CN113174373B

CN113174373B - Method for knocking out baculovirus essential gene

Info

Publication number: CN113174373B
Application number: CN202110502748.1A
Authority: CN
Inventors: 苏武杰; 李兵
Original assignee: Suzhou University
Current assignee: Suzhou University
Priority date: 2021-05-09
Filing date: 2021-05-09
Publication date: 2023-03-24
Anticipated expiration: 2041-05-09
Also published as: CN113174373A

Abstract

The invention discloses a method for knocking out baculovirus essential genes, which comprises the following steps of carrying out homologous recombination and purification on a transfer vector and modified baculovirus bacmid in silkworm cells, extracting DNA, converting escherichia coli competence, selecting bacterial colonies as bacterial liquid PCR to obtain a bacterial strain containing an intermediate knock-out strain, then infecting silkworm cells with the intermediate knock-out strain virus and unmodified bacmid virus for homologous recombination and extracting DNA, converting the escherichia coli competence, selecting blue bacterial colonies as bacterial liquid PCR to obtain the bacterial strain containing the bacmid with the essential gene knocked out, and realizing the knocking-out of the baculovirus essential genes. The method does not need a specific cell or bacterial system, saves time and labor, can save capital investment, does not need special equipment, is simple to operate, is easy to master, can be applied to knockout of other baculovirus essential genes, and has wide application prospect.

Description

Method for knocking out baculovirus essential gene

Technical Field

The invention belongs to the field of research on functions of insect baculovirus genes, and particularly relates to a method for knocking out baculovirus essential genes, which can save labor and improve working efficiency.

Background

Baculovirus is a kind of envelope-coated double-stranded circular DNA virus, and its genome size is generally 80-180 kb, and its coding genes are 100-200. Depending on the importance of function, it can be divided into essential genes and non-essential genes. The baculovirus has wide application and can be used for exogenous gene overexpression, biological insecticides, baculovirus surface display and gene therapy vectors. Bombyx mori nuclear polyhedrosis virus: (Bombyx mori Nuclear Polyhedrosis Virus, bmNPV) is a natural pathogenic microorganism of bombyx mori and is representative of baculovirus. The blood type pyosis caused by the virus has the characteristics of large outbreak scale, long influence time and the like, the loss of silkworm cocoons caused by the virus accounts for more than 60 percent of the loss of the total silkworm diseases every year, but no specific medicine is available, and the prevention is mainly performed. The research on the essential genes of the baculovirus can analyze the replication and assembly mechanism of the virus, and provide theoretical reference for resisting the baculovirus.

To study the function of essential genes, a knockout strain is obtained after the essential genes are knocked out. Since baculovirus cannot replicate, assemble or transport and cannot spread among cells cultured in vitro after knockout of essential genes, homologous recombination in unmodified bnn cells cannot yield purified knockout strains. The traditional method is to integrate the essential gene to be knocked out into the genome of the BmN cell by transposition, then use the transgenic cell line to knock out the essential gene by homologous recombination, and use low melting point agarose to carry out multiple rounds of purification. The disadvantage of this method is that it is time and labor intensive to obtain transgenic cell lines and that the cells are easily contaminated. In addition, the purification process requires high technical requirements and long periods, and requires the use of expensive low-melting agarose. There is also a method for knocking out essential genes in E.coli based on RED recombination technology, which does not need to construct a transfer vector, the recombinant homology arm is directly designed on a primer, and then BW25113 E.coli is directly transformed using a linear PCR product, however, since the linear DNA transformation efficiency is low and the recombination rate of RED technology is low, an electroshock instrument and antibiotic screening are necessary. In addition, PCR primers are long, costly, and require extensive and time-consuming exploration of amplification conditions. The PKD46 plasmid encoding RED recombinase using a temperature-sensitive replicon required culturing at 30 ℃ and high-temperature treatment at 42 ℃ to lose the PKD46 plasmid, whereas RED recombinase required L-arabinose-induced expression. Therefore, the knockout method based on RED technology does not require the construction of a transfer vector, but it has high requirements for technology and equipment and is not easy to implement.

Based on the above practical situation, there is an urgent need for research to develop a new method that can efficiently knock out the baculovirus essential gene, does not need special equipment, and is easy to operate.

Disclosure of Invention

The invention aims to provide a method for knocking out an essential gene of baculoviral, which can efficiently obtain purified virus with the essential gene knocked out and improve the working efficiency.

