ∷ kan50.PCRkan140 length is 1450bp, it is by using primer 140KF 5 '-ATCTGGGAAGTGACGGACAG-3 ' (SEQ ID NO:5) and 140KR 5 '-CAGCATCGCAACCGCATCAG-3 ' (SEQ ID NO:6), being produced through PCR by pEBAC140 ∷ kan50.PCRkan140 has the homology target sequence of 145bp and 143bp respectively at 5 ' of kanamycin gene-and 3 '-terminal.By the gel electrophoresis purified pcr product, reclaim also quantitatively by QIAquick gel extraction kit (Qiagen, GmbH, Hilden, Germany).

Embodiment 7 produces recon

Fig. 5 has listed the group method that produces recon.The 40 microlitre electroreception attitude cell freezings that melt in the Eppendorf tube on ice store thing, add 200ng PCRkan50 or PCRkan140 in every tube cell.With the mixture of DNA and competent cell be transferred to fast precooling 0.2cm electrode gap slot (BIO-RAD Labs, Hercules, CA) in, use BIO-RAD GenePulser device electroporation.Electroporation conditions is: 2.5kV, 200Q, 25 μ F.After the electroporation, in groove, add 1ml LB substratum immediately, with cell transfer to 17 * 100mm FALCON polystyrene tube (BECKTON-DICKINSON Labware, Lincoln Park, NJ).Test tube is placed 37 ℃ of shaking tables (220rpm) insulation 1.5 hours.The cell of each electroporation coated contain 12.5 μ g/ml paraxin and 35 μ g/ml kantlex the LB flat board to identify recon.By using 10ng pZeoSV2 (Invitrogen, Carlsbad, CA) electroporation independently, and the electroporation mixture of serial dilution coated less salt LB (pH7.5) flat board that contains 25 μ g/ml Zeocin, measure the electroporation of every batch of competent cell and render a service.By DH10B (pGETrec with serial dilution, pEBAC140) or DH10B (pGETrec, pEBAC/148) electroporation competent cell (not adding DNA) is coated on the LB flat board, measure the sum of survivaling cell behind the electroporation, described flat board contains 100 μ g/ml penbritins and 12.5 μ g/ml paraxin.With the reorganization percentage test is kantlex in each survival bacterium colony behind the electroporation-and paraxin-shared per-cent of resistance bacterium colony.

Embodiment 8 analyzes recon

Use is through the alkaline lysis micropreparation method of improvement ⁴⁹, from the overnight culture that 2ml grows, isolate paraxin-and the DNA of kantlex-resistance bacterium colony the LB substratum, described substratum contains 12.5 μ g/ml paraxin and 35 μ g/ml kantlex.By in 14 ℃, (Rockland ME), in 0.5 * tbe buffer liquid, carries out pulsed field gel electrophoresis with 6V/cm and analyzes BAC DNA through NotI-or XhoI-digestion for SeaKem, FMC Bioproducts at 1% (w/v) sepharose.(Beverly is MA) as standard for NEB, Inc. with the I PFG mark of low scope and medium range.Use Amplitaq archaeal dna polymerase test kit (PerkinElmer Corp., Norwark, CT) the direct pcr analysis that overnight culture is carried out recombinant clone.The aliquots containig that in the PCR reaction, directly adds 1 microlitre reorganization 2 (deriving from the overnight culture that 2ml grows when having 12.5 μ g/ml paraxin and 35 μ g/ml kantlex) and parental generation clone (when only having 12.5 μ g/ml paraxin, growing).The recombinant products of pEBAC140 and PCRkan50 is called as pEBAC140 ∷ kan50.Similarly, the recombinant products of pEBAC/148 and PCRkan50 or PCRkan140 is called as pEBAC/148 ∷ kan50 and pEBAC/148 ∷ kan140 respectively.Be used to confirm that the PCR primer of pEBAC140 ∷ kan140 and pEBAC/148 ∷ kan140 is 140KA, 5 '-ATAAGCTCATGGAGCGGCGTAAC-3 ' (SEQ ID NO:7) and 140KB, 5 '-GTTCCACATTTCCATATAAAGGCCA-3 ' (SEQ ID N0:8).Be used to confirm that the PCR primer of pEBAC/148 ∷ kan50 and pEBAC140 ∷ kan50 is 140KF and 140KR (Fig. 4).On 1.5% (w/v) sepharose, differentiate the PCR product.(Cleveland is 0H) in the sequence of joint mensuration PCR product of recombinating for Amersham Life Science, Inc. to use the radiolabeled terminal cycle sequencing test kit of hot Sequenase.

