CN1316024C - DNA sequence encoding polypeptide with salt tolerance, salt resistant polypeptide SING-22 and expression carrier - Google Patents
DNA sequence encoding polypeptide with salt tolerance, salt resistant polypeptide SING-22 and expression carrier Download PDFInfo
- Publication number
- CN1316024C CN1316024C CNB2004100517550A CN200410051755A CN1316024C CN 1316024 C CN1316024 C CN 1316024C CN B2004100517550 A CNB2004100517550 A CN B2004100517550A CN 200410051755 A CN200410051755 A CN 200410051755A CN 1316024 C CN1316024 C CN 1316024C
- Authority
- CN
- China
- Prior art keywords
- sing
- salt
- dna
- polypeptide
- lys
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The present invention relates to a DNA sequence for encoding polypeptide having the characteristic of salt resistance, salt-resistance polypeptide SING-22 and an expression carrier. The DNA sequence has the nucleotide sequence of SEQID No. 1 in the sequence table or the nucleotide sequence hybridized with the nucleotide sequence of SEQID No. 1 under extremely strict conditions. The salt-resistance polypeptide SING-22 has the amino acid sequence of SEQID No. 2 in the sequence table, and the molecular weight is 17.0KD. The recombination carrier contains the nucleotide sequence of SEQID No. 2 or the nucleotide sequence hybridized with the nucleotide sequence of SEQID No. 1 under extremely strict conditions. The polypeptide SING-22 has the characteristics of hydrophilicity, thermal stability and salt resistance. The DNA sequence can be applied to new anti-resistance plant variety cultivation.
Description
Technical field
The invention belongs to the genetically engineered field, dna sequence dna, its express polypeptide and the expression vector of the polypeptide of the tool salt-tolerant trait that is specifically related to encode.
Background technology
It is the important factor that influences agriculture production and ecotope that arid, salt marsh, soil desertify.Arid, soil desertify and the frequent dust and sand weather that takes place, havoc human ecotope of depending on for existence.Constantly increase at population, cultivated area reduces and the Freshwater resources deficiency, and under the serious pressure of the deterioration of the ecological environment, increases grain yield, improves the ecological environment, and promotes sustainable development, and has become the problem that scientist, society and national government are concerned about.Along with to going deep into of plant drought salt tolerant Mechanism Study and being gradually improved of transgenic technology, clone the drought resistance and salt tolerance gene, improve the resistance function of drought resistance and salt tolerance gene, cultivate the adversity resistant plant new variety, provide possibility for solving above-mentioned problems.
The salt and the low temperature stress of arid and high density will cause cell dehydration, cause height to ooze and coerce and ion imbalance, cause cell poor growth, dysplasia, seriously will make cell and organism death.Plant has been developed number of mechanisms and has adapted to or resist environment-stress and dehydration reaction in the long-term evolution process.Up to now, scientists has obtained some can express salt tolerant, drought-enduring proteinic gene, as betaine aldehyde dehydrogenase gene (people such as Chen Shouyi, Chinese patent publication number: CN1221034A), barley HVA gene (Xu De-ping etc., Plant Physiol, 1996,110:249-257), Na
+/ H
+Antiport protein gene GhNHX (Zheng Chengchao, Chinese invention patent publication number CN1425675A), 1-phosphomannitol dehydrogenase (Tarczynski, Science, 1993,259:508-510), Δ `-pyrroline-5-carboxylate reductase (D5CR) (Kishol, P.B.K, PlantPhysical, 1995,108:1387-1394) etc.The drought resistance and salt tolerance number gene of people's acquisition at present is few, and this makes that implementing degeneration-resistant genetic breeding engineering is restricted.
In order to improve the drought resistance and salt tolerance ability of transgenic plant better, people are just making great efforts to obtain more drought-enduring resistant gene of salt, particularly those key genes that play an important role.Yet, obtain crucial drought-enduring resistant gene of salt and be not thing easily, need a large amount of cut-and-try works do the basis.Therefore, study drought tolerance in plants resistant gene of salt 26S Proteasome Structure and Function, not only can disclose the mechanism of drought tolerance in plants salt tolerant, also can utilize the functional zone sequence that plays drought-enduring salt tolerant in these gene orders, provide genetic resources for further implementing degeneration-resistant genetic breeding.
