CN1313605C - Gene recombinant fowl influenza virus D3/F-R2/6 and its construction method - Google Patents

Abstract

The present invention provides a gene fowl influenza virus recombinant strain D3/F-R2/6 and a construction method thereof, which relates to the application of a reversal genetic technique. Six inner genes of PB2, PB1, PA, NP, M and NS of an MPAIV chick embryo highly adaptive strain A/Chicken/Shanghai/F/98(H9N2) and an NA gene of an epidemic strain A/Duck/Huadong/D3/00(H5N1) are recombined with an attenuated HA gene to construct the gene fowl influenza virus recombinant strain D3/F-R2/6. The recombinant strain can be used for producing fowl influenza vaccines to avoid menace to public health when a new A type influenza virus prepared by recombining the inner genes of a human influenza virus and a surface gene of AIV is used for preparing fowl influenza vaccines.

Description

A kind of avian influenza virus gene resortment strain D3/F-R2/6 and construction process thereof

Technical field

The present invention relates to use the reverse genetic technology.Particularly (be called for short: H5N1 hypotype AIV) two outside genes and a strain H9N2 subtype avian influenza virus (are called for short: 6 internal gene H9N2 hypotype AIV) with a strain H5N1 subtype avian influenza virus, be built into 8 genes all from the gene resortment virus strain of AIV, be used to make vaccine.

Background technology

The reverse genetic manipulation technology of RNA viruses is meant external by making up the infective molecule cloning of RNA viruses, be about to the virus genome RNA reverse transcription and become cDNA, on the dna molecular level, it is carried out various external manual operations, assemble a technology of new RNA viruses by viral genome cDNA and various accessory protein.Because the RNA viruses that final " rescue " goes out derives from the cDNA clone, therefore, can be by the artificial dna circle joint that adds in the pilot process, on dna level, the rna virus cdna group is carried out various external manual operations, as carry out transformations such as transgenation, gene knockout (disappearance), gene insertion, gene substitution and gene complementation.This technology not only can be used to study the gene replication of RNA viruses and expression regulation mechanism, antiviral strategy, gene therapy, and can be used for making up new vaccine virus.

The genome of influenza virus is made of 8 single-stranded RNAs, and the different segment of virus has different effects aspect pathogenic in that decision is viral, and what wherein play a major role is HA albumen.The acceptor that it can the recognition of host cell and combine with it at first, the specificity of influenza virus HA protein receptor depends on host's kind.Next be HA by protease cracking be HA1 and HA2 characteristic [the Gan Menghou chief editor. bird flu. second edition, Beijing: agriculture press, 2002.], HA is subjected near glycosylated influence aminoacid sequence at cracking site place and the site by the characteristic of protease cracking.The low pathogenicity strain has only a basic amino acids arginine (R) at the cracking site place, and the highly pathogenicity strain has a plurality of basic aminoacidss [Bosch FX, GartenW, Klenk HD, et al.Proteolytic cleavage of influenza virus hemagglutininprimary structure of the connecting site of avian influenzavirus.Virology, 1981,113 (2): 725-735].Most highly pathogenic influenza viruses are arginine (R) at the C of HA1 end, the N end of HA2 is glycine (G), also there is the C end of few part HA1 to be Methionin (K) [Gunther I, Glatthaar B, Doller G, et al.A H1 hemagglutinin of a humaninfluenza A virus with a carbohydrate-modulated receptor binding site and anunusual cleavage site.Virus Res, 1993,27 (2): 147-160.], the proline(Pro) (P) of H5 hypotype HA1C end upstream is conservative in different strains with L-glutamic acid (Q).All have four conserved amino acid R-E-T-R from the isolating low pathogenicity H5 of nature strain major part between Q and G, promptly-and P-Q-R-E-T-R ↓ G (" ↓ " is cracking site); And the H5 strain of highly pathogenicity is near the HA cracking site during sugar based side chain, its sequence is-P-Q-B-X-B-R ↓ G (B is any basic aminoacids), if when near the HA cracking site glycosylation side chain being arranged, then must insert any two amino acid, sequence is-P-Q-X-X-B-X-B-R ↓ G or-P-Q-B (X)-X (B)-B-X-B-R ↓ G, otherwise the not high [SenneDA of virulence, Panigrahy B, Kawaoka Y, et al.Survey of the hemagglutinin (HA) cleavagesites sequence of H5 and H7 avian influenza viruses:amino acid sequence at theHA cleavage site as a marker of pathogenicity potential.Avian Dis, 1996,40 (2): 425-37.].