It will be understood by those skilled in the art that invention as herein described and be not only specifically described like that, can change and modify it.Should understand and the present invention includes all this change and modifications.The present invention also comprises in this specification sheets independent or concentrated indication or described institute in steps, feature, composition and compound, and any and all combinations of any two or more described step or feature.

Bibliography 1.Jaenisch R. transgenic animal. science 1988; 240:1468-1474.2.Brinster what RL etc., intron increased transgenic mice transcribes effectiveness, Proc NatlAcad Sci USA 1988; 85:836-840.3.Lamb BT etc., [disclosed correcting errors in printing appears at Nat Genet 1993 Nov to the amyloid precursor protein gene [correction original text] of importing and expression 400kb in transgenic mice; 5 (3): 312] .Nat Genet, 1993; 5:22-30.4.Porcu S etc. shift the human beta-globin locus that imports by YAC and show specific and reproducible growth adjusting pattern, blood, 1997 in transgenic mice; 90:4602-4609.5.Peterson KR etc., the influence that disappearance human beta-globin locus 5 ' HS3 or 5 ' HS2 control area are regulated the growth of globin gene expression in beta-globin locus yeast artificial chromosome transgenic mice, Proc Natl Acad Sci USA 1996; 93:6605-6609.6.Raguz S etc., the activity of the flesh relevant-specific gene seat control area, developmental biology, 1998 with people's desmin gene; 201:2642.7.Choi T, Huang M, the intron that Gorman C and Jaenjsch R. are general increases the genetic expression in the transgenic mice, molecular cytobiology, 1991; 11:3070-3074.8.Vassaux G, people's cftr gene of YAC-clone depends on the expression of copy number, gene therapy, 1997 in Manson AL and the Huxley C. human epithelial cell system; 4:618-623.9.Gaensler KM, Kitamura M and Kan YW, the kind system of containing the 150-kb yeast artificial chromosome of human beta-globin locus in the transgenic mice transmits and the growth adjusting ProcNatl Acad Sci USA 1993; 90:11381-11385.10.Maas A etc. are by being proofreaied and correct the chain immunodeficiency defective of X-in the mouse, European Journal of Immunology, 1997 by yeast artificial chromosome's transgene expression people Bruton ' s Tyrosylprotein kinase; 27:2180-2187.11.Peterson KR etc., the transgenic mice that contains 248-kb people β locus yeast artificial chromosome demonstrates controls Trans Assoc AmPhysicians 1993 to human globin gene's suitable growth; 106:101-109.12.Peterson KR etc. use yeast artificial chromosome (YACs) to study mammiferous growth: produce and carry the beta-globin locus YAC mouse that people's globin is grown mutant, Proc Natl Acad Sci USA 1995; 92:5655-5659.13.Mccormick SP etc., mutagenesis human apolipoprotein b gene discloses the binding site of lipophorin in the yeast artificial chromosome, Proc Natl Acad Sci USA 1995; 92:10147-10151.14.Smith DJ and Rubin EM. functional screening and complex character: influence the people 21q22.2 sequence of mouse study, human molecular genetics, 1997; 6:1729-1733.15.Pavan WJ, Hieter P and Reeves RH. modify 360-kb and derive from people's yeast artificial chromosome and it is transferred to embryonal carcinoma cell system, molecular cytobiology, 1990; 10:4163-4169.16.Frengen E, Wu C and de Jong PJ. are transferred to intestinal bacteria with little YAC as big circular plasmids, Genet Anal 1997; 14:55-59.17.Bradshaw MS, Bollekens JA and Ruddle FH. clone the novel vector of dna segment big among the yeast artificial chromosome, nucleic acids research, 1995 based on recombinating; 23:4850-4856.18.Green ED and the chromosomal region of 0lson MV. cystic fibrosis gene in the yeast artificial chromosome: the people's gene group is made graph model, science, 1990; 250:94-98.19.Green ED, Riethman HC, DutchikJE and Olson MV. detect and identify chimeric yeast artificial chromosome clone, genomics, 1991; 11:658-669.20.Larionov V, Kouprina N, the reorganization in Nikolaishyjlj N and the Resnick MA. conversion process is as chimeric Mammals yeast artificial chromosome's (YAC) source, nucleic acids research, 1994; 22:4154-4162.21.Peterson KR, Clegg CH, Li Q and Stamatoyannopoulos G. produce the transgenic mice with yeast artificial chromosome, Trends Genet 1997; 13:61-66.22.Larionov V etc. clone people DNA as the yeast artificial chromosome by the reorganization specificity that transforms-be correlated with, Proc Natl Acad Sci USA 1996; 93:491-496.23.Shizuya H etc. use carrier cloning and the right people's dna segment of stable maintenance 300 kilobase based on the F-factor, Proc Natl Acad Sci USA 1992 in intestinal bacteria; 89:8794-8797.24.Ioannou PA etc., the phage P1-derivative vector of big people's dna segment, Nat Genet 1994 are bred in new being used to; 6:84-89.25.Hubert RS etc. cover BAC and PAC contig in the D21S55 of karyomit(e) 21 and the 3.5Mb Down syndrome congenital heart disease zone