CN1326882C

CN1326882C - Carcino-embryonic untigen specific combined peptide and fusion protein with TNF-alpha

Info

Publication number: CN1326882C
Application number: CNB021494193A
Authority: CN
Inventors: 陈惠鹏; 孔丽君; 王清明; 陈吉中; 范国才; 刘刚; 高红伟
Original assignee: Institute of Radiation Medicine of CAMMS
Current assignee: Institute of Radiation Medicine of CAMMS
Priority date: 2002-11-20
Filing date: 2002-11-20
Publication date: 2007-07-18
Anticipated expiration: 2022-11-20
Also published as: CN1502631A

Abstract

The present invention relates to targeted therapeutic research on carcino-embryonic antigen positive tumors, which belongs to the field of biomedical engineering. Conjugated peptides specifically conjugated with carcino-embryonic antigens are selected from a peptide bank shown randomly by bacteriophage. The conjugated peptides can be used as carriers of targeted therapeutic medicines for treating carcino-embryonic antigen positive tumors. The conjugated peptides are fused with TNF-alpha to produce fusion protein by expression, and the fusion protein can be specifically conjugated with carcino-embryonic antigens and has cellulotoxic activity to carcino-embryonic antigen positive LoVo cells, which shows that the fusion protein can be used for treating carcino-embryonic antigen positive tumor cells.

Description

The carcinomebryonic antigen specific binding peptides and with the fusion rotein of TNF-α

The invention discloses two kinds and carcinomebryonic antigen specificity bonded ring seven peptide, and with the fusion rotein of tumour necrosis factor, more particularly, the fusion protein expression vector of aminoacid sequence, nucleotide sequence and structure that comprises aminoacid sequence, nucleotide sequence and the fusion rotein of two binding peptides.

(carcinoembryonic antign CEA) is a kind of tumor markers and tumor related antigen to carcinomebryonic antigen, and high expression level is in the tumor tissues of epithelium source property, especially in digestive tract tumor such as colorectal carcinoma, the rectum cancer.Targeted therapy at CEA mainly concentrates on the research of specificity in conjunction with antibody or the single-chain antibody of CEA, with couplings such as monoclonal antibody or single-chain antibody and cytotoxin such as Zorubicin, methotrexate, tumour necrosis factors, specificity keying action by monoclonal antibody makes toxin can be enriched in tumor locus, improve the concentration of target site, thereby reach the purpose of targeted therapy, reduction toxic side effect.

The object of the present invention is to provide a kind of binding peptide of CEA specific combination, thereby overcome monoclonal antibody and the single-chain antibody molecular weight is big, a little less than the penetration power, be difficult to arrive the especially shortcoming of solid tumor tissue of target site.And the monoclonal antibody of mouse source property is applied to the people and knows from experience the generation human antimouse antibody, and little peptide then has the low advantage of immunogenicity.

Technological approaches of the present invention is the specific binding peptides that filters out CEA from phage display peptide library, with this binding peptide and tumour necrosis factor (TNF-α) amalgamation and expression, form fusion rotein, so that the CEA of binding peptide is in conjunction with cytotoxic activity coupling active and TNF-α, this fusion rotein for, can lead and kill and wound the CEA positive tumor.It is characterized by: 1) show the ring seven peptide that filters out the ring seven peptide storehouse with the CEA specific combination from phage random.2) aminoacid sequence of CEA binding peptide is: CPAPWGRLC.3) making up sequence is the binding peptide CSP-1 of CPAPWGRLC and the expression vector of the fusion rotein CSP-1-TNF of TNF-α, and two glycine of adding are as flexible joint between the two.4) making up sequence is the binding peptide CSP-2 of CLRGWPAPC and the expression vector of the fusion rotein CSP-2-TNF of TNF-α, and two glycine of adding are as flexible joint between the two.5) express and purifying CSP-1-TNF, CSP-2-TNF, detect and show that said two devices all can combine with the CEA specificity, and can compete suppress to filter out with the combining of CEA bonded mono-clonal phage and CEA.6) CSP-1-TNF, CSP-2-TNF all have the cytotoxic activity that kills and wounds the L929 cell, and CSP-1-TNF has the cytotoxic activity to the LoVo cell.