Because influenza virus has a lot of hypotypes, and same hypotype also has different variants, and this makes selects to produce influenza vaccines and with suitable strain very big difficulty is arranged.In addition, some strain isolated can not be bred and enough high titre, need take efforts and concentrate vaccine [the Palese P that enough protections are arranged with production, Garc í a-Sastre.Influenza A Vaccines:present and future.Clinical Investigation, 2002,110:9-13.]; Because the easy variability of influenza antigen all will be reappraised the matching of vaccine every year, this process is time-consuming requires great effort again simultaneously.But the reverse genetic manipulation technology has been quickened this process greatly, only the HA of epidemic strain and the NA gene plasmid combination cotransfection cell with the internal gene that builds in advance just can need be obtained needed vaccine strain.As [Subbarao K such as Subbarao K, Chen H, Swayne D, et al.Evalution of a Genetically Modified Reassortant H5N1Influenza A Virus Vaccine Cadidate Generated by Plasmid-Based ReverseGenetics.Virology, 2003,305:192-200.] made up H5N1/PR8 reprovision virus, this viral HA is from the HA of A/Hong Kong/97 (H5N1), remove 5 basic aminoacidss at HA cracking position through genetic modification, adopt 12 pUC pUCs to produce H5N1/PR8 virus, make it to become low virulent strain, the virus that is produced all causes weak to mouse and chicken.Chen H etc. adopt with quadrat method and make up generation H9N2/PR8 virus, wherein H9N2 is fowl source A/CK/HK/G9 (H9N2) strain [Chen H, Subbarao K, SwayneD.et al.Generation and Evaluation of a high-growth Reassortant H9N2 InfluenzaA virus as a Vaccine Candidate.Vaccine, 2003,21,1983-1988.].Hoffmann E etc. utilizes 8 plasmid rescue systems to produce H1N1/PR8, H9N2/PR8, H3N2/PR8, H6N1/PR8 strain [Hoffmann E, Krauss S, Perez D, et al.Eight-plasmid system for rapidgeneration of influenza virus vaccines.Vaccine, 2002, Aug, 19; 20 (25-26): 3165.].The HA of H5N3/PR8 low virulent strain on the chicken embryo of structures such as Liu M tires up to 1: 2 ¹¹Inactivated vaccine can be protected the attack of chicken to strong poison; compare with commercialized vaccine; can stop toxin expelling [Liu M more significantly; Wood JM, Ellis T.Preparation of a standardized, efficacious agricultural H5N3vaccine by reverse genetics.Virology; 2003,314:580-90.].Lu Jianhong etc. utilize 8 plasmid rescue systems to produce the causing weak H5 hypotype reprovision influenza virus of H5N1/WSN and H5N2/WSN, and are not high but duplicating in the chicken embryo dripped poison, the antibody that direct inoculation SPF chicken produces also very low (2 ^1-3) [Lu Jianhong, Long Jinxue, Shao Weixing, etc. cause weak H5 hypotype reprovision influenza virus with the generation of reverse genetic manipulation technology. microorganism journal, 2005,45 (1): 53-57].The H5N1/PR8 virus avian influenza vaccine of domestic existing registration at present.But the reprovision virus that above research produces, its internal gene is all from people source influenza virus A/PR/8/34 (H1N1) or A/WSN/33 (H1N1) strain.The A type influenza virus of experiment indoors artificial with the surperficial gene resortment Cheng Xin of human influenza virus's internal gene and AIV, because influenza virus is segmented minus-stranded rna virus, gene resortment forms novel influenza virus and causes that the pandemic possibility of human influenza is very big, therefore its public health that may exist threatens, caused some experts' worry, and the internal gene of weak pathogenic AIV is carried out reprovision with the surperficial gene that causes weak highly pathogenic AIV, produce the full fowl of 8 genes source virus, this danger is much smaller.

Summary of the invention

First purpose of the present invention is to invent a kind of 8 genes all from the weak H5N1 hypotype AIV gene resortment strain D3/F-R2/6 that causes of AIV, be used to produce avian influenza vaccine, in the time of can avoiding adopting the production of Influenza virus avian influenza vaccine of surperficial gene resortment Cheng Xin of human influenza virus's internal gene and AIV, the threat that may cause public health.

The preserving number of avian influenza virus gene resortment strain D3/F-R2/6 of the present invention is CGMCC NO:1386, genome length is 13.5Kb, be made of two the outside genes of H5N1 hypotype AIV and 6 internal gene PB2, PB1, PA, NP, M, the NS of MPAIV chicken embryo height adapted strain A/Chicken/Shanghai/F/98 (H9N2), two outside genes of described H5N1 hypotype AIV are respectively the NA genes of HPAIV epidemic strain A/Duck/Huadong/D3/00 (H5N1) and cause weak HA gene.