In order to achieve the purpose of the invention, the technical scheme adopted by the invention is as follows:

a method of knocking out an essential gene of baculovirus, comprising the steps of:

(1) Constructing a transfer vector and transforming baculovirus bacmids;

(2) Carrying out homologous recombination and purification on the transfer vector and the modified baculovirus bacmid in silkworm cells, and extracting DNA;

(3) Transforming the extracted DNA into escherichia coli competence, selecting bacterial colonies as bacterial liquid PCR, and obtaining a bacterial strain containing an intermediate knockout strain;

(4) Co-infecting silkworm cells with the intermediate knockout strain virus and the unmodified baculovirus to carry out homologous recombination and extract DNA;

(5) Transforming the extracted DNA into escherichia coli competence, selecting a blue bacterial colony to perform bacterial liquid PCR to obtain a bacterial strain containing the bacmid with the essential gene knocked out, and knocking out the essential gene of the baculovirus.

In the present invention, the essential gene is orf92 gene; the silkworm cell is a silkworm ovary cell line (BmN); the baculovirus is bombyx mori nuclear polyhedrosis baculovirus (BmNPV).

In the invention, in step (1), an amplification product of an essential gene sequence to be knocked out and an upstream and downstream sequence thereof is connected to a linear vector through enzyme digestion connection to construct an intermediate transfer vector, and then a reporter gene amplification product is connected to the linear amplification product of the intermediate transfer vector through enzyme digestion to construct the transfer vector; taking baculovirus bacmid DNA as a template, and amplifying an essential gene by PCR to obtain an essential gene amplification product; then connecting the essential gene amplification product to a vector, thereby constructing an essential gene plasmid; and then the essential gene is transposed to the polyhedron locus of the baculovirus bacmid through a Bac-to-Bac transposition system to obtain the modified baculovirus bacmid. Amplifying a sequence of an essential gene to be knocked out and an upstream and downstream sequence thereof by PCR, linearizing a vector by reverse PCR, and constructing an intermediate transfer vector by enzyme digestion ligation reaction; performing reverse PCR again to partially replace the gene to be knocked out with the reporter gene; and (3) carrying out PCR amplification on the essential gene to be knocked out, and transposing the essential gene to the polyhedron gene locus through a Bac-to-Bac transposition system to obtain the baculovirus bacmid driven by the polyhedron promoter, namely the modified baculovirus bacmid. The polyhedrin promoter can be replaced by an IE1 immediate early promoter or the self promoter of the essential gene to be knocked out by double digestion of pFastbac1 plasmid with SnaBI and BamHI according to the expression phase of the essential gene.

In the invention, a vector is used as a template, and reverse PCR is carried out to linearize the vector to obtain a linear vector; taking baculoviral DNA as a template, and carrying out PCR amplification on an essential gene and upstream and downstream sequences thereof to obtain an essential gene sequence to be knocked out and amplification products of the upstream and downstream sequences; taking the intermediate transfer vector as a template, and carrying out reverse PCR to obtain an intermediate transfer vector linear amplification product; and (3) carrying out PCR amplification on the reporter gene and the polyhedron promoter thereof by taking the reporter gene plasmid as a template to obtain a reporter gene amplification product. The vector plasmid can be puc19, and can also be a plurality of smaller plasmids; inverse PCR uses high fidelity enzymes; by using reverse PCR, the transfer vector can be constructed only by two rounds of enzyme digestion ligation reactions, whereas the traditional method requires three rounds of enzyme digestion ligation reactions.

In the invention, in the step (2), the transfer vector and the modified baculovirus bacmid are cotransfected with silkworm cells for homologous recombination; then taking the supernatant and silkworm cells to incubate in a 96-well plate; then visually observing, taking out supernatant in a well which emits the most green fluorescent cells, particularly a well which emits fluorescence of a sheet cell group, and adding the supernatant into another 96-well plate for incubation; then, the supernatant from the well with the largest number of green fluorescent cells was added to a cell bottle filled with silkworm cells and cultured for 3 days, and then DNA was extracted. The constructed transfer vector and the modified baculovirus bacmid DNA are cotransfected with silkworm cells and then purified without using low-melting-point agarose, which is one of the technical means for distinguishing the prior art. Co-transfecting the modified baculovirus bacmid and a transfer vector without constructing a cell line stably expressing a gene to be knocked out; the virus was purified by dilution method using 96-well plates without using low melting point agarose.

In the present invention, in step (3), the DNA extracted in step (2) is transformed into competent cells (E.coli DH 0B), which are then plated on agar plates, and after culturing, bacterial colonies are selected for PCR to select strains containing intermediate knockout strains. Extracting bacmid DNA from the BmN cells by using the kit, collecting virus particles without ultracentrifugation, and without protein K digestion and phenol chloroform extraction; in particular, DH10B competence prepared using the conventional calcium chloride method in the laboratory (conventional method for competence) was achieved without the use of a shock instrument.

In the invention, in step (4), bacmid DNA is extracted from a strain containing an intermediate knockout strain and is transfected into silkworm cells, then the supernatant and unmodified bacmid virus are taken to infect the silkworm cells together, and the silkworm cells are cultured for 3 days without purification and directly extracted with the DNA.