between the MX1, genomics, 1997; 41; 218-226.26.Ncchiporuk T etc., the PAC and the BAC collection of illustrative plates of SCA2 zone height-resolving power, genomics, 1997; 44:321-329.27.Wooster R etc. identify that breast cancer susceptibility gene BRCA2[sees the comment part] [disclosed correcting errors in printing comes across: nature 1996 Feb 22; 379 (6567): 749], nature, 1995; 373:789-792.28.Marshall E and Pennisi E. are arrogant and the people's gene group, science, 1998; 280:994-995.29.Venter JC etc., the air gun order-checking of people's gene group, science, 1998; 230:1540-1542.30.Venter JC, the New Policy of Smith HO and Hood L. gene order-checking, nature, 1996; 381:364-366.31.Antoch MP etc., by transgenosis BAC be rescued to mouse round the clock clock gene carry out Function Identification, cell, 1997; 89:655-667.32.Hejna JA etc. are by carrying out function compensation, nucleic acids research, 1998 with people BAC electroporation to Mammals inoblast; 26:1124-1125.33.O ' Connor M, Peifer M and Bender W. make up big DNA section, science, 1989 in intestinal bacteria; 244:1307-1312.34.Stembetg N, P1 cloning system: past and future, mammalian genes group, 1994; 5:397-404.35.Boren J etc., rite-directed mutagenesis lacks and merges big DNA, as P1 and BAC clone's simple but effective method, genome research, 1996; 6:1123-1130.36.Kim SY etc. use the Cre recombinase to modify bacterial artificial chromosome: import and in eukaryotic cell, express used selective marker, genome research, 1998; 8:404-412.37.Chatterjce PK and Coren JS. come big nested deletion in separation of bacterial and the P1 artificial chromosome, nucleic acids research, 1997 by the packing of P1 in vivo by the recombinant products between the loxP site of catalytic endogenous of Cre-and swivel base; 25:2205-2212.38.Yang XW, the kind system based on bacterial artificial chromosome in the modification of homologous recombination and the transgenic mice in Model P and the Heintz N. intestinal bacteria transmits Nat Biotechnol1997; 15:859-865.39.Messerle M etc., clone and mutagenesis are as the hsv gene group of infectious bacteria artificial chromosome, Proc Natl Acad Sci USA 1997; 94:14759-14763.40.1essen JR etc., the homologous recombination that stimulates by chi-is modified bacterial artificial chromosome and is used it for zebra fish is carried out transgenosis, Proc Natl Acad Sci USA 1998; 95:5121-5126.41.Murphy KC. uses the phage recombination function to replace bacteriology magazine, 1998 to promote gene in intestinal bacteria; 180:2063-2071.42.Oliner JD, Kinzier KW and Vogeistein B. be vivo clone PCR product in intestinal bacteria, nucleic acids research, 1993; 21:5192-5197.43.Zhang Y, BuChholz F uses reorganization to simplify DNA engineering (1998) in intestinal bacteria with Stewazt A.. and (submitting to) .44.Kawaguchi S is connected with Kuramitsu S. homology: new cloning process, Trends Genet 1994; 10:420.45.Kolodner R, Hall SD and Luisi-DeLuca C. are by the autosyndetic pairing protein of intestinal bacteria recE and recT genes encoding, molecular microbiology, 1994; 11:23-30.46.Kowalczykowski SC etc., the biological chemistry of homologous recombination in the intestinal bacteria, the microorganism comment, 1994:58:401-465.47.Noirot P and Kolodner RD. are invaded by the promoted DNA chain of intestinal bacteria RecT albumen, journal of biological chemistry, 1998; (disclosed correcting errors in printing appears at Nat Genet1994 Dec to the manually free type karyomit(e) of the people of the big dna segment of cell 273:12274-12280.48.Sun TQ, Fernstermacher DA and Vos JM. are used for cloning people; 8 (4): 410) .Nat Genet 1994; 8:33-41.49.Ioaanou P and Delong P: based on modified P1 (PAC) system constructing Bacterial Artificial Chromosome Library, Dracopoli NC, Korf BR, Moir DT, Motton CC, Seidman CE, Seidman JG, Smith DR (volume). up-to-date human genetics method, John Wiley and Sons:New York, 1996, pp 5.15.11-15.15.24.50.Westphal EM etc., 200-kb BAC/PAC clone is shuttled back and forth to the system of people's cell: keep and long-term allosteric activation human gene therapy, 1998 outside the stable karyomit(e); 9:1863-1873.＜110〉THE MURDOCHINSTITUTE＜120〉＜130〉2219883/TDO＜140〉＜141〉＜150〉PP6849/98＜151〉1998-10-30＜160〉8＜170〉PatentIn Ver.2.0＜210〉1＜211〉34＜212〉DNA＜213〉＜220〉＜223〉：/＜400〉1aggtaggatc caccatggat attaatactg aaac 34＜210〉2＜211〉36＜212〉DNA＜213〉＜220〉＜223〉：/＜400〉2actgaggatc ctcgttttat acctctgaat caatat 36＜210〉3＜211〉70＜212〉DNA＜213〉＜220〉＜223〉：/＜400〉3accacatacg ttccgccatt cctatgcgat gcacatgctg tatgccggta caagaaatca 60cagccgaagc 70＜210〉4＜211〉71＜212〉DNA＜213〉＜220〉＜223〉：/＜400〉4tgaactgatg gacttatgtc ccatcaggct ttgcagaact ttcagcggta gcgtgatctg 60atccttcaact 71＜210〉5＜211〉20＜212〉DNA＜213〉＜220〉＜223〉：/＜400〉5atctgggaag tgacggacag 20＜210〉6＜211〉20＜212〉DNA＜213〉＜220〉＜223〉：/＜400〉6cagcatcgca accgcatcag 20＜210〉7＜211〉23＜212〉DNA＜213〉＜220〉＜223〉：/＜400〉7ataagctcat ggagcggcgt aac 23＜210〉8＜211〉25＜212〉DNA＜213〉＜220〉＜223〉：/＜400〉8gttccacatt tccatataaa ggcca 25

