CN1315582A - Carrier effectively expressed in plant - Google Patents

Abstract

The untranslated region (UTR) sequence of tobacco mosaic virus (TMV) RNA is used to build up the efficient expression carrier pBin440 of plant, including the fusion gene configurator of the mentioned UTR sequence and GUS reporter gene. The said configurator is used to transfer the explant of plant, resulting in the transgenic plant able to effectively express external gene (GUS).

Description

A carrier that in plant, efficiently expresses

The invention belongs to plant genetic engineering field, specifically, the present invention relates to the dna sequence dna that goal gene efficiently expresses in plant, the fusion constructs that comprises described dna sequence dna and reporter gene, carry the recombinant expression vector of this construct, and the transgenic plant that transform the expression alien gene that plant explants produced by described expression vector.

In cell, a gene transcription level is controlled by the regulating and controlling sequence (being promotor) of its upstream mainly, so in molecular biology and biotechnology research and application, be a hot topic to the research of the 26S Proteasome Structure and Function of promotor always.But the stability of mRNA and translation efficiency have very important influence, in the regulation and control significance level on the translation skill and not second on transcriptional level to the final product-proteinic productive rate of gene after transcribing.

The non-translational region sequence (UTR) of the mRNA of many eukaryotes (comprising virus) can play an important role to regulating protein expression level by stability and the translation efficiency that influences mRNA.Two sections UTR sequences described in the present invention are respectively 5 ' end (be called for short the Ω fragment, be 67bp) and the 3 ' end (be called for short TMV 3 ' UTR, be the cDNA of 204bp) of TMV-RNA from tobacco mosaic virus (TMV) (TMV).

The Ω fragment of TMV can improve expression of exogenous gene ^[1,2]The effect that this enhancing is expressed does not rely on the product of any virogene, and the effect in the dicotyledons cell is than strong in unifacial leaf ^[3]People such as Sleat think that the Ω fragment has reduced the secondary structure of mRNA, make the 40S ribosomal subunit easier at 5 ' end motion searching transcription initiation site, and make 5 ' terminal interaction strengthen, thereby the Ω fragment of TMV have enhancement to translation with initiation factor ^[4]The existing patent of the technology of this respect is delivered (WO87/07644; WILSON; Enhancing translationof mRNA by attaching leader sequence-from--RNA--virus, opt.in form ofcomplementary DNA-, e.g.for improving protein expression in transformedcells.).

And 3 ' the end UTR of its RNA can form five false knots (pseudoknot) with sophisticated structure.Form the tail of a similar tRNA on secondary structure at 2 false knots of 3 ' least significant end, this is that virus replication is essential.The upstream that is right after this district is other 3 false knots (UPD).Gallie etc. ^[3,5,11]Show that with the protoplastis architectural study the main effect of UPD is to improve translation efficiency among the TMV 3 ' UTR, its mechanism is similar to the mechanism of action of the poly A of eukaryote mRNA.

But above relevant TMV UTR district all is in the isolated cells expression system to the result of study of exogenous gene expression influence, and reporter gene obtains under the nonconformity state.Use TMV5 ' UTR and 3 ' UTR to make up plant expression vector among the present invention first, and on the plant integral level, reporter gene proves that under integrated state TMV 5 ' UTR and TMV 3 ' UTR sequence can strengthen expression of exogenous gene, and proves that two sequence actings in conjunction use 5 ' UTR more can strengthen expression of exogenous gene more separately.So the influence that the constructed expression vector pBin440 of the present invention expresses in whole plant for the research mosaic gene can reflect TMV UTR true effect in vivo more accurately, it should be a new carrier that efficiently expresses in plant.

The clone pGT114 of TMV-coat protein (CP) gene contains coat protein coding region and 3 ' end non-translational region thereof ^[6]Obtain TMV 3 ' UTRDNA sequence (two ends have the restriction enzyme site of Sal I and Sac I respectively) with PCR method,, be inserted into plasmid pD513, and be built into pD515 through Sal I and Sac I enzymolysis; After Hind III and EcoR I enzymolysis insert pBin438 ^[7], obtain high efficiency plant expression vector pBin440.

Hereinafter the embodiment that will narrate discloses the plant expression vector (Figure 1A) that the inventor obtains and can efficiently express reporter gene and other goal gene in plant.