Summary of the invention
First purpose of the present invention is to provide the polypeptide of the tool salt-tolerant trait of a kind of dna sequence dna of polypeptide of the tool salt-tolerant trait of encoding and expression thereof.
Second purpose of the present invention is to provide the expression vector of the dna sequence dna that contains coding tool salt-tolerant trait polypeptide of the present invention.
The 3rd purpose of the present invention is the dna sequence dna of coding tool salt-tolerant trait polypeptide of the present invention is applied to cultivate salt tolerant, drought-enduring, low temperature resistant new variety of plant.
The object of the present invention is achieved like this:
Dna sequence dna provided by the invention is the described nucleotide sequence of SEQ ID NO.1 or can be under rigorous condition and the nucleotide sequence of the described nucleotide sequence hybridization of SEQ ID NO.1 in the sequence table, and the described nucleotide sequence of SEQ ID NO.1 is specific as follows in the sequence table:
GCCACGGACA?ACAACAACAA?CAAAACCGGT?TCCAAGGTCG?GAGAGTACGC?AGATTACGCT?60
TCTCAGAAGG?CCAAGGAAAC?AAAAGATGCA?ACGATGGAAA?AAGCTGGAGA?GTACACGGAT?120
TATGCTTCGC?AGAAAGCGAA?GGAAGCGAAG?AAGACGACCA?TGGAGAAGGG?TGGAGAATAC?180
AAGGATTACT?CTGCGGAGAA?AGCTAAGGAG?AGAAAAGATG?CTACTGTGAA?TAAGATGGGA?240
GAGTATAAGG?ACTATGCTGC?GGAGAAAGCC?AAAGAGGGGA?AAGATGCTAC?TGTGAATAAA?300
ATGGGAGAGT?ATAAGGACTA?TGCTGCGGAG?AAAACGAAAG?AGGGGAAAGA?TGCCACTGTG?360
AATAAGATGG?GAGAGTATAA?GGATTACACT?GCGGAGAAGG?CGAAAGAGGG?GAAAGATACG?420
ACGTTGGGG 429
The described dna sequence dna of SEQ ID NO.1 derives from the partial sequence of soybean GmPM2 gene (GenBank No:M80664) reading frame in the sequence table, and its length is 429bp, and the applicant is with this dna fragmentation called after SING-22.The inventor infers that dna sequence dna SING-22 encoded protein matter product S ING-22 can form hydrophilic α-Luo Xuanjiegou.In order to prepare this dna fragmentation, the inventor amplifies this fragment according to this dna sequence dna design Auele Specific Primer with PCR method.
The polypeptide SING-22 of tool salt-tolerant trait provided by the invention is by dna sequence dna SING-22 coding, and polypeptide SING-22 is the described aminoacid sequence of SEQ ID NO.2 in the sequence table, and is specific as follows:
Ala?Thr?Asp?Asn?Asn?Asn?Asn?Lys?Thr?Gly?Ser?Lys?Val?Gly?Glu?Tyr
1 5 10 15
Ala?Asp?Tyr?Ala?Ser?Gln?Lys?Ala?Lys?Glu?Thr?Lys?Asp?Ala?Thr?Met
20 25 30
Glu?Lys?Ala?Gly?Glu?Tyr?Thr?Asp?Tyr?Ala?Ser?Gln?Lys?Ala?Lys?Glu
35 40 45
Ala?Lys?Lys?Thr?Thr?Met?Glu?Lys?Gly?Gly?Glu?Tyr?Lys?Asp?Tyr?Ser
50 55 60
Ala?Glu?Lys?Ala?Lys?Glu?Arg?Lys?Asp?Ala?Thr?Val?Asn?Lys?Met?Gly
65 70 75 80
Glu?Tyr?Lys?Asp?Tyr?Ala?Ala?Glu?Lys?Ala?Lys?Glu?Gly?Lys?Asp?Ala
85 90 95
Thr?Val?Asn?Lys?Met?Gly?Glu?Tyr?Lys?Asp?Tyr?Ala?Ala?Glu?Lys?Thr
100 105 110
Lys?Glu?Gly?Lys?Asp?Ala?Thr?Val?Asn?Lys?Met?Gly?Glu?Tyr?Lys?Asp
Tyr?Thr?Ala?Glu?Lys?Ala?Lys?Glu?Gly?Lys?Asp?Thr?Thr?Leu?Gly
130 135 140
Polypeptide SING-22 has the molecular weight of 17.0KD.
