CN1317387C

CN1317387C - Fast donor plasmid carrying cotton bollworm single particle embedded nuclear polyhedrosis virus gene and P10 gene promotor sequence and construction method

Info

Publication number: CN1317387C
Application number: CNB011383763A
Authority: CN
Inventors: 王汉中; 陈新文; 胡志红
Original assignee: Wuhan Institute of Virology of CAS
Current assignee: Wuhan Institute of Virology of CAS
Priority date: 2001-12-31
Filing date: 2001-12-31
Publication date: 2007-05-23
Anticipated expiration: 2021-12-31
Also published as: CN1429903A

Abstract

The present invention discloses a construction method for a rapid doner plasmid with helicoverpa armigera single nucleocapsid nucleopolyhedrovirus genes and P10 gene promotor sequence. After an exogenous gene is inserted into a multiple clone site under the control of P10, the exogenous gene and a polyhedrosis gene are simultaneously inserted into a transposon insertion site in a shuttle expression vector of helicoverpa armigera single nucleocapsid nucleopolyhedrovirus by transposition; after a cotton bollworm cell is transfected, people can observe whether an inclusion body is formed in the cell under an optical microscope; if the inclusion body is formed in the cell, transfection is successful; and subsequently, recombinant virus particles are collected for infecting the cell again and an exogenous gene expression level can be detected. The exogenous gene is rapidly inserted into an HZ8 expression vector by the construction method, recombinant virus can be obtained only by 7 to 14 days, and the exogenous gene can be expressed in a Hzaml cell. The construction method can efficiently express the exogenous gene under mediation of a P10 strong promoter and rapidly identify the recombinant virus by polyhedrosis phenotype.

Description

The fast donor plasmid and the construction process that have cotton bollworm single particle embedded nuclear polyhedrosis virus gene and P10 gene promoter sequence

Technical field

The invention belongs to molecular biology and technical field of bioengineering, be specifically related to a kind of fast donor plasmid that has cotton bollworm single particle embedded nuclear polyhedrosis virus gene and P10 gene promoter sequence, also relate to the construction process of this plasmid.

Background technology

Baculovirus is widely used in the biological control of agriculture and forestry injurious insect.The still very good eukaryotic expression system of baculovirus-insect (cell) system has been used for the research and the production of foreign gene, diagnostic reagent and vaccine etc. simultaneously.The same with other baculovirus, China cotton bollworm single particle embedded nuclear polyhedrosis virus (Helicoverpaarmigera single nucleocapsid nucleopolyhedrovirus, hereinafter to be referred as wild-type virus or HaSNPV) as sterilant owing to there is the slow-footed shortcoming of desinsection, cause the effect of its big area control bollworm harm to be restricted; And the expression amount that improves constantly virus expression systems also is the research focus of current bioengineering field always.To the molecular biological research of baculovirus, particularly will help to disclose duplicating and regularity of infection of virus, for recombinant virus sterilant and development and application quick, efficient expression vector lay the foundation to the structure of virogene and the research of function.

Utilize many embedding nuclear polyhedrosis virus of autographa california expressing human-interferon-gene in the Sf9 cell from nineteen eighty-three Smith and Summers reported first, rhabdovirus expression vector because of its can be in insect cell and insect larvae efficiently expressing exogenous gene, and ask the ability that baculovirus expression system has processing and modifies expression product under the condition at great majority, cutting, glycosylation and phosphorylation and most of expression product as signal peptide have very high advantages such as biological activity, make it become crucial eukaryotic expression system.Use the foreign gene that baculovirus expression system has been expressed hundreds of kind different sources at present.

Traditional recombinant baculovirus makes up and need be undertaken by following two steps: at first must be on the multiple clone site of metastasis transplanting physique grain with exogenous gene cloning, and multiple clone site is positioned under the strong promoter control of baculovirus usually.With transfer vector with the baculovirus DNA cotransfection in insect cell, produce recombinant virus through homologous recombination, recombination fraction is usually between 0.1-1%.Secondly need to identify and purification of Recombinant virus with the plaque method.Because the low and plaque method of purification complicated operation, consuming time of production rate of recombinant virus often needs several months even longer time to make up a complete recombinant virus.In view of there are above-mentioned two defectives in baculovirus expression system, Kuckow has invented a kind of method that fast, effectively makes up recombinant baculovirus, be baculovirus shuttle expression carrier system, can in 7 days, finish the structure of recombinant virus and efficiently expressing of foreign gene.This system is by shuttle expression carrier (Bacmid) and fast donor plasmid (pFastBac ^TM) two portions composition.Shuttle expression carrier (Bacmid) contains the dna fragmentation of the 8.5kb of bacterium DNA replication (mini-F replicon) of a low copy number, kalamycin resistance gene and a galactosidase gene (lacZ α), short-movie section as bacterium transposon insertion site (mini-attTn7) is inserted into lacZ α gene N-end simultaneously, and this segmental insertion does not change the reading frame of lacZ α gene.This shuttle expression carrier (Bacmid) can duplicate and can duplicate the complete virus particle of formation in insect cell in E.coli.Fast donor plasmid (pFastBac ^TM) then form by a mini-Tn7 transposable element, between the mini-Tn7 left and right arms, insert a gentamicin resistant gene, special strong promoter of baculovirus, multiple clone site and monkey and steep the expression cassette that virus-4 0 poly A (SV40 (A) poly) signal sequence is formed more.Under the effect of the translocase that helper plasmid provides, clone in fast donor plasmid (pFastBac ^TM) foreign gene of multiple clone site can be indexed on the mini-attTn7 site of shuttle expression carrier (Bacmid), by antibiotics resistance screening and blue hickie Screening and Identification reorganization shuttle expression carrier (Bacmid), in insect cell, carry out expression of exogenous gene from extracting shuttle expression carrier DNA transfection in the E.coli subsequently.This method has the recombination fraction height, recombinant virus screens advantages such as convenient.But this shuttle expression carrier is the imperfect virus of a disappearance polyhedrosis gene, thereby only can produce virus in cell, is difficult for judging that whether cell is by recombinant virus infection.In addition, because the disappearance polyhedrosis gene, recombinant virus can not infected insect, in other words can not be in insect body expression alien gene.