The plant expression vector pBin440 that the present invention will make up first merges the recombinant plasmid pBG440 that has produced in expression of plants mutually with the coding region nucleotide sequence of β-glucuronidase (GUS) reporter gene, and these two kinds of recombinant plasmids is transformed into dust Xi Shi intestinal bacteria (Escherichia coli DH5 α) respectively and soil Agrobacterium (Agrobacterium tumefaciensLBA4404) has produced recombinant microorganism.Preservation is to Chinese microorganism strain preservation preservation management committee common micro-organisms center for dust Xi Shi intestinal bacteria (the Escherichia coli DH5 α) transformant that contains pBin440, and the preservation bacterial classification number is CGMCC No.0444.

In order to prove that TMV 3 ' UTR is to improving the effect of foreign gene expression level in plant among the new plant expression vector pBin440, the present invention has utilized gus gene and the TMV-RNA non-translational region sequence construct in addition plant expression vector of three kinds of gus genes, pBG437 (not containing TMV 5 ' UTR and 3 ' UTR), pBG438 (only containing TMV 5 ' UTR) and pBG440 Δ NOS (remove and do not contain the NOS terminator, other are identical with pBG440), recombinant plasmid is transformed into dust Xi Shi intestinal bacteria (Escherichia coli DH5 α) respectively and soil Agrobacterium (Agrobacterium tumefaciensLBA4404) has produced recombinant microorganism.Under the mediation of the soil Agrobacterium that contains recombinant plasmid pBG440 etc., above-mentioned each chimeric gus gene is imported plant chromosome respectively with leaf disc transformation method and produced transgenic plant.

The nucleotides sequence that the present invention relates to the goal gene coding region is listed in the carrier that efficiently expresses in the vegetable cell.Described " efficiently expressing in the vegetable cell " refers to be significantly higher than at the expression level of vegetable cell the plant expression vector of no TMV UTR sequence, as pBin437, pBin438 (lacking 3 ' UTR) or the like.

The constructed plant expression vector of the present invention utilizes TMV 5 ' UTR and 3 ' UTR acting in conjunction to be inserted in foreign gene between these two sequences at the intravital expression level of plant with enhancing, and for the first time on whole plant level this fragment of proof have the function of reinforcing gene expression.So the plant expression vector pBin440 among the present invention should be a new high efficiency plant expression vector.

In conjunction with following accompanying drawing the present invention is described in detail:

The structure iron of Figure 1A: pBin440.

204bp?TMV?3’UTR?DNA

BamH I-Sal I 277bp fragment from pBR322

TMV?5’UTR

Arrow refers to the gene transcription direction

The kalamycin resistance gene that LB-T-DNA left margin sequence Knr-expresses in bacterium

RB-T-DNA right border sequence NPT II-neomycin phosphotransferase gene is plant

Express resistance in the Sc-Sac I to kantlex.

SL-SalⅠ

Bm-BamHⅠ

Hd-HindⅢ

RI-EcoRⅠ

The RK2-RK2 replication orgin

The CaMV 35S promoter of the two enhansers of DE35S-band

^*This figure each several part draws not in scale, only is synoptic diagram.

Figure 1B: the structure of plant expression vector pBG437, pBG438, pBG440 and pBG440 Δ NOS.

Fig. 2: the average activity (unit: pmolMU/min/ug extracts total protein) of the gus gene moment expression of four kinds of different structures.

Fig. 3: the active distribution of transgene tobacco GUS.

Fig. 4: the GUS average specific activity of transgene tobacco.

Fig. 5: the PCR result of partial regeneration plant.