The invention provides the recombinant vectors of the nucleotide sequence that contains dna sequence dna SING-22 or can under rigorous condition, hybridize with dna sequence dna SING-22.When increasing dna sequence dna of the present invention, can add the restriction enzyme site that can be connected on the carrier, for example, can be added with EcoR I site, can be added with Hind III site at 3 ' end at 5 ' end at the 5 ' end and the 3 ' end of dna sequence dna with PCR method.In order to make up recombinant vectors of the present invention, after the inventor reclaims the dna fragmentation that amplifies, enzyme is cut, be connected to expression vector, the recombinant vectors of the nucleotide sequence that promptly obtains to contain dna sequence dna SING-22 or can under rigorous condition, hybridize, for example described recombinant plasmid pET28a::SING-22 of the embodiment of the invention with dna sequence dna SING-22.
The recombinant vectors that obtains is transformed the host,, obtain transformant as intestinal bacteria TOP10.Extract recombinant vectors and carry out PCR reaction and restriction analysis from transformant, recombinant vectors is transformed the host again, for example e. coli bl21 STAR obtains transformant, for example the engineering bacteria BL21/pET28a::SING-22 described in the embodiment.
Carry out isopropyl-and induce expanding engineering bacteria BL21/pET28a::SING-22 after numerous, induced product carries out polyacrylamide gel electrophoresis.After Coomassie brilliant blue dyeing, a special protein band appears on the electrophoresis plate.To use the trifluoroacetic acid wash-out behind this protein band cutting-out, the enzymolysis.Elutriant is identified through LC-MS-electrospray ionization mass spectrum (Agilent company), is proved that this protein band really is polypeptide SING-22.
By experiment showed, of inventor polypeptide SING-22 provided by the invention possess hydrophilic property, thermostability and salt-tolerant trait.
Dna sequence dna SING-22 provided by the invention or the nucleotide sequence that can hybridize with dna sequence dna SING-22 under rigorous condition can be applicable to cultivate salt tolerant, drought-enduring, low temperature resistant new variety of plant:
Design a pair of Auele Specific Primer that has translation initiation site ATG and terminator codon TGA respectively, from engineering bacteria pET28a::SING-22, amplify the SING-22 gene.Be connected in the plant expression vector.The SING-22 expression carrier be will have and plant tissue or cell transformed.Extract genomic dna the plant leaf after transforming, the PCR that carries out the SING-22 gene identifies.The transfer-gen plant that will have a SING-22 gene is planted to contain in the salt culture medium and is cultivated.Cultivate after 15-25 days as can be seen, the growth conditions of transfer-gen plant is significantly better than the adjoining tree that does not contain the SING-22 gene.This result shows that the salt tolerance of transfer-gen plant is better than the latter.
Salt tolerant dna sequence dna of the present invention and resistant gene of salt thereof are to clone from the soybean immature seed, the product of its coding should belong to storage protein matter part, therefore, dna sequence dna of the present invention and corresponding gene do not relate to the safety issue to environment, ecology and food.
The invention will be further described below in conjunction with drawings and Examples.
Description of drawings
Fig. 1 is the structure schema of recombinant plasmid pET28a::SING-22 in the embodiment of the invention two.
Embodiment
Embodiment one: the preparation of the dna sequence dna SING-22 of coded polypeptide SING-22.
1. the preparation of soybean immature seed cDNA:
Test used soybean seeds and take from Jilin Province Baicheng City research of agricultural science institute.