In the invention, in the step (5), DNA extracted in the step (4) is transformed into competent cells, then the competent cells are coated on an agar culture plate, after culture, blue colonies are selected to be used as bacterial liquid PCR, and a bacterial strain containing bacmid with the baculovirus essential gene knocked out is obtained, thus realizing the purpose of the invention.

The invention discloses a strain containing bacmid with a baculovirus essential gene knocked out, which is obtained according to the method for knocking out the baculovirus essential gene.

The invention discloses application of a modified baculovirus bacmid in knockout of an essential gene of baculovirus; taking baculovirus bacmid DNA as a template, and amplifying an essential gene by PCR to obtain an essential gene amplification product; then connecting the essential gene amplification product to a vector, thereby constructing an essential gene plasmid; and then the essential gene is transposed to the polyhedron locus of the baculovirus bacmid through a Bac-to-Bac transposition system to obtain the modified baculovirus bacmid.

In the invention, the transformation, transfection and infection conditions related to the step (1), the step (2), the step (3), the step (4) and the step (5) are consistent with the conventional requirements, and the specific method does not influence the realization of the technical effect of the invention.

The transfer vector can be constructed by performing two rounds of enzyme digestion connection through two rounds of reverse PCR in the step (1), and the transfer vector can be constructed by performing three rounds of enzyme digestion connection reactions including left arm enzyme digestion connection, right arm enzyme digestion connection and reporter gene enzyme digestion connection in the conventional method. Co-transfecting BmN cells by using the modified baculovirus bacmid DNA and a transfer vector; the purification is carried out by utilizing a 96-well plate, and the problem that the prior art needs to use low-melting-point agarose is solved. In steps (3) and (5) of the invention, virus particles are collected without ultracentrifugation (> 35000 rpm), and virus DNA is extracted from BmN cells by a kit; the calcium chloride method is used for competence, and an electric shock instrument is not needed.

Due to the application of the technical scheme, compared with the prior art, the invention has the following advantages:

1. the invention provides a method for efficiently constructing a transfer vector, which only needs two rounds of enzyme digestion ligation reactions, while the traditional method needs three rounds of enzyme digestion ligation reactions.

2. The method for purifying the baculovirus in the cultured cells, disclosed by the invention, utilizes a 96-well plate and purifies the virus by a virus dilution method, does not need to use low-melting-point agarose, and is simple to operate, economic and efficient.

3. The method for knocking out the baculovirus essential gene disclosed by the invention is simple and efficient because a cell line for stably expressing the gene to be knocked out does not need to be constructed, and is an efficient technology which is easy to operate without using an electric shock instrument, ultra-high speed centrifugation equipment and the like.

Drawings

FIG. 1 is a diagram of the upstream and downstream genome structure of recombinant and non-recombinant bacmid orf 92;

FIG. 2 is a restriction enzyme digestion-verifying electrophoretogram of the transfer vector;

FIG. 3 is an electrophoretogram of PCR-verified products of various strains;

FIG. 4 shows the results of culture of transformed DH10B competent cells;

FIG. 5 is a graph of transfection-infection of orf92 knockout and rescued strains thereof.

Detailed Description

The plasmid, the low-melting point agarose, the PCR reagent and the enzyme digestion reagent related by the invention are all conventional reagents in the field; the invention provides a new technical idea, obtains the knockout strain of the essential gene knockout simply and efficiently, and solves the problem that the prior art needs a cell line for stably expressing the essential gene to be knocked out, low-melting agarose, an electroshock instrument and antibiotics as necessary technical means. Typical materials and equipment: the test uses silkworm ovary cell lines BmN, DH5a and DH10B. Calcium chloride for preparation of competence was purchased from Sigma; the transfection reagent was Invitrogen lipo 2000. The equipment used (e.g., centrifuge and clean bench) was laboratory-scale equipment. The specific operation method/test method related by the invention is a conventional method in the field, for example, the conditions related to transformation, transfection and extraction are consistent with the conventional requirements in the field, and the specific method does not influence the realization of the technical effect of the invention.

The method for knocking out the baculovirus essential gene disclosed by the invention comprises the following steps:

(1) Constructing a transfer vector and transforming baculovirus bacmids;

The method comprises the steps of firstly introducing a copy of an essential gene to be knocked out into a polyhedron gene locus through a Bac-to-Bac transposition system, co-transfecting BmN cells with the modified bacmid and a transfer vector, purifying after primary homologous recombination to obtain a white spot knocked-out strain with the essential gene knocked out but the essential gene copy contained in the polyhedron gene locus, called an intermediate knocked-out strain, and carrying out secondary homologous recombination on unmodified bacmid viruses (namely bacmid capable of forming blue spots, original BmNPV bacmid bought from merchants and existing in DH10B competence without an external gene inserted into the polyhedron gene locus) and the intermediate knocked-out strain viruses in the BmN cells to replace the essential gene copy in the polyhedron gene locus, so as to finally obtain the blue spot knocked-out strain with the essential gene knocked-out and complete polyhedron gene transposition locus (namely the blue spot knocked-out strain capable of forming blue spots without an external gene inserted into the polyhedron gene locus).