The weak HA gene DNA sequence that causes of HPAIV epidemic strain A/Duck/Huadong/D3/00 (H5N1) is:

atggagaaaa tagtgcttct tcttgcaata gtcagtcttg ttaaaagtga tcagatttgc 60

attggttacc atgcaaacaa ctcgacagag caggttgaca caataatgga aaagaacgtt 120

actgttacgc atgcccaaga catactggaa aaggcacaca acgggaaact ctgcgatcta 180

gatggagtga agcctctaat tttgggagat tgtagtgtagc tggatggctc ctcggaaac 240

cctatgtgtg acgaattcat caatgtgccg gaatggtctt acatagtggg gaaggccagt 300

ccagccaatg acctctgtta cccaggggat ttcaacgact atgaagaact gaaacaccta 360

ttgagcagaa taaaccactt tgagaaaatt cagatcatcc ccaaaagttc ttggtccaat 420

catgaagcct catcaggggt gagcgcggca tgtccatacc atgggaagcc ctcctttttc 480

agaaatgtgg tatggcttat caaaaagaac agtgcatacc caacaataaa gaggagctac 540

aataacacca accaagaaga tcttttggta ctgtggggga ttcaccatcc taatgatgca 600

gcagagcaga caaagctcta tcaaaaccca accacctata tctccgttgg aacatcaaca 660

ttaaaccaga gattggtccc aaaaatagct actagatcca gagtaaacgg gcaaagtgga 720

agaatggagt tcttctggac aattttaaag ccgaatgatg ccataaattt cgagagtaat 780

gggaatttca ttgctccaga atacgcatac aaaattgtca agaaagggga ctcagcaatt 840

atgaaaagtg aattggaata tggtaactgc aacaccaagt gtcaaactcc aatgggggcg 900

ataaactcta gtatgccatt ccacaacata caccctctca ccatcgggga atgccccaaa 960

tatgtgaaat caaacagatt agtccttgcg actagactca gaaatacccc tcaaagagag 1020

agaaggagaa aaaagagagg actatttgga gctatagcag gttttataga gggaggatgg 1080

cagggaatgg tagatggttg gtatgggtac caccatagca atgagcaggg gagtggatac 1140

gctgcagaca aagaatccac tcaaaaggca atagatggag tcaccaataa ggtcaactcg 1200

atcattgaca aaatgaacac tcagtttgag gccgttggaa gggaatttaa taacttagaa 1260

aggaggatag aaaatttaaa caagaagatg gaagacggat tcctagatgt ctggacttat 1320

aatgctgaac ttctggttct catggaaaat gagagaactc tagactttca tgattcaaat 1380

gtcaagaacc tttacaacaa ggtccgacta cagcttaggg ataatgcaaa ggagctgggt 1440

aatggttgtt tcgagttcta tcacaaatgt gataatgaat gtatggaaag tgtaaaaaac 1500

gggacgtatg actacccgca gtattcagaa gaagcaagac taaacagaga ggaaataaat 1560

ggagtaaaat tggaatcaat gggaacttac caaatactgt caatttattc aacagtggcg 1620

agttccctag cactggcaat catggtagct ggtctatctt tatggatgtg ctccaatgga 1680

tcgttacaat gcagaatttg catttaa

The NA gene DNA sequence of HPAIV epidemic strain A/Duck/Huadong/D3/00 (H5N1) is:

agcaaaagca ggagttcaaa atgaatccaa atcaaaagat aataaccacc ggatcaatct 60

gtatggtaatt ggaatggtta gcttgatgtt gcaaattgg gaacataatc tcaatatggg 120

ttagtcattc aattcagaca gggactcaac accgagctga accatgcaat cgaagcatta 180

ttaattatga aaacaacacc tgggtaaatc agacatatgt caaaatcagc aacaccaatt 240

ttcttactga gaaagctgtg gcttcagtaa gattagtggg caattcatct ctttgcccca 300

tgtttgttat aagagagccg ttcatctcat gctcccactt ggaatgccga accttctttt 360

tgactcaggg agccttgctg aatgataagc actccaatgg gaccgtcaaa gacagaagcc 420

cttacagaac attgatgagc tgtcctgtgg gtgaggcccc ctccccatat aactcgaggt 480

ttgagtctgt tgcttggtcg gcaagtgctt gtcatgatgg cactagttgg ttgacaattg 540

gaatttctgg cccagacaat ggggctgtgg ctgtattgaa atacaatggc ataataacag 600

acactatcaa gagttggagg aacaacatac tgagagctca agagtctgaa tgtgcatgtg 660

taaatggctc ttgctttact gtaatgactg acggaccaag taatgggcag gcttcatata 720

agatcttcaa aatagaaaaa gggaaagtag ttaaatcagt cgaattgaat gcccctaatt 780

atcactatga ggagtgctcc tgttatcctg atgctggcga aatcacatgt gtgtgcaggg 840

ataattggca tggctcaaat cggccatggg tatctttcaa tcaaaatttg gagtaccaaa 900

taggatatat atgcagtgga gttttcggag acaatccacg ccccaatgat ggaacaggca 960

gttgtggtcc ggtgtcccct aacggggcat atggagtaaa agggttttca tttaaatacg 1020

gcaatggtgt ttggatcggg agaaccaaaa gcactaattc caggagcggc tttgaaatga 1080

tttgggatcc aaatgggtgg actggaacgg acagtaattt ttcggtgaag caagatatcg 1140

tagctataac tgattggtca ggatatagcg ggagttttgt ccagcatcca gaactgacag 1200

gattagattg cataagacct tgtttctggg ttgagctaat cagagggcgg cccaaagaga 1260

gcacaatttg gactagtggg agcagcatat ctttttgtgg tgtaaatagtgacactgtgg 1320

gttggtcttg gccagacggt gctgagttgc cattcaccat tgacaagtag tttgttcaaa 1380

aaactccttg tttctact。

6 internal gene PB2, the PB1 of above-mentioned MPAIV chicken embryo height adapted strain A/Chicken/Shanghai/F/98 (H9N2), PA, NP, M, NS sequence are seen GenBank, and accession number is AY253750, AY253751, AY253752, AY253753, AY253755, AY253756.Avian influenza virus gene resortment strain D3/F-R2/6 on June 6th, 2005 in the survival preservation of China Committee for Culture Collection of Microorganisms common micro-organisms center, preserving number is CGMCC NO:1386.

The present invention can be used for making avian influenza vaccine, when preparing avian influenza vaccine with the A type influenza virus of the surperficial gene resortment Cheng Xin of the internal gene of avoiding adopting the human influenza virus and AIV, public health is constituted a threat to.

Second purpose of the present invention is to invent the construction process of a kind of avian influenza virus gene resortment strain D3/F-R2/6:

With the NA gene of 6 internal gene PB2, PB1, PA, NP, M, NS and the HPAIV epidemic strain A/Duck/Huadong/D3/00 (H5N1) of MPAIV chicken embryo height adapted strain A/Chicken/Shanghai/F/98 (H9N2) with cause weak HA gene and carry out reprovision, be built into avian influenza virus gene resortment strain D3/F-R2/6.

The present invention is 6 internal gene of two outside genes and the strain H9N2 hypotype AIV of a strain H5N1 hypotype AIV, is built into 8 genes all from the gene resortment virus strain of AIV.Because the influenza virus rescue system based on plasmid that adopts now is to use primates zooblast as transfectional cell, can the weak pathogenic AIV in therefore full fowl source produce in primates zooblast, also unknown.Also rarely seen at home and abroad 8 genes are all reported from the rescue of AIV especially H9N2 hypotype AIV.And the F strain is weak pathogenic H9N2 hypotype AIV, and its levels of replication in primates zooblast is restricted, and has both made the content that increases pancreatin also be not enough to save out virus.The host that the most suitable F strain AIV duplicates is a development of chick embryo, and Fan Zhi virus titer can reach 2 therein ¹¹We have improved transfection method for this reason: be about to 24h behind the plasmid transfection cell, just the cell inoculation 10 age in days SPF chicken embryos of transfection plasmid, hatch behind the 48h on SPF chicken embryo amplification once again.The result saves out avian influenza virus gene resortment strain D3/F-R2/6 on the isolating F strain basis, China's Mainland of having saved out the full fowl of 8 genes source.

The present invention utilizes the reverse genetic technology, with 1998 China's Mainland isolated M PAIV chicken embryo height adapted strain A/Chicken/Shangha/F/98 (H9N2) 6 internal gene and HPAIV epidemic strain A/Duck/Huadong/D3/00 (H5N1) cause weak HA gene and NA gene and carry out reprovision, that successfully saves out 6+2 combination causes 8 weak genes all from the gene resortment AIV of AIV, and to its virulence, after pathogenic and immune efficacy is identified, the present invention is workable for proof, stable performance, can avoid adopting the A type influenza virus of the surperficial gene resortment Cheng Xin of human influenza virus's internal gene and AIV, when making avian influenza vaccine, public health is constituted a threat to.

The present invention includes following concrete steps:

1) 6 internal gene PB2, PB1, PA, NP, M, the NS of MPAIV A/Chicken/Shanghai/F/98 (H9N2) strain of amplification chicken embryo height adaptation.

The amplimer sequence is as follows:

Bm-PB2-1 5’-TATT CGTCTCAGGGAGCGAAAGCAGGTC-3’；

Bm-PB2-2 5’-ATAT CGTCTCGTATTAGTAGAAACAAGGTCGTTT-3’；

Bm-PB1-1 5’-TATT CGTCTCAGGGAGCGAAAGCAGGCA-3’；

Bm-PB1-2 5’-ATAT CGTCTCGTATTAGTAGAAACAAGGCATTT-3’；

Bm-PA-1 5’-TATT CGTCTCAGGGAGCGAAAGCAGGTACTGAT-3’；

Bm-PA-2 5’-ATAT CGTCTCGTATTAGTAGAAACAAGGTACTTTT-3’；

Bm-NP-1 5’-TATT CGTCTCAGGGAGCA AAAGCAGGGTAGATAATC-3’；

Bm-NP-2 5’-ATAT CGTCTCGTATTAGTAGAAACAAGGGTATTTTTC-3’；

Bm-M-1 5’-TATT CGTCTCAGGGAGCAAAAGCAGGTAG-3’；

Bm-M-2 5’-ATAT CGTCTCGTATTAGTAGAAACAAGGTAGTTTTT-3’；

Bm-NS-1 5’-TATT CGTCTCAGGGAGCAAAAGCAGGGTG-3’；

Bm-NS-2 5’-ATAT CGTCTCGTATTAGTAGAAACAAGGGTGTTTT-3’；

2) increase respectively the HA gene and the NA gene of HPAIV A/Duck/Huadong/D3/00 (H5N1) strain, the primer sequence of amplification HA and NA gene is as follows:

Bm-HA-1 5’-TATT CGTCTCAGGGAGCAAAAGCAGGGG-3’；

Bm-HA-2 5’-ATAT CGTCTCGTATTAGTAGAAACAAGGGTGTTTT-3’；

Bm-NA-1 5’-TATT CGTCTCAGGGAGCAAAAGCAGGAGT-3’；

Bm-NA-2 5’-ATAT CGTCTCGTATTAGTAGAAACAAGGAGTTTTTT-3’；

3) the HA gene of modification H5N1 hypotype HPAIV A/Duck/Huadong/D3/00 (H5N1) strain: the cracking site PQIETR ↓ GL that the cracking site PQRERRRKKR ↓ GL of HA gene is sported non-virulent influenza virus A/Teal/Hong Kong/W312/97 (H6N1) strain HA;

4) the HA gene cDNA of H5N1 hypotype HPAIV A/Duck/Huadon/DD3/00 (H5N1) strain after will modifying is cloned into pHW2000 through 3 molecule connection methods, makes up to cause weak A/Duck/Huadong/D3/00 (H5N1) strain HA gene transcription/expression vector plasmid pHW504-HA;

5) make up transcribing/expression plasmid of 6 internal gene: transcribe at 8 plasmids/expression vector pHW2000 in, insert 6 of 6 internal gene of F strain (PB2, PB1, PA, NP, M, NS) cDNA formation respectively and transcribe/expression plasmid, be i.e. pHW201-PB2, pHW202-PB1, pHW203-PA, pHW205-NP, pHW207-M, pHW208-NS;

6) make up the NA gene transcription/expression plasmid of HPAIV A/Duck/Huadong/D3/00 (H5N1) strain: the NA gene of transcribing/inserting among the expression vector pHW2000 HPAIVA/Duck/Huadong/D3/00 (H5N1) strain at 8 plasmids forms pHW506-NA;

7) 6+2 gene resortment: will be from 6 plasmid pHW201-PB2, pHW202-PB1 of F strain, pHW203-PA, pHW205-NP, pHW207-M, pHW208-NS with from 2 plasmid pHW504-HA, pHW506-NA of A/Duck/Huadong/D3/00 (H5N1) strain, mixed by 1: 1, blended plasmid and transfection reagent are added in the COS-1 cell, put and contain 5%CO ₂, in 37 ℃ of incubators, cultivate switching kind of 10 age in days SPF chicken embryos behind the 24h, promptly obtain avian influenza virus gene resortment strain D3/F-R2/6.

Above-mentioned steps 4) in by two pairs of primers increase respectively HA1 (1.05kb) and two fragments of HA2 (0.65kb), HA1 and HA2 that gel electrophoresis is reclaimed cut, reclaim through the BsmBI enzyme, with equally carry out 3 molecule ligations, 16 ℃ of effect 12h through transcribing of cutting of BsmBI enzyme/expression vector pHW2000;

Two pairs of primers are respectively:

Bm-HA-1 5’-TATTCGTCTCAGGGAGCAAAAGCAGG-3’；

Bm-HA-2 5’-ATATCGTCTCGTATTAGTAGAAACAAGGGTGTTTT-3’；

P-MG4-1 5’-ACATCGTCTCACTAGAGGATTATTTGGAGCTAT-3’；

P-MG4-2 5’-AGATCGTCTCTTCAATTTGAGGGCTTTTTCTGAGTCC-3’。

Description of drawings

Fig. 1 is for modifying D3 strain HA gene cracking site synoptic diagram.

Fig. 2 is cloned into the pHW2000 connection diagram for the HA gene cDNA of D3 strain after modifying through 3 molecule connection methods.

Specific embodiment

MPAIV and HPAIV strain that the present invention selects, these two strains must have good immunity, higher replication is arranged in the chicken embryo.The present invention has selected MPAIV A/Chicken/Shahghai//98 (H9N2) strain as the H9N2 subgroup vaccine, be abbreviated as the F strain, this strain is by the livestock and poultry loimology emphasis open laboratory's separation and purification of the Ministry of Agriculture of Yangzhou University, be accredited as the H9N2 hypotype through national influenza center, the complete genome sequence login is at GenBank, accession number is red for Lu AY253750-AY253756[builds, Liu Xiu Buddhist, Shao Weixing, genetic analysis Deng .H9N2 hypotype AIV genome full length sequence mensuration and each gene. the microorganism journal, 2003,43 (4): 434-41.].Select HPAIV A/Duck/Huadong/D3/00 (H5N1) strain, abbreviate the D3 strain as, this strain is accredited as the H5N1 hypotype by the livestock and poultry loimology emphasis open laboratory's separation and purification of the Ministry of Agriculture of Yangzhou University through national influenza center.