Utilize (the RNAgents of Promega company
) RNA extracts test kit (Total RNAIsolation System), according to the specification sheets operation of test kit, extracts the mRNA of soybean immature seed.MRNA with extraction is a template, and oligonucleotide (olig) dT is a primer, utilizes reverse transcription test kit (available from Takara company), carries out reverse transcription (RT) reaction, obtains soybean immature seed cDNA.
The reverse transcription reaction system is:
10 * RNA PCR damping fluid, 2 μ l
MgCl
2(25mM) 4μl
DNTP mixture (each 10mM) 2 μ l
AMV ThermoScript II XL (5U/ μ l) 1 μ l
RNase inhibitor (40U/ μ l) 0.5 μ l
Oligonucleotide dT (2.5 μ M) 1 μ l
Soybean immature seed mRNA 1 μ l
dH
2O 8.5μl
20 μ l altogether
The condition that reverse transcription (RT-PCR) reaction is carried out is:
The centrifuge tube that above-mentioned reaction system is housed is placed in the PCR instrument, adopt following reaction conditions to carry out reverse transcription reaction: promptly 30 ℃, 10 minutes; 45～60 ℃, 20 minutes; 95 ℃, 5 minutes.Promptly obtain soybean immature seed cDNA.
2.DNA the preparation of sequence SING-22:
According to a pair of specific primer of dna sequence dna SING-22 (429bp) design, primer sequence is seen SEQ ID NO:3 and SEQ ID NO:4 in the sequence table, and is specific as follows:
Upstream primer: CACCGAATTCGCCACGGACAACAACAACAAC,
Downstream primer: GTCCAAGCTTCCCCAACGTCGTATCTTT,
5 ' end of above-mentioned primer sequence contains EcoR I restriction enzyme site, and 3 ' end contains the restriction enzyme site of HindIII.The soybean immature seed cDNA that the previous step reverse transcription is made makes the template that PCR reacts, and adopts above-mentioned specific primer sequence, through the PCR reaction, amplifies dna sequence dna SING-22, and this PCR reaction system is as follows:
10 * Ex Taq damping fluid (adds Mg
2+) 10 μ l
TaKaRa Ex Taq enzyme (5U/ μ l) 0.5 μ l
Upstream specific PCR primer (20 μ M) 1 μ l
Downstream specific PCR primer (20 μ M) 1 μ l
Soybean immature seed cDNA 20 μ l
dH
2O 67.5μl
Cumulative volume 100 μ l
This PCR reaction conditions is as follows:
The centrifuge tube that above-mentioned reaction system is housed is placed in the PCR instrument, adopt following reaction conditions to carry out 30 circulations: 94 ℃, 30 seconds; 45～55 ℃, 30 seconds; 72 ℃, 1 minute.Promptly obtained dna fragmentation SING-22.
Embodiment two: the structure of the expression vector of dna sequence dna SING-22
The dna fragmentation SING-22 that embodiment one is amplified is after reclaiming, with EcoR I and HindIII double digestion, be connected to the plasmid pET28a (available from Novagen company) that cuts processing through same enzyme, obtain recombinant plasmid pET28a::SING-22, building process as shown in Figure 1.With recombinant plasmid pET28a::SING-22 transformed into escherichia coli TOP10 (available from Novagen company), obtain intestinal bacteria transformant TOP/pET28a::SING-22.From intestinal bacteria transformant TOP/pET28a::SING-22, extract recombinant plasmid, with recombinant plasmid transformed e. coli bl21 STAR bacterial strain (available from Novagen company), obtain the intestinal bacteria transformant, with this engineering bacteria called after BL21/pET28a::SING-22.
Embodiment three: SING-22 polypeptide expression and evaluation among the intestinal bacteria transformant BL21/pET28a::SING-22.
1. SING-22 polypeptide expression and mass spectrum are identified among the intestinal bacteria transformant BL21/pET28a::SING-22.
(1) SING-22 polypeptide expression and electrophoretic analysis among the intestinal bacteria transformant BL21/pET28a::SING-22.
