CN102477083A - Carcinoembryonic antigen specific binding peptide with targeting therapy and low-toxic side effects - Google Patents

Abstract

The invention relates to research of targeting therapy of a carcinoembryonic antigen positive tumour, belonging to the field of biomedical engineering. Binding peptides specifically bonded with carcinoembryonic antigen are screened from a phage random display peptide library; the binding peptides can be used as carriers of a targeting therapy medicine of the carcinoembryonic antigen positive tumour; the binding peptides are blended with TNF (Tumour Necrosis Factor)-alpha and express that generated blended protein can be specifically bonded with carcinoembryonic antigen and has cytotoxicity on carcinoembryonic antigen positive LoVo cells; and the result shows that the blended protein can be used for treating the carcinoembryonic antigen positive tumour cells.

Description

CEACAMS specific binding peptides with the low toxic side effect of targeted therapy

Technical field

The invention belongs to biomedicine field, concrete relate to a kind of CEACAMS specific binding peptides with the low toxic side effect of targeted therapy.

Background technology

The invention discloses two kinds and CEACAMS specificity bonded ring seven peptide; And with the fusion rotein of tumour necrosis factor; More particularly, the fusion protein expression vector that comprises aminoacid sequence, nuclear former times acid sequence and the aminoacid sequence of fusion rotein, the general acid sequence of nuclear and the structure of two binding peptides.

(carcinoembryonic antign CEA) is a kind of tumor markers and tumor related antigen to CEACAMS, and high expression level is in the tumor tissues of epithelium source property, especially in digestive tract tumor such as colorectal carcinoma, the rectum cancer.Targeted therapy to CEA mainly concentrates on the antibody of specificity combination CEA or the research of single-chain antibody; With couplings such as monoclonal antibody or single-chain antibody and cytotoxin such as Zorubicin, methotrexate, tumour necrosis factors; Specificity keying action through monoclonal antibody makes toxin can be enriched in tumor locus; Improve the concentration of target site, thereby reach the purpose of targeted therapy, reduction toxic side effect.

Summary of the invention

The objective of the invention is to above-mentioned cancer therapy drug research and development present situation; A kind of CEACAMS specific binding peptides with the low toxic side effect of targeted therapy is provided; Thereby overcome monoclonal antibody and the single-chain antibody molecular weight is big, a little less than the penetration power, be difficult to arrive the especially shortcoming of solid tumor tissue of target site.And the monoclonal antibody of mouse source property is applied to the people and knows from experience the generation HAMA, and little peptide then has the low advantage of immunogenicity.

Technological approaches of the present invention is that the specificity that from phage display peptide library, filters out CEA combines tripe; With this binding peptide and tumour necrosis factor (TNF-α) amalgamation and expression; Form fusion rotein; So that the CEA of binding peptide combines cytotoxic activity coupling active and TNF-α, this fusion rotein is, can leads and kill and wound the CEA positive tumor.It is characterized by: l) show the ring seven peptide that filters out the ring seven peptide storehouse with the CEA specific combination from phage random.2) aminoacid sequence of CEA binding peptide is: CPAPWGRLC.3) making up sequence is the binding peptide CSP-1 of CPAPWGRLC and the expression vector of the fusion rotein CSP-1-TNF of TNF-α, and two glycocoll of adding are as flexible joint between the two.4) making up sequence is the binding peptide CSP-2 of CLRGWPAPC and the expression vector of the fusion rotein CSP-2-TNF of TNF-α, and two glycocoll of adding are as flexible joint between the two.5) express and purifying CSP-1-TNF, CSP-2-TNF, detect and show that said two devices all can combine with the CEA specificity, and can compete that inhibition filters out with the combining of CEA bonded mono-clonal phage and CEA.6) CSP-1-TNF, CSP-2-TNF all have the cytotoxic activity that kills and wounds the L929 cell, and CSP-1-TNF has the cytotoxic activity to the LoVo cell.

Description of drawings

The aminoacid sequence 330-339 of Fig. 1 CAE binding peptide is the numbering of little peptide, and aminoacid sequence is from left to right held the C end for N;

Fig. 2 phage mono-clonal and CEA avidity are relatively;

The specific comparison of Fig. 3 phage mono-clonal;

The design of graphics of Fig. 4 CSP-1-TNF expression vector pBV220-CSP-l-TNF;

The design of graphics of Fig. 5 CSP-2-TNF expression vector pBV220-CSP-2-TNF.

Embodiment

Embodiment one: the screening of CEA binding peptide is that target protein is showed the binding peptide that screens the ring seven peptide storehouse with the CEA specific combination from phage random with CEA; Screening through four-wheel; Obtained a series of and the phage mono-clonal CEA specific combination; Therefrom 10 mono-clonal order-checkings of picking at random, its external source displayed polypeptide sequence is seen Fig. 1.