Accompanying drawings specific implementation method of the present invention is as follows:

The aminoacid sequence of Fig. 1 CAE binding peptide

330-339 is the numbering of little peptide, and aminoacid sequence is from left to right held the C end for N.

Fig. 2 phage mono-clonal and CEA avidity are relatively

The specific comparison of Fig. 3 phage mono-clonal

The design of graphics of Fig. 4 CSP-1-TNF expression vector pBV220-CSP-1-TNF

The design of graphics of Fig. 5 CSP-2-TNF expression vector pBV220-CSP-2-TNF

The CSP-1-TNF albumen of Fig. 6 purifying

The CSP-2-TNF albumen of Fig. 7 purifying

Fig. 8 ELISA detects the specific combination of CSP-1-TNF and CEA

Each group refers to the different concns of CSP-1-TNF and TNF-α in the X-coordinate, and wherein " A " is

89.25 μ g/ml, " B " " C " " D " ... be followed successively by 5 times of protein concentrations behind the gradient dilution.

Fig. 9 ELISA detects the specific combination of CSP-2-TNF and CEA

X-coordinate is grouped into the protein concentration of CSP-2-TNF and TNF-α, A:0.781 μ g/ml; B:3.125 μ g/ml; C:12.5 μ g/ml; D:50 μ g/ml.

Figure 10 CSP-1-TNF suppresses No. 338 phages and the competition of CEA bonded

" 0 " series is 0 for the concentration that adds CSP-1-TNF, and the concentration of CSP-1-TNF raises successively in series " 1 " " 2 " " 3 " " 4 ", is followed successively by: 0.714 μ g/ml, 3.57 μ g/ml, 17.85 μ g/ml, 89.25 μ g/ml.According to the different grouping of the CEA concentration of wrapping quilt, A:50 μ g/ml; B:5 μ g/ml; C:0.5 μ g/ml; D:0.05 μ g/ml.

Figure 11 CSP-2-TNF suppresses No. 338 phages and the competition of CEA bonded

The concentration of CSP-2-TNF in the X-coordinate among the figure, " 0 " refers to only add phage, does not add CSP-2-TNF;

The concentration of from " A " to " E " CSP-2-TNF raises gradually, is followed successively by: 0.714 μ g/ml, 3.57 μ g/ml, 17.85 μ g/ml, 89.25 μ g/ml.

Figure 12 CSP-1-TNF is to the cytotoxicity of L929 cell

Comparison values is that protein concentration is three parallel hole OD of 0 ₅₇₀Mean value.

5 times of gradient dilutions of protein concentration from " A " to " J " concentration: A:89.250 μ g/ml; B:17.850 μ g/ml; C:3.570 μ g/ml; D:0.714 μ g/ml; E:0.143 μ g/ml; F:0.0286 μ g/ml; G:5.712ng/ml; H:1.142ng/ml; I:0.229ng/ml; J:0.0457ng/ml.

Figure 13 CSP-2-TNF is to the cytotoxic activity of L929 cell

Protein concentration from " 8 " to " 1 " is 10 times of gradient dilutions: " 8 ": 50 μ g/ml; " 7 ": 5 μ g/ml; " 6 ": 0.5 μ g/ml; " 5 ": 0.05 μ g/ml; " 4 ": 0.005 μ g/ml; " 3 ": 0.5ng/ml; " 2 ": 0.05 ng/ml; " 1 ": 0.005ng/ml; The TE damping fluid that " not dosing " series adds filtration sterilization compares.

Figure 14 CSP-1-TNF is to the cytotoxicity of LoVo cell

Embodiment one: the screening of CEA binding peptide

With CEA is that target protein is showed the binding peptide that screens the ring seven peptide storehouse with the CEA specific combination from phage random, screening through four-wheel, obtained a series of and the phage mono-clonal CEA specific combination, therefrom 10 mono-clonals order-checkings of picking at random, its external source displayed polypeptide sequence is seen Fig. 1.