Claims

1. be convenient between at least two nucleotide sequences, carry out the method for homologous recombination, described method comprises: by cultivate host cell under the condition that enough helps at least two nucleotide sequences of homologous recombination, in host cell, to induce the reorganization between described at least two nucleotide sequences, wherein said host cell can be expressed recBCD and coding exonuclease, the nucleotide sequence of recombinant protein and recBCD inhibitor or derivatives thereof, exonuclease, the expression of recombinant protein and recBCD inhibitor is can be synthetic.

2. according to the process of claim 1 wherein that described two nucleotide sequences are ringed nucleus nucleotide sequence and linear kernel nucleotide sequence.

3. according to the method for claim 2, wherein said ringed nucleus nucleotide sequence contains F-plasmid part.

4. according to the method for claim 3, wherein said F-plasmid partly is BAC.

5. according to the method for claim 3, wherein said F-plasmid partly is PAC.

6. according to each method in the claim 1 to 5, described exonuclease is recE or its functional deriv, and described recombinant protein is recT or its functional deriv.

7. according to the method for claim 6, wherein said recBCD inhibitor is gam, P22Aba or SSB or its functional deriv.

8. according to the method for claim 7, wherein said recBCD inhibitor is gam or its functional deriv.

9. method according to Claim 8, the described recE that wherein encodes, the nucleic acid molecule of recT and gam can operate with inducible promoter and link to each other.

10. according to the method for claim 9, the described recE that wherein encodes, the nucleic acid molecule of recT and gam can operate with total promotor and link to each other.

11. according to the method for claim 9 or 10, wherein said promotor is the L-arabinose promotor.

12. according to the method for claim 11, wherein said and total L-arabinose promotor can be operated the nucleic acid molecule that links to each other and is equivalent to expression plasmid pGETrec.

13. according to each method in the claim 1 to 12, wherein said host cell is intestinal bacteria.

14. according to the method for claim 13, wherein said escherichia coli expression recBCD.

15. according to the method for claim 14, wherein said intestinal bacteria are bacterial strain RR1, DM1 or DH10B.

16. according to the method for claim 15, wherein said bacterial strain is DH10B.

17. be convenient to the method for at least two nucleotide sequences of homologous recombination in host cell, described method comprises step:

18. according to the method for claim 17, wherein said two nucleotide sequences are ringed nucleus nucleotide sequence and linear kernel nucleotide sequence.