Detect the size and the specificity (Fig. 2, Fig. 3) of the CEA bonding force of each mono-clonal phage with the method for ELISA; Confirm bonding force and specificity best the sequence of monoclonal external source displayed polypeptide be PAPWGRL; Because be cycle peptide library; So binding peptide should add first peptide propylhomoserin, that is: CPAPWGRLC in both sides.

Embodiment two: the structure of CSP-1-TNF expression vector (Fig. 4)

1. the gene of synthetic CSP-1

Two complementary fragments of synthetic CSP-1 gene, and add the gene codon of two glycocoll at 5 ' end of its gene, the gene both sides add EcoR worker's restriction enzyme site respectively.

Fragment 1:

5?'?AATTCACCACCGCACAGACGACCCCACGGAGCCGGGCACATG?3?'

Fragment 2:

5?'?AATTCATGTGCCCGGCTCCGTGGGGTCGTCTGTGCGGTGGTG?3?'

With fragment 1 and 2 equal proportion mixings, 94 ℃ of water-bath sex change 3min treat that it slowly is cooled to room temperature, make two complementary fragment annealing.

Enzyme is cut and is connected

PBV220-TNF cuts with EcoR I enzyme, and the enzyme system of cutting is: pBV22O-TNF plasmid solution 8.5 μ l, 10 * H buffer, 1 μ l, EcoR I 0.5 μ l; 37 ℃ of incubation lh, agarose gel electrophoresis identify that fragment is downcut and reclaimed; Be connected with annealed CSP-1 gene fragment, linked system is: the fragment 4 μ l that reclaim behind the pBV220-TNF plasmid enzyme restriction, the target gene fragment 6 μ l after the annealing; Ligation Solution I l0 μ l, mixing, 16 ℃ connect lh.

Identify

Connect product transformed into escherichia coli BL21 (DE3) competence, choose mono-clonal and cultivate, order-checking is identified and is expressed and identify respectively, confirms correct clone.

Embodiment three: the structure of CSP-2-TNF expression vector (Fig. 5)

The aminoacid sequence of CSP-1 is put upside down, be CLRGWPAPC, be designated as CSP-2.With pBV220-TNF is template, the gene of CSP-2 is progressively joined the upper reaches of TNF-α gene through twice PCR.

1、PCR

Reaction is PCR for the first time:

Upstream primer is:

5?'?CGGCTCCGTGCGGTGGTGTCAGATCATCTTCTCGA?3?'?,

Downstream primer is:

5 ' GGGTCATCACAGGGCAATGATC 3 ', contain Sma I restriction enzyme site.

The PCR parameter is: 94 ℃, and 2 min; 94 ℃, 30 sec; 55 ℃, 30 sec; 72 ℃, lmin carries out 5 circulations; 94 ℃, 30 SeC, 60 ℃, 1 min, 72 ℃, lmin, totally 25 circulations; 72 ℃, 7 min.

The PCR product downcuts the purpose fragment and reclaims through 1 % agarose gel electrophoresis, is connected with pMD18-T, chooses the mono-clonal order-checking after the conversion, and therefrom the correct clone's of choosing plasmid carries out the PCR second time as template.

PCR for the second time

Upstream primer is:

5 ' GGAATTCATGTGCCTGCGTGGTTGGCCGGCTCCGTGCGGTGGT3 ', contain EcoR I restriction enzyme site.

Downstream primer is: 5 ' GGGTCATCACAGGGCAATGATC3 ',

The PCR parameter is: 94 ℃, and 2 min; 94 ℃, 30 sec; 55 ℃, 30 sec; 72 ℃, lmin carries out 5 circulations; 94 ℃, 30 Sec; 60 ℃, 1 min; 72 ℃, lmin, totally 25 circulations; 72 ℃, 7 min.

Product reclaims the purpose fragment with l % agarose gel electrophoresis, is connected with pMD 18-T, and transformed into escherichia coli BL21 (DE3) chooses the mono-clonal order-checking, therefrom selects correct clone.

2, enzyme is cut and is connected

Correct clone uses EcoR I, Sma I double digestion, and the enzyme system of cutting is: EcoR I, each 0.5 μ l of Sma I; Plasmid solution 7 μ l, 10 * T buffer l μ l, 10 * BSA, 1 μ l; 37 ℃, lh, simultaneously with pBV220 with EcoR I, Sma I double digestion.Enzyme is cut product 1 % agarose gel electrophoresis.Reclaim the purpose fragment, connect.

Claims (2)

1. have the CEACAMS specific binding peptides of the low toxic side effect of targeted therapy, it is characterized in that its aminoacid sequence from the N end to the C end is: C – P – A – P – W – G – R – L – C.

2. according to the said reverse sequence of claim 1, it is characterized in that aminoacid sequence from the N end to the C end is: C – L – R – G – W – P – A – P – C with CEACAMS specific binding peptides of the low toxic side effect of targeted therapy.

Images