Detect the size and the specificity (Fig. 2, Fig. 3) of the CEA bonding force of each mono-clonal phage with the method for ELISA, determine bonding force and specificity best the sequence of monoclonal external source displayed polypeptide be PAPWGRL, because be cycle peptide library, so binding peptide should add halfcystine in both sides, that is: CPAPWGRLC.

Embodiment two: the structure of CSP-1-TNF expression vector (Fig. 4)

1. the gene that synthesizes CSP-1

Two complementary fragments of synthetic CSP-1 gene, and add the gene codon of two glycine at 5 ' end of its gene, the gene both sides add the restriction enzyme site of EcoR I respectively.

Fragment 1:

5’AATTCACCACCGCACAGACGACCCCACGGAGCCGGGCACATG?3’

Fragment 2:

5’AATTCATGTGCCCGGCTCCGTGGGGTCGTCTGTGCGGTGGTG?3’

With

fragment

1 and 2 equal proportion mixings, 94 ℃ of water-bath sex change 3min treat that it slowly is cooled to room temperature, make two complementary fragment annealing.

Enzyme is cut and is connected

PBV220-TNF cuts with EcoR I enzyme, and the enzyme system of cutting is: pBV220-TNF plasmid solution 8.5 μ l, 10 * H buffer, 1 μ l, EcoR I 0.5 μ l, 37 ℃ of incubation 1h, agarose gel electrophoresis identify that fragment is downcut and reclaimed, be connected with annealed CSP-1 gene fragment, linked system is: the fragment 4 μ l that reclaim behind the pBV220-TNF plasmid enzyme restriction, the target gene fragment 6 μ l after the annealing, Ligation Solution I 10 μ l, mixing, 16 ℃ connect 1h.

Identify

Connect product transformed into escherichia coli BL21 (DE3) competence, choose mono-clonal and cultivate, order-checking is identified and is expressed and identify respectively, determines correct clone.

Embodiment three: the structure of CSP-2-TNF expression vector (Fig. 5)

The aminoacid sequence of CSP-1 is put upside down, be CLRGWPAPC, be designated as CSP-2.With pBV220-TNF is template, the gene of CSP-2 is progressively joined the upstream of TNF-α gene by twice PCR.

1, PCR reaction

PCR for the first time:

Upstream primer is:

5’CGGCTCCGTGCGGTGGTGTCAGATCATCTTCTCGA?3’，

Downstream primer is:

5 ' GGGTCATCACAGGGCAATGATC 3 ' contains Sma I restriction enzyme site.

The PCR parameter is:

94 ℃, 2min; 94 ℃, 30sec, 55 ℃, 30sec, 72 ℃, 1min carries out 5 circulations; 94 ℃, 30 sec, 60 ℃, 1min, 72 ℃, 1min, totally 25 circulations; 72 ℃, 7min.

The PCR product downcuts the purpose fragment and reclaims through 1% agarose gel electrophoresis, is connected with pMD18-T, chooses the mono-clonal order-checking after the conversion, and therefrom the correct clone's of choosing plasmid carries out the PCR second time as template.

PCR for the second time

Upstream primer is:

5’GGAATTCATGTGCCTGCGTGGTTGGCCGGCTCCGTGCGGTGGT?3’，

Contain EcoR I restriction enzyme site.

Downstream primer is:

5`GGGTCATCACAGGGCAATGATC?3’，

The PCR parameter is:

94 ℃, 2min; 94 ℃, 30sec; 55 ℃, 30sec; 72 ℃, 1min carries out 5 circulations; 94 ℃, 30sec; 60 ℃, 1min; 72 ℃, 1min, totally 25 circulations; 72 ℃, 7min.

Product 1% agarose gel electrophoresis reclaims the purpose fragment, is connected with pMD18-T, and transformed into escherichia coli BL21 (DE3) chooses the mono-clonal order-checking, therefrom selects correct clone.