In the examples of the present invention, the sequences (reverse PCR, PCR) used for the amplification and construction of the transfer vector used the same system and procedure as follows:

amplification System (50. Mu.l):

ddH ₂ O: 32 μl

5× PrimeSTAR Buffer (Mg2+ Plus):10 μl

1× dNTP Mixture (2.5 mM each) : 4 μl

primer 1 (concentration 10. Mu. Mol): 1. Mu.l

Primer 2 (concentration 10. Mu. Mol): 1. Mu.l

Template (plasmid 100 ng, bacmid 400 ng): 1 μ l

DNA Polymerase (Takara PrimeSTAR HS DNA Polymerase): 1. mu.l

And (3) amplification procedure:

94℃ 5 min

30 cycles: 10 sec at 98 ℃; 15 sec at 55 ℃ and 1 min/kb at 72 ℃;

72℃ 10 min

4℃ 1 hr

bacteria liquid PCR verification system (15 mul)

ddH ₂ O: 11μl

10×PCR Buffer(Mg 2+ plus):1.5 μl

1× dNTP Mixture (2.5 mM each) : 0.6 μl

Primer 1 (concentration 10. Mu. Mol): 0.3. Mu.l

Primer 2 (concentration 10. Mu. Mol): 0.3. Mu.l

Template (bacterial solution): 1 μ l

DNA Polymerase (Takara PrimeSTAR HS DNA Polymerase): 0.3 Mu.l

orf92 primer validation PCR program:

a forward primer: 5' -CTGGGATCCGCCACCATGGAATGCCCGTTTCAGATTCAAG -3’；

Reverse primer: 5' -GCCCTGAATTCCTACAAATAATAGTTGTACTTGATGG -3’）

The procedure is as follows:

94℃ 5 min

30 cycles: 94 ℃ for 30 sec; 60 ℃ 30 sec, 72 ℃ 1 min/kb;

72℃ 10 min

4℃ 1 hr

m13 primer sequence

A forward primer: 5' CGCCAGGGTTTTTTCCCAGTCACGAC

Reverse primer: 5' AGCGGATAACAATTCACCACGGGA-3

The procedure is as follows:

94℃ 5 min

30 cycles: 94 ℃ for 30 sec; 30 sec at 55 ℃ and 1 min/kb at 72 ℃;

72℃ 10 min

4℃ 1 hr。

the invention is further described below with reference to the following examples:

the first embodiment is as follows: the method for knocking out baculovirus essential gene

(1) Construction of transfer vectors

Design of primer (forward primer: 5' -TAT) with puc19 as templateGAATTCACAACTGTCCTGATGCCGC-3'; reverse primer: 5' -ATAGGATCCAATCATGGTCATAGCTGTTTTCCTG-3') carrying out reverse PCR to linearize puc19 and obtain a linear puc19 vector;

using Bombyx mori nuclear polyhedrosis virus bacmid DNA as a template, orf92 gene (essential gene) and its upstream and downstream sequences were amplified by PCR, see FIG. 1 (forward primer: 5' -ATA)GGATCCGACAATCCAGTCACGGACGAACATC-3'; reverse primer: 5' -ACACTGAATTCAACGCTGCCTGACGACCAGTCTATG-3') to obtain a PCR amplification product;

performing first round enzyme digestion by using Takara BamHI + EcoRI restriction enzyme according to a conventional method, performing ligation reaction by using a raw T4 ligase according to an instruction, and connecting an amplification product to a linear puc19 vector to construct an intermediate transfer vector;

design primer (forward primer: 5' -TCA) using intermediate transfer vector as templateAAGCTTGTCGTCTGTGGGCACGTACAACT-3'; reverse primer: 5' -CTCCTGCAGCGCTACAGTAAACCGCTCCAGTCTTC-3') to obtain a linear amplification product of the intermediate transfer vector;

design of primers (Forward primer: 5' -GTA)GAATTCATGGTGAGCAAAGGGCGAGGA-3', reverse primer: 5' -GCGAAGCTTTTACTTGTACAGCTCGTCCCATGC-3'), a green fluorescent gene egfp is amplified by PCR by taking a pEGFP-N1 plasmid as a template, restriction enzyme digestion is carried out by Takara EcoRI + HindIII restriction enzyme, ligation reaction is carried out by using a raw T4 ligase, the egfp is connected to an EcoRI-HindIII site of a pFastBac1 vector, and thus pFastBac-pohp-egfp is constructed;