The preparation of 8 used plasmid virus rescue systems among the present invention: the 8 plasmid virus rescue pHW2000 of system are so kind as to give [HoffmannE by Robert doctor Webster of U.S. St.Jude child study hospital, Neumann G, Kawaoka Y, et al.A DNA transfection system for generation ofinfluenza A virus from eight plasmids.Proc.Natl.Acad.Sci.USA, 2000,97:6108～13.].

Step 1: the extraction of F strain and D3 strain RNA

F strain and D3 strain seed culture of viruses are inoculated in SPF chicken embryo, collect allantoic fluid 300ml, and the centrifugal 15min of 6000rpm (30# rotor) gets supernatant; 4 ℃ of centrifugal 1.5h of 18000rpm are with 40ml STE (10mMpH8.0 Tris-HCl, 100mM NaCl, 5mM pH8.0 EDTA) suspension precipitation.Rebasing with 10% sucrose, carefully add suspension, 4 ℃ of centrifugal 1.5h foreigh protein removings of 18000rpm are abandoned supernatant, and precipitation suspends with 30mL STE, and 4 ℃ of centrifugal 1h of 18000rpm remove sucrose, and precipitation suspends with 7mL STE, packing dactylethrae, every pipe 450 μ L.

The RNA extraction agent box of using marine life engineering Services Co., Ltd extracts RNA.Get the above-mentioned viral liquid preparation of 300 μ L, add the abundant mixing of 400 μ L Trizol, add 100 μ L chloroform/primary isoamyl alcohol (24: 1) again, jolt 30 seconds after, 12, centrifugal 5 minutes of 000rpm; Move supernatant to aseptic 1.5mL RNase-free centrifuge tube, add 150 μ L dehydrated alcohols, mixing; Place the MNIQ-10 post, room temperature was placed 2 minutes, and 8, centrifugal 1 minute of 000rpm; Discard waste liquid, in pillar, add 450 μ L Solution RPE, 10,000rpm, centrifugal 30 seconds; The step once before repeating; Discard waste liquid, 10,000rpm, centrifugal 15 seconds; Move pillar and go in aseptic, the RNase-free centrifuge tube, central authorities add 50 μ L DEPC-H at pillar ₂O placed 2 minutes for 55-80 ℃, and 10,000rpm, centrifugal 1 minute, the solution in the collection tube was the RNA sample.

Step 2: 6 internal gene of F strain and the HA of D3 strain and amplification, clone and the sequencing of NA gene

The design primer is with 6 internal gene of reverse transcription-polymerase chain reaction (RT-PCR) method amplification F strain, the HA of D3 strain and NA gene, respectively with each PCR product cloning order-checking, and with each gene openly sequence compare.

The primer sequence of 6 internal gene of amplification F strain is as follows:

Bm-PB1-1 5’-TATT CGTCTCAGGGAGCGAAAGCAGGCA-3’；

Bm-PB1-2 5’-ATAT CGTCTCGTATTAGTAGAAACAAGGCATTTT3’；

Bm-PA-1 5’-TATT CGTCTCAGGGAGCGAAAGCAGGTACTGAT-3’；

Bm-PA-2 5’-ATAT CGTCTCGTATTAGTAGAAACAAGGTACTTTTT3’；

Bm-NP-1 5’-TATT CGTCTCAGGGAGCAAAAGCAGGGTAGATAATC-3’；

Bm-NP-2 5’-ATAT CGTCTCGTATTAGTAGAAACAAGGGTATTTTTC-3’；

Bm-PB2-1 5’-TATT CGTCTCAGGGAGCGAAAGCAGGTC-3’；

Bm-PB2-2 5’-ATAT CGTCTCGTATTAGTAGAAACAAGGTCGTTT-3’；

Bm-M-1 5’-TATT CGTCTCAGGGAGCAAAAGCAGGTAG-3’；

Bm-M-2 5’-ATAT CGTCTCGTATTAGTAGAAACAAGGTAGTTTT3’；

Bm-NS-1 5’-TATT CGTCTCAGGGAGCAAAAGCAGGGTG-3’；

Bm-NS-2 5’-ATAT CGTCTCGTATTAGTAGAAACAAGGGTGTTTT-3’。

12uni 5’-AGCAAAAGCAGG-3’

The HA of amplification D3 strain and the primer sequence of NA gene are as follows:

Bm-HA-1 5’-TATT CGTCTCAGGGAGCAAAAGCAGGGG-3’；

Bm-NA-1 5’-TATT CGTCTCAGGGAGCAAAAGCAGGAGT-3’；

Bm-NA-2 5’-ATAT CGTCTCGTATTAGTAGAAACAAGGAGTTTTTT-3’；

Bm-HA-2 5’-ATAT CGTCTCGTATTAGTAGAAACAAGGGTGTTTT-3’。

For convenient above 8 gene fragment clones to transcribe/expression vector pHW2000 (transcribe/expression vector on the BsmBI restriction enzyme site is arranged) in, when designing the primer of pcr amplification gene fragment, add clone's restriction enzyme site BsmBI site at 5 of upstream and downstream primer ' end, be abbreviated as Bm, band underscore place is the recognition site of corresponding enzyme.In addition, design the universal primer (12uni) of making RT, be used for reverse transcription with the 12nt that all segment cDNA 5 ' end all has.All primers are synthetic by precious biological (Dalian) company limited.

Reverse transcription F strain and the full genome of D3 strain (25 μ l reaction system):

Get the F strain or the D3 pnca gene group RNA 15 μ l of above extraction respectively, add 70 ℃ of sex change 5min of 1 μ l 50pmol/L12nt primer, put 0 ℃ immediately, add following reagent then successively:

5×RT buffer 5μL

RNasin(40U/μL) 1μL

10mM dNTPs 2μL

AMV ThermoScript II 1 μ L

(10U/μL)

42 ℃ the effect 1h, can use immediately or put-20 ℃ standby.

Pcr amplification HA and NA full length fragment (50 μ L reaction system):

Get respectively in above-mentioned RT product (cDNA) 10 μ L to the 0.5mL PCR reaction tubess, use primer Bm-PB2-1 and Bm-PB-2 when wherein increasing the PB2 fragment; Use primer Bm-PB1-1 and Bm-PB1-2 during amplification PB1 fragment; Use primer Bm-PA-1 and Bm-PA-2 during amplification PA fragment; Use primer Bm-HA-1 and Bm-HA-2 during amplification HA fragment; Use primer Bm-NP-1 and Bm-NP-2 during amplification NP fragment; Use primer Bm-NA-1 and Bm-NA-2 during amplification NA fragment; Use primer Bm-M-1 and Bm-M-2 during amplification M fragment; Use primer Bm-NS-1 and Bm-NS-2 during amplification NS fragment.Add following reagent successively:

10×PCR buffer 5μL

10mM dNTPs 1μL

Upstream primer (50p moL/L) 1 μ L

Downstream primer (50p moL/L) 1 μ L

Ultrapure water (SW) 31.5 μ L

Instantaneous centrifugal, 94 ℃ of pre-sex change 5min add Expand High Fidelity polysaccharase 0.5 μ L (2.5U) at 75-80 ℃; With 94 ℃ of 40s, 58 ℃ of 35s, 30 circulations of 72 ℃ of 2min; Last 72 ℃ were extended 7 minutes, 4 ℃ of operation 10min.

Get PCR product 5 μ L, the agarose gel electrophoresis with 0.8% is identified.

The clone of PCR product, evaluation and sequencing:

The PCR product is identified through electrophoresis, the whole electrophoresis of remaining product, cutting contains the segmental gel of purpose size, reclaim with Agrose Gel DNA Extraction Kit, be connected with pGEM-Teasy vector, be converted into escherichia coli jm109 competent cell, cut evaluation, PCR product and the product that is connected with the T carrier are served the order-checking of extra large United Gene Science Co., Ltd simultaneously through EcoR I enzyme.

With DNASTAR 4.0 softwares, edit sequence with EditSeq, the Clustal method among the MegAlign becomes the fragment assembly of RT-PCR amplification the complete sequence of each gene.The complete genome sequence login of F strain is at GenBank, accession number is red for Lu AY253750-AY253756[builds, Liu Xiu Buddhist, Shao Weixing, genetic analysis Deng .H9N2 hypotype AIV genome full length sequence mensuration and each gene. the microorganism journal, 2003,43 (4): 434～41.], the HA of D3 strain and NA gene order are seen this paper.

The modification of step 3:D3 strain HA gene and structure D3 strain HA gene transcription/expression plasmid:

Amplify the HA gene and order-checking of D3 strain by the RT-PCR method after, cracking site PQRERRRKKR ↓ the GL of the HA gene of D3 strain is sported cracking site PQIETR ↓ GL (as Fig. 1) of non-virulent influenza virus A/Teal/Hong Kong/W312/97 (H6N1) strain HA according to the sequences Design mutant primer, connect through 3 molecules, the 8 plasmid rescue systems of being cloned into transcribe/expression vector pHW2000 on, form and transcribe/expression plasmid pHW504-HA.