2, enzyme is cut and is connected

Correct clone uses EcoRI, Sma I double digestion, and the enzyme system of cutting is: each 0.5 μ l of ECoR I, Sma I, plasmid solution 7 μ l, 10 * T buffer, 1 μ l, 10 * BSA, 1 μ l, 37 ℃, 1h is simultaneously with pBV220 EcoR I, Sma I double digestion.Enzyme is cut product 1% agarose gel electrophoresis.Reclaim the purpose fragment, connect.

Embodiment four: the expression and purification of CSP-1-TNF, CSP-2-TNF

1, expresses

Choose CSP-1-TNF and CSP-2-TNF respectively through identifying correct clone, from the bacterium liquid of preserving, draw 100 μ l and be forwarded among the 10ml LB-Amp, 37 ℃, 200rpm jolting overnight incubation.The bacterium 5ml of incubated overnight is forwarded to 500ml and contains among the LB-Amp, and 37 ℃, the 200rpm jolting is cultured to OD ₆₀₀Be about at 0.5 o'clock, 42 ℃ of abduction deliverings 4 hours.Bacterium liquid descends 10 at 4 ℃, and the centrifugal 10min of 000rpm outwells supernatant, and thalline is frozen in-20 ℃.

2, purifying

CSP-1-TNF, behind the CSP-2-TNF bacterial sediment multigelation, (Cycle 0.5 in ultrasonication respectively, Amplitude 40%), 4 ℃ following 10 of lysates, the centrifugal 10min of 000rpm, supernatant slowly adds an amount of ammonium sulfate respectively while stirring under condition of ice bath, making it the ammonium sulfate final concentration is 20% saturation ratio, fully after the dissolving, 4 ℃ following 10, the centrifugal 10min of 000rpm gets supernatant, under condition of ice bath, slowly add an amount of ammonium sulfate while stirring, making it the ammonium sulfate final concentration is 40% saturation ratio, after fully dissolving, and 4 ℃ following 10, the centrifugal 10min of 000rpm, precipitation sample-loading buffer (20mmol/L Tris, 150mmol/L Nacl, 1mmol/L EDTA, pH value 8.0) dissolving, with sample-loading buffer balance ULTROGEL ^AcA 44 gel-filtration columns, sample on the protein solution that above-mentioned dissolving is good, with above-mentioned sample-loading buffer wash-out, 280nm detects elution peak, and SDS-PAGE detects, and merges target protein.Purification result is seen Fig. 6, Fig. 7.

Embodiment five: the ELISA method detects the specific combination of CSP-1-TNF, CSP-2-TNF and CEA

Bag is by CEA, and 4 ℃ are spent the night, the BSA sealing with 0.5%, room temperature 3 hours, every hole adds the CSP-1-TNF or the CSP-2-TNF of different concns, and the two all compares with the TNF-α of same concentration, every hole 100 μ l, each concentration is established 3 parallel holes, and 37 ℃ in conjunction with 1 hour, and PBST washes plate 6 times, the monoclonal antibody that adds TNF-α, 37 ℃ in conjunction with 1 hour, and PBST washes plate 6 times, add two of HRP mark and resist, 37 ℃ in conjunction with 1 hour, PBST washes plate 6 times, adds tmb substrate colour developing 5-15min, 2M H ₂SO ₄Stop, enzyme connection instrument is surveyed OD ₄₅₀The result shows that CSP-1-TNF and CSP-2-TNF want high 2-3 doubly with the binding ratio TNF-α of CEA with combining of CEA, illustrate that CSP-1-TNF and CSP-2-TNF can combine with the CEA specificity.(Fig. 8, Fig. 9)

Embodiment six: CSP-1-TNF, CSP-2-TNF suppress No. 338 phages and the competition of CEA bonded