The mono-clonal of picking engineering bacteria BL21/pET28a::SING-22, be seeded to and contain in that the LB substratum of 50ug/ml card, cultivate 10-15h after, isopropyl-(IPTG) inducible protein that adds final concentration and be 1mM is expressed, behind the 4h, centrifugal collection thalline.Thalline is centrifugal after boiling water boils 5min, gets supernatant liquor and carries out sodium lauryl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) electrophoresis.The result shows, compares with the contrast bacterium, and engineering bacteria BL21/pET28a::SING-22 has a denseer specific band at 20～22kD place, and the molecular weight size of the polypeptide SING-22 of this protein band and expection is approaching.
(2) mass spectroscopy of polypeptide SING-22 among the intestinal bacteria transformant BL21/pET28a::SING-22.
Cut this special protein band from the SDS-PAGE electrophoresis plate.Albumen is carried out tryptic digestion, utilize trifluoroacetic acid (TFA) that protein wash-out from gel is come out again.Elutriant identifies that through LC-MS-electrospray ionization mass spectrum (Agilent) peptide section sequence that the result records is consistent with the sequence of the salt tolerant polypeptide SING-22 of supposition, but shows engineering bacteria BL21/pET28a::SING-22 express polypeptide SING-22.
2. the wetting ability of polypeptide SING-22 and thermal stability analysis.
With centrifugal after the intestinal bacteria transformant BL21/pET28a::SING-22 cracking, get supernatant liquor and carry out the SDS-PAGE electrophoresis.The result shows and has the SING-22 polypeptide in the supernatant liquor, shows that the SING-22 polypeptide exists with water miscible form in the engineering bacteria.
The extracting method of intestinal bacteria transformant BL21/pET28a::SING-22 heat-stable protein is: bacterium liquid with the centrifugal 10min of 15000rpm, is got supernatant liquor and is carried out the SDS-PAGE electrophoresis behind 85 ℃ of thermal treatment 10min.Electrophoresis result shows that nearly all e. coli protein band all disappears, and engineering bacteria BL21/pET28a::SING-22 still obviously exists through the specificity SING-22 of IPTG abduction delivering band, shows that polypeptide SING-22 has good thermostability.
Embodiment four: but the salt tolerant functional analysis of the intestinal bacteria transformant of express polypeptide SING-22.
We obtain engineering bacteria (bacterial strain BL21/pET28a with pET28a carrier transformed into escherichia coli BL21.Be to determine the segmental degeneration-resistant activity of SING-22, we organize in contrast with above-mentioned engineering bacteria (bacterial strain BL21/pET28a), with the engineering bacteria (bacterial strain BL21/pET28a::SING-22) that contains dna sequence dna SING-22 as experimental group.Adopt colony counting method, by observing the upgrowth situation of above-mentioned two kinds of bacterial strains on high salt solid medium, research contains the tolerance of the bacterial strain of SING-22 gene to high salt.
Specific practice is: induce the bacterium liquid of 4h as bacterium stoste isopropyl-(IPTG) respectively, and take turns doing gradient dilution, and it is applied to the LB solid plate and contain 700mM NaCl and the high salt flat board of 500mM KCl on, be inverted for 37 ℃ and cultivate after 2～3 days, the dull and stereotyped bacterium colony number of going up growth of statistics.
Statistical result showed: (bacterial strain BL21/pET28a) compares with control group, the survival rate of experimental bacteria (bacterial strain BL21/pET28a::SING-22) on the 700mMNaCl plate culture medium that contains dna sequence dna SING-22 is higher 1.76 times than the former, and the survival rate on the 500mMKCl plate culture medium is higher 1.66 times than the former.This shows that by the polypeptide SING-22 of SING-22 genes encoding colibacillary breeding is not caused detrimentally affect, on the contrary, the expression of polypeptide SING-22 is given recon bacterial strain (BL21/pET28a::SING-22) with high salt-tolerant trait.
Embodiment five: the structure that contains the plant expression vector of SING-22 gene.