design of primers (Forward primer: 5' -TAT)AAGCTTCATCGTTGTTCGCCCAGGACTC-3'; reverse primer: 5' -GGCCTGCAGTTACTTGTACAGCTCGTCCCATGC-3') for PCR amplification of reporter gene egfp and its polyhedron promoter with pFastBac-pohp-egfp plasmid as template to obtain reporter gene amplification product;

according to a conventional method, takara HindIII + PstI restriction enzyme is adopted for second round enzyme digestion, the ligation reaction is carried out by using the raw T4 ligase according to the instruction, and the reporter gene amplification product is connected to the intermediate transfer vector linear amplification product to construct the final transfer vector. The restriction enzyme-verified electrophorogram is shown in FIG. 2. Lane 1 is DL-5000; the intermediate transfer vector was digested with Takara BamHI + EcoRI restriction enzymes to generate two bands (see lane 2), one of which was a puc19 vector fragment of about 2700 bp and the other was an insert of 3454 bp, which was expected; the final transfer vector was digested with Takara BamHI + EcoRI restriction enzyme to generate two bands (see lane 3) due to a BamHI cleavage site in the polyhedrin promoter-egfp expression cassette (see FIG. 1), and the insert generated a 1873bp band (containing the left arm and egfp) and a 1944bp band (containing the polyhedrin promoter, 135bp and the right arm at the 5' end of orf 92) which were superimposed on the electrophoretogram due to their comparable sizes; the final transfer vector was digested with Takara BamHI + PstI restriction enzymes, yielding a left arm of 1113bp, and an egfp of 754bp (cloned at the EcoRI-HindIII site of pfastbac 1), see lane 4; the final transfer vector was digested with Takara PstI + HindIII restriction enzymes to generate a 959 bp egfp gene expression cassette (see lane 5). The final transfer vector was digested with Takara HindIII + EcoRI restriction enzyme, yielding a 1745 bp right arm (see lane 6). The enzyme digestion result proves that the final transfer vector is successfully constructed.

Modification of baculovirus

Silkworm nuclear polyhedrosis virus (BmNPV) bacmid DNA is used as a template, and orf92 gene (essential gene) is amplified by PCR (forward primer: 5' -CTG)GGATCCGCCACCATGGAATGCCGTTTCAGAGTTCAAG-3'; reverse primer: 5' -GCCCTGAATTCCTACAAATAATAGTTGTACTTGATGG-3') to obtain orf92 amplification product; pFastBac-pohp-orf92 was constructed by ligating orf92 to the BamHI-EcoRI site of the pFastBac1 vector by digestion with Takara BamHI + EcoRI restriction enzyme and ligation using the constructed T4 ligase as described in the specification according to the conventional method. The results of the BamHI + EcoRI digestion of pFastBac-pohp-orf92 are shown in FIG. 3, lane 10.

According to the specification of an insect cell-baculovirus expression system of invitrogen, orf92 is transposed to a polyhedron locus of a baculovirus (BmNPV) bacmid by a Bac-to-Bac transposition system to obtain a baculovirus bacmid with an essential gene to be knocked out driven by a polyhedron promoter, namely, a modified baculovirus (BmNPV) bacmid. Verification was performed using orf92 and M13 primers. According to the instruction, the successfully transposed bacmids are verified by M13 primer, the size of the band is 2300 bp + the size of the inserted foreign gene, and the size of the band is 2300+1176=3476 bp because orf92 is 1176, and the verification results are shown in FIG. 3, lane 2 (orf 92 primer) and 3 (M13 primer).

(2) Homologous recombination and purification of baculovirus in silkworm cells

Co-transfecting the final transfer vector constructed in the step (1) and the modified BmNPV bacmid with a transfection reagent by a standard method of an instruction;

4 days after transfection, 1. Mu.l of the supernatant of the transfected cells was added to 20 ml of a cell culture medium (TC-100 medium, manufactured by Sigma, containing 5X 10 cells) containing 10% fetal bovine serum ⁷ Individual BmN cells), then added to a 96-well plate on average for 3 days of conventional incubation (without using low melting point agarose),then, the well exhibiting the largest number of green fluorescent cells observed in the eyes (having fluorescence in a cell mass) was selected from the 96-well plate, and 0.1. Mu.l of the supernatant was added to 20 ml of a cell culture medium (TC-100 medium, manufactured by Sigma, containing 5X 10% fetal bovine serum) containing 10% fetal bovine serum ⁷ Individual BmN cells), then added to a 96-well plate on average for conventional incubation for 3 days (without using low-melting agarose), and wells with the highest green fluorescent cell number observed under flesh eye (fluorescence of a large population of individual cells) are selected from the 96-well plate, and the cell supernatant is pipetted to 25 cm confluent with the BmN cells ² The cells were cultured in a culture flask for 3 days in a conventional manner in a cell culture medium (TC-100 medium, manufactured by Sigma) containing 10% fetal bovine serum.