Bag is by CEA antigen, and 4 ℃ are spent the night, the BSA sealing with 0.5%, and room temperature 3 hours, every hole adds CSP-1-TNF or the CSP-2-TNF and the fixed concentration (10 of different concns ¹⁰Pfu/ml) the solution 100 μ l of No. 338 phages, each concentration is established 3 parallel holes, and 37 ℃ in conjunction with 1 hour, and PBST washes plate 6 times, adds the M13 monoclonal antibody of HRP mark, and 37 ℃ in conjunction with 1 hour, and PBST washes plate 6 times, adds tmb substrate colour developing 5-15min, 2M H ₂SO ₄Stop, enzyme connection instrument is surveyed OD ₄₅₀The result shows, raising along with CSP-1-TNF or CSP-2-TNF protein concentration, the binding capacity of No. 338 phages and CEA reduces (Figure 10, Figure 11) gradually, proof CSP-1-TNF, CSP-2-TNF can compete and suppress combining of No. 338 phages and CEA, this experimental result explanation, the little peptide that is expressed in phage surface has similar space structure with the little peptide that is expressed in TNF-α protein N terminal, can both combine with the CEA specificity.

Embodiment seven: with the biologic activity of L929 raji cell assay Raji CSP-1-TNF and CSP-2-TNF

Select the good L929 cell of growth conditions, 0.25% trysinization is made into the individual cells suspension with the RPMI RPMI-1640 that contains 10% foetal calf serum, and counting is diluted to 5 * 10 ⁴Individual cell/ml, 100 μ l/ hole inoculating cells, 37 ℃, 5%CO ₂, cultivate 24h; Respectively filtration sterilization of CSP-1-TNF, CSP-2-TNF, be diluted to finite concentration after, join respectively in each hole cultured cells, 37 ℃, 5%CO ₂, cultivate 48h; 5mg/ml MTT solution, 10 μ l/ holes, 37 ℃ of incubation 4h; The careful suction removed the upper strata nutrient solution, adds DMSO, 100 μ l/ holes, and it is dissolving crystallized to vibrate gently, surveys OD ₅₇₀The result shows that CSP-1-TNF, CSP-2-TNF all have the cytotoxic activity to the L929 cell.(Figure 12, Figure 13)

Embodiment eight: detect the cytotoxicity of CSP-1-TNF to the LoVo cell

Select the good LoVo cell of growth conditions, 0.25% trysinization is made into the individual cells suspension with the RPMI RPMI-1640 that contains 10% foetal calf serum, and counting is diluted to 5 * 10 ⁴Individual cell/ml, 100 μ l/ hole inoculating cells, 37 ℃, 5%CO ₂, cultivate 24h; With the CSP-1-TNF filtration sterilization, be diluted to finite concentration after, join respectively in each hole cultured cells, 37 ℃, 5%CO ₂, cultivate 48h; 5mg/ml MTT solution, 10 μ l/ holes, 37 ℃ of incubation 4h; The careful suction removed the upper strata nutrient solution, adds DMSO, 100 μ l/ holes, and it is dissolving crystallized to vibrate gently, surveys OD ₅₇₀The result shows that CSP-1-TNF has the cytotoxic activity to the LoVo cell.(Figure 14)

Claims

1, a kind of energy specificity is in conjunction with the little peptide of carcinomebryonic antigen, and its aminoacid sequence from the N-terminal to the C-terminal is: C-P-A-P-W-G-R-L-C.

2, the described little peptide amalgamation and expression of claim 1 is in the fusion rotein that N-terminal constituted of TNF-α, and its aminoacid sequence from the N-terminal to the C-terminal is:

MCPAPWGRLC?GGEFMVRSSS?RTPSDKPVAH?VVANPQAEGQ?LQWLNRRANA?LLANGVELRD

NQLVVPSEGL YLIYSQVLFK GQGCPSTHVL?LTHTISRIAV SYQTKVNLLS AIKSPCQRET

PEGAEAKPWY?EPIYLGGVFQ LEKGDPLSAE?INRPDYLDFA ESGQVYFGIIAL。

3, the application of the described fusion rotein of claim 2 in preparation carcinoembryonic antigen positive tumor medicine.