Hold design to have the primer of translation initiation site ATG and BamHI restriction enzyme site at 5 ' of dna sequence dna SING-22,3 ' end design has the primer of terminator codon TGA and SacI restriction enzyme site, is that template increases with the pET28a::SING-22 plasmid.Primer sequence is seen SEQ ID NO:5 and SEQ ID NO:6 in the sequence table, and is specific as follows:
Upstream primer: CTGTGGATCCATGGCCACGGACAACAACA
Downstream primer: CATCGAGCTCACTAGTGCCCCAACGTCGT
Amplified production is connected to the plant binary expression vector pBI121 that cuts processing through same enzyme behind BamHI and SacI double digestion, obtain to contain the pBI121::SING-22 plasmid of SING-22 gene.The pBI121::SING-22 plasmid is converted among the Agrobacterium LBA4404 (available from CAMBIA company), obtains to contain the Agrobacterium LBA4404/pBI121::SING-22 of SING-22 expression vector.
Embodiment six: contain the conversion of the Agrobacterium LBA4404/pBI121::SING-22 of SING-22 expression vector to tobacco plant.
Aseptic tobacco leaf disc is put into above-mentioned Agrobacterium (LBA4404/pBI121::SING-22) bacterium liquid to be infected.The dark cultivation after 3 days, the tobacco leaf disc after will infecting is transferred in the division culture medium that contains kantlex and cephamycin.Cultivated 20 days, and differentiated young shoot at the edge of tobacco leaf disc with kalamycin resistance.Promptly obtain the tobacco seedling of commentaries on classics SING-22 gene to be identified this moment.
Embodiment seven: the molecular biology identification of SING-22 gene in transgenic plant.
Extract the tobacco leaf genomic dna from above-mentioned seedling leaves.As template, the primer with SING-22 gene and kanamycin gene carries out the PCR reaction respectively.Electrophoresis detection, amplified production is respectively SING-22 gene and kanamycin gene two specific DNA bands to occur, is two positive reactions.Prove that thus goal gene SING-22 has been incorporated in the genome of tobacco plant.
Embodiment eight: change the salt tolerant functional analysis of SING-22 gene plant.
We transform Agrobacterium LBA4404 with the pBI121 carrier, obtain engineering bacteria (bacterial strain 1LBA4404/pBI121).Utilize this engineering bacteria to infect tobacco leaf disc, the tobacco plant of the anti-kantlex of acquisition is as the adjoining tree of salt tolerant Function Identification.Will be through dna level tobacco plant that identify, that have the SING-22 gene as experimental group.Control group and experimental group tobacco seedling are transferred in the substratum that contains 1.5%NaCl.
Cultivate after 15～25 days, relatively the upgrowth situation of the two plant in containing salt culture medium.The result shows that at this moment the blade flavescence of control group plant is compared with it, and the transgene tobacco leaf color still is deep green, and blade is fuller.As seen, change the SING-22 genetic tobacco to the tolerance of high salt apparently higher than the control group that does not contain foreign gene.