Embodiment

1. the acquisition of complete TMV 3 ' UTR sequence

TMV coat protein (CP) gene clone pGT114 contains CP gene coding region and 3 ' non-coding region [6].According to 3 ' non-coding area sequence, following PCR primer has been synthesized in design: UT5:5 ' CGGTCGACGGTAGTCAAGATGCATAATAAAT 3 ' 31merUT3:5 ' CTGAGCTCTGGGCCCCTACCGGGGGTAA 3 ' 28merPCR reaction mixture cumulative volume 50ul, contain pGT114DNA～10ng, each 5ul of primer UT5 and UT3, make ultimate density reach 1umol/L, damping fluid (500mM KCl, 100mM Tris-HCl, pH8.8,15mM MgCl ₂, 30mM DTT, 1mg/ml BSA) and 5ul, 2mM dNTP 5ul, 2U Tag DNA Polymerase.Be reflected at 94 ℃ of pre-sex change 3 minutes, then with 94 ℃ of sex change 30 seconds, 56 ℃ of renaturation 1 minute, 72 ℃ were extended totally 30 circulations 30 seconds.Reaction mixture uses the ethanol of two volumes to precipitate more than one hour centrifugal recovery PCR product at-20 ℃ after phenol/chloroform extracting once.Thereby obtain TMV 3 ' the UTR fragment of total length 204bp, its sequence is:

GGTAGTCAAGATGCATAATAAATAACGGATTGTGTCCGTAATCACACGTGGTGCGTA

CGATAACGCATAGTGTTTTTCCCTCCACTTAAATCGAAGGGTTGTGTCTTGGATCGC

GCGGGTCAAATGTATATGGTTCATATACATCCGCAGGCACGTAATAAAGCGAGGGGT

TCGAATCCCCCCGTTACCCCCGGTAGGGGCCCA

2. the structure of plant expression vector pBin440 and pBG440 etc.

The enzymolysis of DNA, fragment separation and purification and ligation are undertaken by " CurrentProtocols in Molecular Biology " described method of a book of people such as Ausubel.For 3 ' UTR fragment being inserted in the expression framework of pBin438, at first use Hind III and EcoR I with after downcutting by the expression cassette of CaMV 35S promoter-TMV " Ω " fragment of two enhansers-form from section of DNA weighting material-Nos 3 ' terminator sequence of BamH I-Sal I of pBR322 among the pBin438, with be connected with the pUC19 of BamH I with EcoR I enzymolysis, promptly obtain recombinant plasmid pD513.The PCR product of above-mentioned pGT114 is connected with pD513 with same enzymolysis and can be built into pD515 behind Sac I and Sal I enzymolysis, and pD515 and pD513 difference only are that pD515 has inserted TMV UTR sequence at 5 ' end of Nos terminator sequence.With Nos 3 ' terminal sequence be the minus strand primer, the result that carries out sequential analysis with the T7DNA Sequencing Kit of Pharmacia company proves that the UTR sequence of being inserted among the pD515 is correct.With the UTR dna fragmentation of Hind III and BamH I enzymolysis PCR generation and the pBin438 of same enzymolysis ^[7]The carrier DNA of gained connects, and promptly obtains recombinant plasmid pBin440, a new binary expression vector, or be referred to as a new plant expression vector.The structure of pBin440 is seen Fig. 1.Any foreign gene is cut in the above-mentioned expression cassette that is inserted into this expression vector through suitable enzyme, all may realize efficiently expressing in plant.In pBin440, we have used CaMV 35S promoter and Nos 3 ' end terminator sequence to regulate and control the expression of the foreign gene (GUS) that is connected with 3 ' end UTR sequence by TMV 5 '.But do not repel with other plant strong promoter and other transcription termination sequences and replace above-mentioned promotor and the effect of transcription termination sequence to realize that TMV UTR sequence improves the exogenous gene expression level.

In order to confirm that TMV UTR can improve the possibility of exogenous gene expression efficient in whole plant, the gus gene that the present invention also uses is isolating from p35SGUSINT, have an intron has made up GUS mosaic gene expression vector pBG440, pBG438, pBG437 with pBin440, pBin438 and pBin437 respectively and with the pBG440 Δ NOS that is built into after the excision of the 3 ' terminal sequence of the Nos among the pBin440.The building process of these expression vectors is referring to Figure 1B.

3. the generation of transgenic plant

1. conversion soil Agrobacterium:

With alkaline denaturation (J.Sambrook et al., Molecular cloning, A LaboratoryManual, 2nd ed, Cold Spring Harbor Laboratory Press 1989) preparation pBG437, pBG438, pBG440 and pBG440 Δ NOS plasmid, with frozen-thawed conversion method (Jia Panxing, microbial genetics experimental technique Beijing such as Cai Jinke: 1992 108-109 of Science Press) above-mentioned plasmid is changed over to soil Agrobacterium LBA4404, cut screening and cloning with PCR and enzyme then.