(3) The baculovirus was purified by transformation of E.coli DH10B

And (3) extracting rod particle DNA from virus-infected BmN cells cultured for 3 days in the step (2) by using a Biyuntian baculovirus shuttle vector bacmid small-amount extraction kit, transforming DH10B competent cells (without rod particles) by using a standard heat shock method process, coating the transformed rod particle DNA on LB agar culture plates containing tetracycline (10 mu g/ml), kanamycin (50 mu g/ml) and gentamicin (7 mu g/ml), culturing for 16 hours at 37 ℃, and picking colonies for bacteria liquid PCR, wherein the primers are orf92 amplification primers and M13 primers. If homologous recombination occurs, a reporter gene is inserted at the orf92 gene locus itself, resulting in a 1545 bp band, and a 1188 bp band due to a complete copy of the orf92 gene at the polyhedrin locus. Thus, bacmid that did not undergo homologous recombination produced a band of 1188 bp, and colonies that produced two bands contained the intermediate knockout, see FIG. 3, lanes 4 (orf 92 primer) and 5 (M13 primer).

(4) Homologous recombination of baculovirus in silkworm cell

Bacmid DNA was extracted from the strain containing the intermediate knockout strain obtained in step (3) (white colonies) and transfected into BmN cells by the standard method described in the specification using a transfection reagent, and after 4 days, cell supernatants were collected to co-infect the BmN cells with unmodified bacmid virus (BmNPV) which forms blue spots, and cultured for 3 days to obtain virus-infected BmN cells.

(5) The baculovirus was purified by transformation of E.coli DH10B

And (3) extracting rod particle DNA from the virus-infected BmN cells obtained in the step (4) by using a Biyuntian baculovirus shuttle vector bacmid small-amount extraction kit, transforming DH10B competent cells by using a standard heat shock method process, coating the rod particle DNA on an LB agar culture plate containing tetracycline (10 mu g/ml), kanamycin (50 mu g/ml), IPTG (40 mu g/ml) and X-gal (100 mu g/ml), culturing for 48 hours at 37 ℃ (as shown in figure 4), and selecting blue colonies for carrying out bacteria liquid PCR, wherein the primers are orf92 amplification primers and M13 primers. The PCR results for blue colonies containing the orf92 knockout, see FIG. 3, lanes 6 (orf 92 primer) and 7 (M13 primer), yielded a strain containing the bacmid with the essential gene knockout (i.e., containing the orf92 knockout).

Counting the time of use:

for transfer vector construction: 6 days;

the baculovirus is used for homologous recombination and purification in silkworm cells: 13 days;

when the baculovirus was purified by transformation of E.coli DH 10B: 1 day;

when baculovirus is used for homologous recombination in silkworm cells: 7 days;

when the baculovirus was purified by transformation of E.coli DH 10B: 2 days;

when the total use is carried out: and 29 days.

Feasibility: a knockout strain in which the essential gene orf92 is knocked out is obtained.

Experimental verification

To determine that the phenotype of the orf92 knockout strain was due to deletion of orf92, but not mutation at other sites, a rescue strain was constructed by the Bac-to-Bac system, i.e., a copy of orf92 was introduced at the polyhedrin locus of the orf92 knockout strain obtained above, validation results were constructed, see fig. 3, lanes 8 (orf 92 primer) and 9 (M13 primer), and transfection-reinfection experiments were performed for the orf92 knockout strain and the orf92 knockout rescue strain. Since orf92 is an essential gene, the virus cannot spread from cell to cell after deletion, so green fluorescence was observed only in cells that were successfully transfected, see fig. 5; the rescued strain introduced a copy of orf92 at the polyhedrin locus restored infectivity and spread among cells, so green fluorescence was observed in the cell population, see fig. 5. This validation confirmed that the phenotype of the orf92 knockout strain was indeed due to the orf92 knockout.

Comparative experiment 1

On the basis of the first embodiment, if the step (2) is adjusted to: the final transfer vector constructed in step (1) and unmodified BmNPV bacmid were co-transfected with the transfection reagent by standard methods described in the specification for BmNP cells. Otherwise, according to example one, the virus could not spread between cells, the purification experiment could not be performed, and the experiment was terminated.