19. according to the method for claim 18, wherein said ringed nucleus nucleotide sequence contains F-plasmid part.

20. according to the method for claim 19, wherein said F-plasmid partly is BAC.

21. according to the method for claim 19, wherein said F-plasmid partly is PAC.

22. according to each method in the claim 17 to 21, described exonuclease is recE or its functional deriv, described recombinant protein is recT or its functional deriv.

23. according to the method for claim 22, wherein said recBCD inhibitor is gam, P22Aba or SSB or its functional deriv.

24. according to the method for claim 23, wherein said recBCD inhibitor is gam or its functional deriv.

25. according to the method for claim 24, the described recE that wherein encodes, the nucleic acid molecule of recT and gam can operate with inducible promoter and link to each other.

26. according to the method for claim 25, the described recE that wherein encodes, the nucleic acid molecule of recT and gam can operate with total promotor and link to each other.

27. according to the method for claim 25 or 26, wherein said promotor is the L-arabinose promotor.

28. according to the method for claim 27, wherein said and total L-arabinose promotor can be operated the nucleic acid molecule that links to each other and is equivalent to expression plasmid pGETrec.

29. according to each method in the claim 17 to 28, wherein said host cell is intestinal bacteria.

30. according to the method for claim 29, wherein said escherichia coli expression recBCD.

31. according to the method for claim 30, wherein said intestinal bacteria are bacterial strain RR1, DM1 or DH10B.

32. according to the method for claim 31, wherein said bacterial strain is DH10B.

33. generation method of microorganism, described microorganism is convenient at least two nucleotide sequences of homologous recombination, described method comprises: host cell is carried out genetic manipulation, make it can express recBCD, but the exonuclease of modulation level, the gene of recombinant protein and coding recBCD inhibitor and described at least two other nucleotide sequences.

34. according to the method for claim 33, wherein said two nucleotide sequences are ringed nucleus nucleotide sequence and linear kernel nucleotide sequence.

35. according to the method for claim 34, wherein said ringed nucleus nucleotide sequence contains F-plasmid part.

36. according to the method for claim 35, wherein said F-plasmid partly is BAC.

37. according to the method for claim 35, wherein said F-plasmid partly is PAC.

38. according to each method in the claim 33 to 37, described exonuclease is recE or its functional deriv, described recombinant protein is recT or its functional deriv.

39. according to the method for claim 38, wherein said recBCD inhibitor is gam, P22Aba or SSB or its functional deriv.

40. according to the method for claim 39, wherein said recBCD inhibitor is gam or its functional deriv.

41. according to the method for claim 40, the described recE that wherein encodes, the nucleic acid molecule of recT and gam can operate with inducible promoter and link to each other.

42. according to the method for claim 41, the described recE that wherein encodes, the nucleic acid molecule of recT and gam can operate with total promotor and link to each other.

43. according to the method for claim 41 or 42, wherein said promotor is the L-arabinose promotor.

44. according to the method for claim 43, wherein said and total L-arabinose promotor can be operated the nucleic acid molecule that links to each other and is equivalent to expression plasmid pGETrec.

45. according to each method in the claim 33 to 44, wherein said host cell is intestinal bacteria.

46. according to the method for claim 45, wherein said escherichia coli expression recBCD.

47. according to the method for claim 45, wherein said intestinal bacteria are bacterial strain RR1, DM1 or DH10B.

48. according to the method for claim 47, wherein said bacterial strain is DH10B.

49. be convenient to the cell of at least two nucleotide sequences of homologous recombination, described cell contains the coding exonuclease, the gene of the nucleotide sequence of recombinant protein and coding recBCD inhibitor, exonuclease wherein, the expression of recombinant protein and recBCD inhibitor is can be synthetic, also contains described at least two nucleotide sequences.

50., wherein carry out described homologous recombination according to each defined method in the claim 1 to 32 according to the cell of claim 49.

51. nucleic acid molecule by each described method homologous recombination in the claim 1 to 32.

52. the purposes of the nucleic acid molecule of claim 51 in the medicine of preparation treatment mammalian diseases.

53. the purposes of the nucleic acid molecule of claim 51 in the diagnosis mammalian diseases.

54. pharmaceutical composition, it contains nucleic acid molecule and one or more drug acceptable carriers and/or the thinner of claim 51.

55. be convenient to the test kit of at least two nucleotide sequences of homologous recombination in host cell, described test kit contains a plurality of compartments, wherein be fit to comprise any or multiple coding exonuclease, recombinant protein, the nucleotide sequence of recBCD inhibitor or its functional deriv and be convenient to the used reagent of homologous recombination.