2. Plant Transformation:

With pBG437, pBG438, the soil Agrobacterium of pBG440 and pBG440 Δ NOS clone transformation of tobacco (NC89) respectively with Ye Panfa (Science 227 for Horsch, R.B.et al., 1229-1231,1985).Obtain the tobacco regeneration plant by the kalamycin resistance screening.

3. the moment of agriculture bacillus mediated chimeric gus gene expresses:

(1) moment is expressed the real name cigarette (Nicotianabenthamiana) that arrives 10-12 sheet leaf with the length of hot-house culture.

(2) the single bacterium colony of picking Agrobacterium from the new flat board of drawing is inoculated in the 5mL LB substratum and (contains Kn 50ug/mL), and 28 ℃, 300r.p.m, the shaking table overnight incubation is got 1mL and is added in same (the containing Kn50ug/ul) substratum of 50mL, and 28 ℃ of 300r.p.m shake and spend the night.With 4000r.p.m, 4 ℃ of centrifugal collection thalline suspend thalline more then, and making ultimate density is O.D ₆₀₀To 1.5, static placement is 3hr at room temperature.Injecting 4 kinds of Agrobacterium solution respectively on the different blades of same plant, make agrobacterium liquid soak into whole blade, is blank with the LBA4404 bacteria suspension.The method of pressing Jefferson in 3-5 days detects the GUS specific activity of the blade of injecting.

4. the PCR of transgene tobacco detects:

Getting the tobacco DNA that 1ul extracts on a small scale is template, (the dNTP ultimate density is every kind of 0.2mmol/l in 20 μ l PCR reaction systems, with positive strand primer of NOS and GUS minus strand primer, concentration is 0.5 μ mol/l) in 94 ℃ of sex change 4 minutes, then with 94 ℃ 1 minute, 55 ℃ 1 minute, 72 ℃ were carried out 30 circulating reactions in 1 minute, reaction product is observed, is taken a picture in 1% agarose gel electrophoresis.

Primer sequence is as follows

GUS minus strand primer: 5 ' ATCGAAACGCAGCACGATAC 3 '

The positive strand primer of NOS: 5 ' CGCGGTGTCATCTATGTTAC 3 '

PCR result sees also figure-5.

The result shows that the positive plant of all GUS reaction all can amplify a dna fragmentation that gus gene is special in the PCR reaction, shows that the gus gene expression cassette among the pBG440 is whole and to the genome of tobacco with T-DNA.

5. the GUS activation analysis of transgene tobacco

(1) extraction of tobacco total soluble protein:

With reference to Jefferson etc. ^[9,13](Jefferson R A, Kavanagh T A, Beven M W.EMBO Journal, 1987,6:3901-3907.Jefferson R A, Plant Molecular BiologyReporter, 1987,5:387～405) and the luciferase analytical system of Promega company (Luciferage Assay System, E1500, Promega Technical Bulletin) method is extracted the total soluble protein of tobacco leaf or vein: get 50mg tobacco leaf or vein tissue, after the liquid nitrogen freezing grinding, add 200ul protein extract (25mmol/L Tris-phosphate, pH7.8,2mmol/L DTT, 2mmol/L 1,2-diamino cyclohexane-N, N, N ', N '-tetraaceticacid, 10%glycerol and 1%Triton X-100), mixing, 4 ℃ centrifugal (12,000rm, 2min.), get supernatant liquor and be tobacco total soluble protein extracting solution.The mensuration of protein concentration adopts Bio-Rad Protein II to measure liquid, is undertaken by the method that producer provides.

2.GUS active the detection:

Described with reference to Gu Hongya etc. ^[10]Get the tobacco leaf of preparation in the 10ul step 1 or the total soluble protein extracting solution and the 90ul GUS reaction solution of vein and (in the described protein extract of step 1, add 1mmol/L 4-methyl umbelliferone acyl-glucuronide, be that 4-MUG and 10mmol/L beta-mercaptoethanol are the GUS reaction solution) mixing, 37 ℃ of insulation reaction.Each sample is provided with 2 reaction times, promptly respectively 20 ' and 30 ' time respectively add the Na of 900ul 0.2mol/L ₂CO ₃The solution termination reaction.Na with 0.2mol/L ₂CO ₃The 4-methyl umbelliferone of formulations prepared from solutions 0.2umol/L (4-MU) uses photofluorometer (the DyNA Quant of Hoefer Pharmacia biotech company production as fluorescence standard substance ^TM200 Fluorometer), survey fluorescence under the emission light 455nm condition at exciting light 365nm.Before formal the measurement, the standard substance 4-MU with serial dilution concentration measures fluorescent value earlier, makes typical curve, determines the linearity range of fluorescent value and 4-MU concentration.When measuring transgenic plant, find the content of the 4-MU of generation from typical curve with the measurement fluorescent value of each sample, make the function curve of different time corresponding to 4-MU, obtain the content of the 4-MU of per minute generation, again divided by the total soluble protein amount of each sample, be the GUS activity, last unit is " 4-MU pmol./min.ug total protein ".