Summary of the invention:

The object of the present invention is to provide a kind of fast donor plasmid that has cotton bollworm single particle embedded nuclear polyhedrosis virus gene and P10 gene promoter sequence, foreign gene is inserted on the HZ8 expression vector fast, obtain recombinant virus fast, and at the cell inner expression foreign gene, simultaneously under the regulation and control of P10 strong promoter, efficiently expressing exogenous gene, the Rapid identification recombinant virus.

Another object of the present invention provides the construction process of this donor plasmid.

In order to achieve the above object, the present invention is by the following technical solutions: made up the fast donor plasmid HapFastPhP10 that has cotton bollworm single particle embedded nuclear polyhedrosis virus gene and P10 gene promoter sequence, this fast donor plasmid (HapFastPhP10) is transformed in the Eschrichia Coli DH5 α strain,-80 ℃ of preservations, the bacterial strain of this plasmid is preserved in Chinese typical culture collection center, CCTCCM201047 December 26 calendar year 2001.On the basis of the two-way donor plasmid (pFastBacdual) that has many embedding nuclear polyhedrosis virus of autographa california polyhedrosis gene promoter sequence and P10 gene promoter sequence, successfully made up the fast donor plasmid (pFastPhP10) that has cotton bollworm single particle embedded nuclear polyhedrosis virus gene and P10 gene promoter sequence, and green fluorescent protein (eGFP) gene is inserted into multiple clone site under the P10 promotor control, after transposition in the DH10B recipient bacterium, reorganization shuttle expression carrier (HZ8Ph+eGFP) the DNA transfection that is inserted with polyhedrosis gene and green fluorescence protein gene is expressed in bolworm cell, so far successfully made up the expression system of the perfect cotton bollworm single particle embedded nuclear polyhedrosis virus shuttle expression carrier of a cover.HZ8 utilizes the method for homologous recombination with a DNA of bacteria F replicator (mini-Freplicon) that contains low copy number, a kalamycin resistance gene and a lacZ α gene, the dna fragmentation that short-movie section of inserting site (mini-attTn7) as the bacterium transposon is inserted into the 8.5kb of lacZ α gene N-end is simultaneously replaced on the virus genomic polyhedrosis gene site, therefore, constructed HZ8 is the recombinant virus that lacks polyhedrosis gene, only can produce cytopathy with this recombinant virus infection HzAml cell, but can not in nucleus, form inclusion body, after the transposon that utilizes the pFastPhP10 donor plasmid foreign gene to be inserted to HZ8 inserts site (mini-attTn7), behind its DNA transfection HzAml cell, can form and have infective recombinant virus particle, and can be under polyhedron promotor and the control of P10 promotor expression alien gene.Multiple clone site under the constructed existing P10 promotor control of donor plasmid (pFastPhP10) that different with many embedding nuclear polyhedrosis virus of autographa california shuttling expressing system (AcBacmid) is is inserted the complete polyhedrosis gene that has the polyhedron promoter sequence again.

Its advantage is after foreign gene is inserted into multiple clone site under the P10 control, through transposition the transposon that foreign gene and polyhedrosis gene are inserted in the full genome shuttle expression carrier of cotton bollworm single particle embedded nuclear polyhedrosis virus (HaBcmid) is simultaneously inserted the site, transfection is behind bolworm cell (HzAml), can in observation of cell under the opticmicroscope, whether form inclusion body, as forming inclusion body in the cell, the proof transfection is succeedd, recombinant virus particle cells infected again can be collected subsequently, and the detection of exogenous gene expression level can be carried out.Therefore the formation of the expression of polyhedrosis gene and inclusion body can be used as the important identification marking of transfection success.In addition, owing to again polyhedrosis gene is inserted into viral genome, the recombinant virus that is produced is a recombinant virus that does not lack any gene, thereby this recombinant virus can not only also can be at insect larvae expression in vivo foreign gene in insect cell.Another significant advantage is to be convenient to insert the toxin gene that insect is had the specificity toxic action, makes up efficiently, recombinant virus sterilant fast.