Sequence table
＜110〉Shenzhen University
＜120〉dna sequence dna, salt tolerant polypeptide SING-22 and the expression vector of coding tool salt-tolerant trait polypeptide
<160>6
<170>PatentIn?version?3.1
<210>1
<211>429
<212>DNA
＜213〉soybean (Glycine Max.L)
<400>1
gccacggaca?acaacaacaa?caaaaccggt?tccaaggtcg?gagagtacgc?agattacgct?60
tctcagaagg?ccaaggaaac?aaaagatgca?acgatggaaa?aagctggaga?gtacacggat?120
tatgcttcgc?agaaagcgaa?ggaagcgaag?aagacgacca?tggagaaggg?tggagaatac?180
aaggattact?ctgcggagaa?agctaaggag?agaaaagatg?ctactgtgaa?taagatggga?240
gagtataagg?actatgctgc?ggagaaagcc?aaagagggga?aagatgctac?tgtgaataaa?300
atgggagagt?ataaggacta?tgctgcggag?aaaacgaaag?aggggaaaga?tgccactgtg?360
aataagatgg?gagagtataa?ggattacact?gcggagaagg?cgaaagaggg?gaaagatacg?420
acgttgggg 429
<210>2
<211>143
<212>PRT
＜213〉soybean (Glycine Max.L)
<400>2
Ala?Thr?Asp?Asn?Asn?Asn?Asn?Lys?Thr?Gly?Ser?Lys?Val?Gly?Glu?Tyr
1 5 10 15
Ala?Asp?Tyr?Ala?Ser?Gln?Lys?Ala?Lys?Glu?Thr?Lys?Asp?Ala?Thr?Met
20 25 30
Glu?Lys?Ala?Gly?Glu?Tyr?Thr?Asp?Tyr?Ala?Ser?Gln?Lys?Ala?Lys?Glu
35 40 45
Ala?Lys?Lys?Thr?Thr?Met?Glu?Lys?Gly?Gly?Glu?Tyr?Lys?Asp?Tyr?Ser
50 55 60
Ala?Glu?Lys?Ala?Lys?Glu?Arg?Lys?Asp?Ala?Thr?Val?Asn?Lys?Met?Gly
65 70 75 80
Glu?Tyr?Lys?Asp?Tyr?Ala?Ala?Glu?Lys?Ala?Lys?Glu?Gly?Lys?Asp?Ala
85 90 95
Thr?Val?Asn?Lys?Met?Gly?Glu?Tyr?Lys?Asp?Tyr?Ala?Ala?Glu?Lys?Thr
100 105 110
Lys?Glu?Gly?Lys?Asp?Ala?Thr?Val?Asn?Lys?Met?Gly?Glu?Tyr?Lys?Asp
115 120 125
Tyr?Thr?Ala?Glu?Lys?Ala?Lys?Glu?Gly?Lys?Asp?Thr?Thr?Leu?Gly
130 135 140
<210>3
<211>31
<212>DNA
＜213〉soybean (Glycine Max.L)
<400>3
caccgaattc?gccacggaca?acaacaacaa?c 31
<210>4
<211>28
<212>DNA
＜213〉soybean (Glycine Max.L)
<400>4
gtccaagctt?ccccaacgtc?gtatcttt 28
<210>5
<211>29
<212>DNA
＜213〉soybean (Glycine Max.L)
<400>5
ctgtggatcc?atggccacgg?acaacaaca 29
<210>6
<211>29
<212>DNA
＜213〉soybean (Glycine Max.L)
<400>6
catcgagctc?actagtgccc?caacgtcgt 29
Claims (5)
1. dna sequence dna is the described nucleotide sequence of SEQ ID NO.1 in the sequence table or can be under rigorous condition and the nucleotide sequence of the described nucleotide sequence hybridization of SEQ ID NO.1.
2. the application of dna sequence dna as claimed in claim 1 in cultivating salt tolerant, drought-enduring, low temperature resistant new variety of plant.
3. the polypeptide SING-22 of a tool salt-tolerant trait is the described aminoacid sequence of SEQ ID NO.2 in the sequence table.
4. a recombinant vectors contains the described any dna sequence dna of claim 1.