6. result and discussion:

(1) expression of results shows moment: (the blade GUS activity of 35S-Ω-GUS-UTR-NOS) is the highest, and GUS average specific activity is 6.6 times of pBG437 (35S-GUS-NOS), is (the 35S-Ω-GUS-NOS) 1.4 times of pBG438 to transform pBG440; The average specific activity that transforms the blade of pBG438 is 4.7 times of pBG437; PBG440 Δ NOS does not detect the GUS activity.(figure-2)

(2) obtained a collection of transformation tissue culture plant through the agrobacterium co-cultivation transformation of tobacco.Through pcr analysis, GUS histochemical stain and GUS show that than quantitative assay alive this mosaic gene of four types has been incorporated on the tobacco karyomit(e), and other transgenic plant all have the expression of GUS except that the tobacco plant that changes pBG440 Δ NOS.The active pBG440 of commentaries on classics of GUS average specific plant be to change 5 times of pBG437, be to change 1.6 times of pBG438, what change pBG438 is to change 3.2 times of pBG437.(figure-3)

Because the difference of gus gene on position in the tobacco gene group has very big influence to its expression level, cause between the individuality expression level widely different.By enlarged sample amount as far as possible, can make single sample in the system that result's influence is reduced, obtain more accurate believable result.The present invention has studied pBG437 transformation tissue culture tobacco 50 strains that obtained, 95 strains of pBG438,116 strains of pBG440,80 strains of pBG440 Δ NOS.After each plant carried out the quantitative assay of GUS specific activity, obtaining GUS, the pBG437 of expression is arranged was 33 strains, accounts for 66% of total regeneration plant; PBG438 is 50 strains, accounts for 53%, and pBG440 is 81 strains, accounts for 70%, and pBG440 expresses the ratio of a little higher than other type of the active plant ratio of GUS, may be that the expression level height of the gus gene of this type causes.But total see that to express the percent difference that the active plant of GUS accounts for total regeneration plant little, show that the conversion condition of four structures is consistent, transformation efficiency is similar.Not detecting GUS though the plant PCR of commentaries on classics pBG440 Δ NOS is positive expresses.Significance analysis from table 1 ^[11]Can learn, pBG437, pBG438, the active difference of GUS is significant between the pBG440, has reflected the true influence of four kinds of different structures to the GUS expression level, and is not that error institute is extremely in the experiment.As seen change active high (＞30pmolMU/min/ug total protein) shared ratio maximum of tobacco expressed GUS of pBG440 from Fig. 3, the ratio that the active high plant of the GUS of commentaries on classics pBG438 accounts for is higher than the tobacco that changes pBG437, in the plant (1-10pmol MU/min/ug total protein) of corresponding GUS low expression level, the ratio of changeing pBG437 is the highest, changes the minimum of pBG440.Can find out also that from Fig. 4 the average GUS specific activity that changes pBG440 is the highest, be to change 1.6 times of pBG438, and being changes 5 times of pBG437, and the average GUS specific activity that changes pBG438 is apparently higher than changeing pBG437, and being changes 3.2 times of pBG437.

Table 1

Expression vector	The plant number	The GUS average activity	Difference shows P=0.95 t 0.05=1.98＜｜t｜
						?pBG437	?pBG438	??pBG440
			?pBG437	????33	?7.98775				?-	?*	?t=4.89458
?pBG438	????50	?23.3414				?t=-3.32522	?-	?*
			?pBG440	????81	?36.6937				?*	t=2.43508	?-

GUS activity unit: pmol MU/min/ug total protein.