Description of drawings

Fig. 1 is that a kind of pFastPhP10 donor plasmid makes up schema;

Fig. 2 is a kind of physical map of pFastPhP10 donor plasmid;

Fig. 3 is a kind of principle of work synoptic diagram of pFastPhP10 donor plasmid.

Embodiment

Below in conjunction with accompanying drawing the present invention is described in further detail:

According to Fig. 1, Fig. 2, Fig. 3 as can be known, utilize the upstream and downstream primer of the polyhedrosis gene of a pair of special cotton bollworm single particle embedded nuclear polyhedrosis virus (HaSNPV), from the genome of HaSNPV, amplify the polyhedrosis gene that has promoter sequence.

Primer sequence: Ph-1 CGGATCCCTTATACTTCTAAACTGTTCGTCGTC

Ph-2 CGTATACTTAATATGCAGGACCAGTGTATAG；

Utilize the upstream and downstream primer of the P10 promotor of a pair of special cotton bollworm single particle embedded nuclear polyhedrosis virus (HaSNPV), from the genome of HaSNPV, amplify the HaP10 promoter sequence.

Primer sequence: P10-1 AGATCTCGAAACCTGACACGAAACG

P10-2 GGATCCCGTGATTATTTCGTCGTACAGTTGG；

Both are cloned into respectively on the pGEMT-ease carrier, obtain pGEMTP10 and pGEMTPh plasmid; Utilize Pst I and Bgl II restriction enzyme cutting pGEMTP10 plasmid.Separate linearizing pGEMTP10 plasmid with 0.7% agarose gel electrophoresis; Utilize Pst I and BamH I restriction enzyme cutting pGEMTPh plasmid, separate the linearizing polyhedrosis gene that has promotor with 0.7% agarose gel electrophoresis; Utilize dna ligase that polyhedrosis gene is connected on the pGEMTP10 plasmid, obtain having the recombinant plasmid of polyhedrosis gene and P10 promotor, called after pHZT PhP10 plasmid; With Nhe I and BamH I restriction enzyme cutting pFastBacdual plasmid, separate linearizing big pFastBacdual plasmid fragment with 0.7% agarose gel electrophoresis; With Spe I and BamH I restriction enzyme cutting pHZTPhP10 plasmid, separate the fragment that contains polyhedrosis gene and P10 promoter sequence with 0.7% agarose gel electrophoresis; The fragment that will contain polyhedrosis gene and P10 promoter sequence is connected on the big pFastBacdual plasmid fragment of the 7th step preparation, is built into the donor recombinant plasmid, called after pFastPhP10 plasmid.

Claims

1, a kind of fast donor plasmid that has cotton bollworm single particle embedded nuclear polyhedrosis virus gene and P10 gene promoter sequence is characterized in that E.coli.DH5 α/HapFastPhP10, and it is preserved in CCTCC, and deposit number is M201047.

2, a kind of described construction process that has the fast donor plasmid of cotton bollworm single particle embedded nuclear polyhedrosis virus gene and P10 gene promoter sequence of claim 1 of realizing comprises the following steps:

A, utilize the upstream and downstream primer of the polyhedrosis gene of a pair of cotton bollworm single particle embedded nuclear polyhedrosis virus, amplify the polyhedrosis gene that has promoter sequence from the genome of HaSNPV, primer is

Ph-1?CGGATCCCTTATACTTCTAAACTGTTCGTCGTC

Ph-2?CGTATACTTAATATGCAGGACCAGTGTATAG；

B, utilize the upstream and downstream primer of the P10 promotor of a pair of cotton bollworm single particle embedded nuclear polyhedrosis virus, amplify the P10 promoter sequence from the genome of HaSNPV, primer is

P10-1?AGATCTCGAAACCTGACACGAAACG

P10-2?GGATCCCGTGATTATTTCGTCGTACAGTTGG；

C, both are cloned into respectively on the pGEMT-ease carrier, obtain pGEMTP10 and pGEMTPh plasmid;

D, usefulness Pst I and Bgl II restriction enzyme cutting pGEMTP10 plasmid separate linearizing pGEMTP10 plasmid with 0.7% agarose gel electrophoresis;

E, utilize Pst I and BamH I restriction enzyme cutting pGEMTPh plasmid, with the linearizing polyhedrosis gene that has promotor of 0.7% agarose gel electrophoresis separation;

F, utilize dna ligase that polyhedrosis gene is connected on the pGEMTP10 plasmid, obtain having the recombinant plasmid of polyhedrosis gene and P10 promotor;

G, usefulness Nhe I and BamH I restriction enzyme cutting pFastBacdual plasmid separate linearizing big pFastBacdual plasmid fragment with 0.7% agarose gel electrophoresis;

H, usefulness Spe I and BamH I restriction enzyme cutting pHZTPhP10 plasmid separate the fragment that contains polyhedrosis gene and P10 promoter sequence with 0.7% agarose gel electrophoresis;

I, the fragment that will contain polyhedrosis gene and P10 promoter sequence are connected on the big pFastBacdual plasmid fragment of G step preparation, are built into the donor recombinant plasmid.