5. recombinant vectors according to claim 4 is recombinant plasmid.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2004100517550A CN1316024C (en) | 2004-09-30 | 2004-09-30 | DNA sequence encoding polypeptide with salt tolerance, salt resistant polypeptide SING-22 and expression carrier |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2004100517550A CN1316024C (en) | 2004-09-30 | 2004-09-30 | DNA sequence encoding polypeptide with salt tolerance, salt resistant polypeptide SING-22 and expression carrier |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1603410A CN1603410A (en) | 2005-04-06 |
| CN1316024C true CN1316024C (en) | 2007-05-16 |
Family
ID=34665999
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2004100517550A Expired - Fee Related CN1316024C (en) | 2004-09-30 | 2004-09-30 | DNA sequence encoding polypeptide with salt tolerance, salt resistant polypeptide SING-22 and expression carrier |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1316024C (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117286147A (en) * | 2023-08-07 | 2023-12-26 | 石河子大学 | SiLEA4 stress-resistant gene fragment, protein and application of saussurea involucrata |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1221034A (en) * | 1997-12-25 | 1999-06-30 | 中国科学院遗传研究所植物生物技术实验室 | Spinacia and betaine aldehyde dehydrogenase gene and method for raising resistance to salt of plant |
| WO2002014515A1 (en) * | 2000-08-11 | 2002-02-21 | Sapporo Breweries Limited | Nucleic acids and proteins showing increased expression dose under salt stress |
-
2004
- 2004-09-30 CN CNB2004100517550A patent/CN1316024C/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1221034A (en) * | 1997-12-25 | 1999-06-30 | 中国科学院遗传研究所植物生物技术实验室 | Spinacia and betaine aldehyde dehydrogenase gene and method for raising resistance to salt of plant |
| WO2002014515A1 (en) * | 2000-08-11 | 2002-02-21 | Sapporo Breweries Limited | Nucleic acids and proteins showing increased expression dose under salt stress |
Non-Patent Citations (3)
| Title |
|---|
| 大豆耐盐基因的PCR标记 郭蓓等，中国农业科学，第33卷第1期 2000 * |
| 大豆耐盐基因的PCR标记 郭蓓等，中国农业科学，第33卷第1期 2000;植物抗旱、耐盐基因概述 曾华宗等，植物遗传资源学报，第4卷第3期 2003 * |
| 植物抗旱、耐盐基因概述 曾华宗等，植物遗传资源学报，第4卷第3期 2003 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1603410A (en) | 2005-04-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101173002A (en) | Plants stress tolerance correlation transcription factor GmWRKY54, encoding gene and application thereof | |
| CN108251432B (en) | Notoginseng disease course related protein genePnPRlikeAnd applications | |
| WO2011047607A1 (en) | Plant stress tolerance related protein gmsik1 and encoding gene and use thereof | |
| CN101608184B (en) | Clone of cotton mitogen activated protein kinase gene GhMAPK16 and application thereof | |
| CN110804090A (en) | Protein CkWRKY33 and coding gene and application thereof | |
| CN112961229B (en) | Rubber tree transcription factor HbICE4 and coding gene and application thereof | |
| CN109207483B (en) | Watermelon disease-resistant gene Cltlp3 and coding protein and application thereof | |
| CN112359049B (en) | Lilium regale chitinase gene LrCHI2 and application thereof | |
| CN1316024C (en) | DNA sequence encoding polypeptide with salt tolerance, salt resistant polypeptide SING-22 and expression carrier | |
| CN101402679B (en) | Coldproof protein, encoding gene and uses thereof | |
| CN112795580B (en) | Pitaya gene HuAAE3 and application thereof in regulation and control of high temperature stress resistance of plants | |
| CN102399270A (en) | MYB transcription factor PtrMYB01 in Populus tomentosa Carr and cloning method of cDNA of PtrMYB01and application thereof | |
| CN105175522B (en) | Crowtoe AP2/ERF transcription factors and its encoding gene and application | |
| CN109295068B (en) | Pseudo-ginseng sweet protein gene PnTLP2 and application | |
| CN101456908B (en) | Transcription factor protein and coding gene thereof and application | |
| CN109293758B (en) | Anti-verticillium wilt related protein GbVIP1, and coding gene and application thereof | |
| CN107022552A (en) | Salt sward resistant gene of salt HgS2 and its application | |
| CN108948162B (en) | Peanut adversity stress gene AhDOG1L and application thereof | |
| CN102718845B (en) | Application of gene in nurturing anti-paraquat transgenic plant | |
| CN106868039B (en) | A kind of expression vector and its application in cultivation genetically modified plants | |
| CN108103071B (en) | Paeonia lactiflora HpLEA gene and application thereof | |
| CN101993479B (en) | Plant stress tolerance related transcription factor TaWRKY1 as well as coding gene and application thereof | |
| CN106755074B (en) | Application of the golden mandarin orange Fm MLP2 albumen in enhancing plant is freeze proof | |
| CN101402678B (en) | Coldproof protein, encoding gene and uses thereof | |
| CN116083386B (en) | Potentilla sericata PsSPMS gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20070516 Termination date: 20091030 |