* significant difference;--not remarkable;

The present invention is from moment expression and two aspects of transgenic plant, the influence that the non-translational region of TMV-RNA is expressed in whole plant chimeric gus gene has for the first time been done than systematic research, proof is under integrated state, 3 ' the UTR district of TMV-RNA can with UTR sequence (the being the Ω fragment) acting in conjunction of 5 ' end, thereby improve the expression of exogenous gene level be inserted between these two UTR sequences significantly.In pBin440, the contriver has used CaMV35S promotor and NOS 3 ' terminator sequence to regulate and control transcribing of foreign gene, does not get rid of with other transcription regulating nucleotide sequences here and also can obtain similar effects.Above result proves that the plant expression vector pBin440 that the present invention makes up is an efficient expression vector really, and it has important applying value aspect the exploitation utilization of plant genetic engineering research and transgenic plant.

In a word, plant expression vector pBin440 and reporter gene that the present invention is constructed are fused into plant expression vector pBG440, by the agrobacterium mediation converted dicotyledons, can efficiently express goal gene, this plant expression vector has a wide range of applications for the engineered development and use such as pest-resistant, disease-resistant of plant.

Reference [1] Dowson Day MJ, Ashurst JL, Mathias SF, Watts JW, Wilson TMA, Plant viral leaders influence expression of a reporter gene in tobacco. Plant Molecular Biology 23:97-107 (1993) [2] Mao Liqun, Guo's three heaps, Ω sequence and 3 ' poly (dA) length and gene expression efficiency concern Botany Gazette 1998,40 (12): 1166-1168[3] Gallie DR, Lucas WJ, Walbot V:Visualizing mRNA expression in plant protoplast:factors influencing efficient mRNA uptake and translation.Plant cell 1:301-311 (1989) [4] Sleat DE, Hull R, Turner PC, Wilson TM:Studies on the mechanism of translational enhancement by the 5 '-leader sequence of tobacco mosaic virus RNA Eur J Biochem.1988 Jul 15:175 (1); 75-86[5] NAR 19:5031-5036,1991; Pl.Mol.Biol.32:145-158,1996[6] Chinese science 20 (8): 822-831 such as Yingchuan, field, 1990[7] Li Taiyuan etc., the research of efficient insect-resistant transgenic tobacco, Chinese science B collects 24:276-282, (1994) [8] Yingchuan, field etc., biotechnology journal 1991 7:1-10[9] Richard A.Jefferson, Assaying chimeric gemes in plants:the GUS gene fusion system, Plant Molecular Biology Reporter, 1987 (5): 387-405[10] Gu Hongya, Qu Lijia etc., plant gene and molecule manipulation, 1994,275-276[11] Du Rongqian, biostatistics, Higher Education Publishing House, 1985 p118-135[12] Leathers V, Tanguay R, Kobayashi M, Gallie DR:A phylogene conserved sequence within viral 3 ' untranslated RNA pseudoknots regulates translation.Mol.Cell Biol.1993 Sep:13 (9): 5331-47.[13] Jefferson R A, Kavanagh T A, Beven M W.EMBO Journal, 1987

Claims (6)

1. plant expression vector is characterized in that the promotor downstream contains TMV 5 ' UTR (Ω) and transcription termination sequence upstream and contain sequence as shown in the formula the 204bp Nucleotide of described TMV 3 ' UTR-RNA3 ' non-translational region.GGTAGTCAAGATGCATAATAAATAACGGATTGTGTCCGTAATCACACGTGGTGCGTACGATAACGCATAGTGTTTTTCCCTCCACTTAAATCGAAGGGTTGTGTCTTGGATCGCGCGGGTCAAATGTATATGGTTCATATACATCCGCAGGCACGTAATAAAGCGAGGGGTTCGAATCCCCCCGTTACCCCCGGTAGGGGCCCA。

2. according to a kind of plant expression vector described in the claim 1, it is to make up on the basis of pBin438.

3. recombinant microorganism contains the plant expression vector of claim 1,2 described features.

4. recombinant microorganism according to claim 3 is a kind of intestinal bacteria (Escherichia coli) DH5 α.

5. recombinant microorganism according to claim 4, its preservation registration number are CGMCCNo.0444.

6. recombinant microorganism according to claim 3 is Agrobacterium tumefaciens (Agrobacterium tumefaciens) LBA4404.

Images