Because orf92 is an essential gene, the competitiveness of a knockout strain is weak after deletion, and a green fluorescent cell colony of a sheet is difficult to form; theoretically, the knockout is easy, but the homologous recombination ratio is extremely low, so the technical difficulty is purification, because the virus cannot spread after the essential gene knockout, the key of the invention is that the virus with the essential gene knockout can also be purified, thereby obtaining the knockout strain with the essential gene orf92 knockout. Moreover, the transfer vector is constructed by reverse PCR, and compared with the traditional method, one round of enzyme digestion ligation reaction is saved; the virus was purified by dilution without using low-melting agarose, and by engineering bacmid, essential genes could be knocked out in cells. The method has complete repeatability, can obtain the knockout strain with the essential gene orf92 knockout through repeated experiments, and is proved to be the orf92 knockout strain through experimental verification.

The comparison is carried out by adopting the conventional method, and the following brief description is provided, and any existing literature can be referred to for a more specific method.

Comparative example one: knockout method using cell line stably expressing gene to be knocked out

(1) Establishment of cell line stably expressing orf92 gene

The orf92 gene is transposed to the genome of silkworm cells by using Piggybab, and then the cells successfully transposed with the orf92 gene are enriched by antibiotic screening.

(2) Construction of transfer vectors

Designing a primer, carrying out PCR amplification on a homologous recombination left arm of the orf92 gene, cloning the homologous recombination left arm to the puc19, then carrying out PCR amplification on a homologous recombination right arm of the orf92 gene, cloning the homologous recombination right arm to the puc19 connected with the left arm, finally carrying out PCR amplification on a reporter gene and a promoter thereof, and cloning the reporter gene and the promoter thereof between the left arm and the right arm to construct a final transfer vector;

(3) Homologous recombination and purification of baculovirus in silkworm cells

And (3) co-transfecting the BmNP cells with the constructed transfer vector and the BmNPV DNA by using a transfection reagent. 6 rounds of purification were performed using low melting point agarose; the existing purified virus is covered on cells by low-melting point agarose, so that the virus cannot randomly diffuse along with a liquid culture medium. This is because the low melting point agarose is solid and the virus can only diffuse out slowly from one point, thus allowing purification of the virus;

time of use statistics

Establishment of cell lines stably expressing orf92 gene: 35 days

For transfer vector construction: 10 days;

the baculovirus is used for homologous recombination and purification in silkworm cells: 30 days;

when the total use is carried out: and 75 days.

Comparative example two: knockout method using Red recombination technology in Escherichia coli

(1) Amplification of Linear PCR products

Designing a primer containing an orf92 gene homology arm, carrying out PCR amplification by taking chloramphenicol as a template, and carrying out gel recovery.

(2) Linear PCR knock-out fragment transformation of BW25113

Transforming BW25113 competent cells by a standard heat shock process; culture at 30 ℃ and induction of RED recombinase expression with L-arabinose and heat shock at 42 ℃ for half an hour lost the pKD46 plasmid encoding the RED recombinase.

Time of use statistics

Time for amplification of linear PCR products: 5 days;

linear PCR knock-out fragment when transforming BW 25113: 2 days;

total labor: 7 days;

feasibility: no knock-out strain was obtained.

Example data analysis

The data for the above three groups indicate that: compared with the first comparative example, the method of the invention is less time-consuming, is 38.67 percent of the time-consuming of the first comparative example (the knockout method by using the cell line stably expressing the gene to be knocked out), and does not need expensive low-melting-point agarose; since the second comparative example (the knockout method using Red recombination technique in escherichia coli) uses a linear PCR fragment, the transformation efficiency is low, and the recombination rate of Red recombination technique is low, no knockout strain can be obtained without using a shock instrument. In addition, the technology of the invention has simple operation, does not need special equipment and is easy to operate.

The invention uses inverse PCR to construct an intermediate transfer vector, and then uses inverse PCR to connect a reporter gene to the transfer vector; then transfect the BmN cell by the modified baculovirus bacmid and the transfer vector; the virus is diluted for purification without using low melting point agarose; then extracting bacmid DNA from the transfected BmN cells by using a kit, and transforming the competence of Escherichia coli DH 10B; then co-infecting the obtained intermediate knockout strain virus and unmodified bacmid virus with the BmN cell without purification; finally, bacmid DNA is extracted from transfected BmN cells by using a kit, and escherichia coli DH10B competence is transformed, so that a knockout strain with an essential gene orf92 knocked out is obtained. The method does not need other steps, does not need technical means such as low-melting-point agarose, an electroshock instrument, antibiotics and the like which are considered necessary in the prior art, and obtains the knockout strain of the essential gene orf92 with low cost and high efficiency.

Sequence listing

<110> Suzhou university

<120> a method for knocking out an essential gene of baculo virus

<160> 14

<170> SIPOSequenceListing 1.0

<210> 1

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

ctgggatccg ccaccatgga atgcccgttt cagattcaag 40

<210> 2

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gccctgaatt cctacaaata atagttgtac ttgatgg 37

<210> 3

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

cgccagggtt ttcccagtca cgac 24

<210> 4

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

agcggataac aatttcacac ggga 24

<210> 5

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

tatgaattca caatctgctc tgatgccgc 29

<210> 6

<211> 33

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ataggatcca atcatggtca tagctgtttc ctg 33

<210> 7

<211> 34

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

ataggatccg acaatccagt cacggacgaa catc 34

<210> 8

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

acactgaatt caacgctgcc tgacgaccag tctatg 36

<210> 9

<211> 34

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

tcaaagcttg tcgtctgtgg gcacgtacac aatc 34

<210> 10

<211> 34

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

ctcctgcagc gctacagtaa accgctccag tctc 34

<210> 11

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

gtagaattca tggtgagcaa gggcgagga 29

<210> 12

<211> 32

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

gcgaagcttt tacttgtaca gctcgtccat gc 32

<210> 13

<211> 32

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

tataagcttc atcgtttgtt cgcccaggac tc 32

<210> 14

<211> 32

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

ggcctgcagt tacttgtaca gctcgtccat gc 32

Claims

1. A method for knocking out an essential gene of baculovirus, comprising the steps of:

(1) Constructing a transfer vector and transforming baculovirus bacmids; taking a carrier as a template, and carrying out reverse PCR to linearize the carrier to obtain a linear carrier; using baculovirus bacmid DNA as a template, and carrying out PCR amplification on an essential gene and upstream and downstream sequences thereof to obtain an essential gene sequence to be knocked out and amplification products of the upstream and downstream sequences; taking the intermediate transfer vector as a template, and carrying out reverse PCR to obtain an intermediate transfer vector linear amplification product; using a reporter gene plasmid as a template, and carrying out PCR amplification on the reporter gene and a polyhedron promoter thereof to obtain a reporter gene amplification product; connecting the amplification product of the essential gene sequence to be knocked out and the upstream and downstream sequences thereof to a linear vector through enzyme digestion connection to construct an intermediate transfer vector, and connecting the report gene amplification product to the linear amplification product of the intermediate transfer vector through enzyme digestion to construct the transfer vector; using baculovirus rod particles as a template, carrying out PCR amplification on an essential gene to obtain an essential gene amplification product; then connecting the essential gene amplification product to a vector, thereby constructing an essential gene plasmid; then, the essential gene is transposed to the polyhedron locus of the baculovirus bacmid through a Bac-to-Bac transposition system to obtain a modified baculovirus bacmid;

(2) Carrying out homologous recombination and purification on the transfer vector and the modified baculovirus bacmid in silkworm cells, and extracting DNA; co-transfecting the transfer vector and the modified baculovirus bacmid DNA into a silkworm cell for homologous recombination; then taking the supernatant and silkworm cells to incubate in a 96-well plate; then taking out the supernatant in the hole with the largest number of green fluorescent cells, adding the supernatant into another 96-well plate for incubation; then adding the supernatant in the hole with the largest number of green fluorescent cells into a culture bottle which is full of silkworm cells, and extracting DNA after culturing;

(5) Transforming the extracted DNA into escherichia coli competence, selecting a blue bacterial colony to perform bacterial liquid PCR to obtain a bacterial strain containing bacmid with the essential gene knocked out, and knocking out the essential gene of the baculovirus;

the essential gene is orf92 gene; the silkworm cell is a silkworm ovary cell line; the baculovirus is bombyx mori nuclear polyhedrosis baculovirus.

2. The method for knocking out an essential gene of baculovirus according to claim 1, wherein: in the step (3), the extracted DNA is transformed into escherichia coli competence, then the escherichia coli competence is coated on an agar culture plate, after culture, bacterial colonies are picked for PCR (polymerase chain reaction) to obtain a bacterial strain containing the intermediate knockout strain.

3. The method for knocking out an essential gene of baculovirus according to claim 1, wherein: in the step (4), baculovirus bacmid DNA is extracted from the strain containing the intermediate knockout strain and is transfected into silkworm cells, then the supernatant and unmodified bacmid virus are taken to infect the silkworm cells together, the culture is carried out for 3 days, and then the DNA is extracted.

4. The method for knocking out an essential gene of baculovirus according to claim 1, wherein: in the step (5), the extracted DNA is transformed into escherichia coli competence, then the escherichia coli competence is coated on an agar culture plate, after culture, a blue colony is selected to be used as bacterial liquid PCR, and a bacterial strain containing bacmid with the baculovirus essential gene knocked out is obtained.

5. A strain containing bacmid knocked out baculovirus essential gene obtained by the method of knocking out baculovirus essential gene according to claim 1.