The downstream primer P-MG4-2 of HA gene of being used to suddenly change is positioned at 993-1020nt, with upstream primer Bm-HA-1 pairing, and amplification cDNA 5 ' end fragment HA1 (expect about 1.05kb); Upstream primer P-MG4-1 is positioned at the 1036-1055nt of coding region, with downstream primer Bm-HA-2 pairing, and amplification cDNA 3 ' end fragment HA2 (expect about 0.65kb).Primer is as follows:

Bm-HA-1 5’-TATT CGTCTCAGGGAGCAAAAGCAGG-3’；

Bm-HA-2 5’-ATAT CGTCTCGTATTAGTAGAAACAAGGGTGTTTT-3’；

P-MG4-1 5’-ACAT CGTCTCACTAGAGGATTATTTGGAGCTAT-3’；

P-MG4-2 5’-AGAT CGTCTCTTCAATTTGAGGGCTTTTTCTGAGTCC-3’；

Primer is synthetic by precious biological (Dalian) company limited.

3 molecules connect the HA cDNA that will modify and are cloned into pHW2000:

3 molecules connect sees Fig. 2, primer pairing amplification HA1 (1.05kb) and two fragments of HA2 (0.65kb) by above-mentioned design, HA1 and HA2 that gel electrophoresis is reclaimed cut, reclaim through the BsmBI enzyme, with equally carry out 3 molecule ligations through transcribing of cutting of BsmBI enzyme/expression vector pHW2000,16 ℃ of effect 12h, be converted into escherichia coli jm109 competent cell, enzyme is cut with PCR and is identified, serves extra large associating genome company sequence verification.

3 molecule ligation systems are as follows:

10 * connection buffer, 1 μ L

T4 dna ligase (3U/ μ L) 1 μ L

HA1 reclaims enzyme and cuts product (0.2 μ g/ μ L) 2.5 μ L

HA2 reclaims enzyme and cuts product (0.2 μ g/ μ L) 4 μ L

PHW2000 reclaims enzyme and cuts product (0.2 μ g/ μ L) 1.5 μ L

Plasmid enzyme restriction is identified: there is the single EcoRI site that does not have on the carrier at the 253bp place of HA cDNA, and there is the single ApaI site that HA inserts not to be had on the fragment at the 645bp place of carrier, and positive plasmid is 1.6kb with EcoRI and ApaI endonuclease bamhi.

Step 4: 6 internal gene and the D3 strain NA gene transcription/expression plasmid that make up the F strain:

Transcribe at 8 plasmids/expression vector pHW2000 in, insert F strain 6 internal gene PB2, PB1, PA, NP respectively, M, NS cDNA form 6 and transcribe/expression plasmid, i.e. pHW201-PB2, pHW202-PB1, pHW203-PA, pHW205-NP, pHW207-M and pHW208-NS; Inserting D3 strain NA gene formation pHW504-NA transcribes/expression plasmid.

The different cloned sequences of each gene are selected correct being used for of sequence to be cloned into 8 plasmids and are transcribed/expression vector pHW2000 through sequential analysis.At first with the BsmBI enzyme cut 6 internal gene of F strain, the NA gene and 8 plasmids of D3 strain are transcribed/expression vector pHW2000, it is as follows that the BsmBI enzyme is cut system (40 μ L), plasmid DNA (0.3 μ g/ μ L) is got 5 μ L.55 ℃ of effect 4h.

10×buffer Y+ 4μL

Goal gene (0.2 μ g/ μ L) 5 μ L

BsmBI(10U/μL) 1μL

SW 30μL

Endonuclease bamhi and carrier are respectively through gel electrophoresis, recovery, connect with the T4 dna ligase again, be converted into escherichia coli jm109 competent cell, choose the bacterium colony enlarged culturing, extract in a small amount plasmid, compare gel electrophoresis with the corresponding plasmid of normal size in 8 pUC pUCs, the positive clone of preliminary evaluation of the same size ,-20 ℃ frozen with-70 ℃.

Step 5: rescue and the evaluation of D3/F-R2/6 strain AIV

The preparation of cell is used in transfection with plasmid and transfection:

With gene fragment from the transformed bacteria of the transcribing of F strain/expression plasmid pHW201-PB2, pHW202-PB1, pHW203-PA, pHW205-NP, pHW207-M, pHW208-NS with from the transformed bacteria enlarged culturing of plasmid pHW504-HA, the pHW506-NA of D3 strain, little upgrading grain test kit upgrading grain with QIAGEN company, and measure content and purity, prepare highly purified plasmid and be used for transfection.Count behind the COS-1 cell dissociation that growth conditions is good, by 10 ⁵The cell concn of individual cells/well places 24 porocyte culture plate overnight incubation.

Virus rescue:

Will be from 6 plasmid pHW201-PB2, pHW202-PB1 of F strain, pHW203-PA, pHW205-NP, pHW207-M, pHW208-NS with from 2 plasmid pHW504-HA, pHW506-NA of D3 strain, by 1: 1 mixed.Make improvements transfection slightly according to Lipofectin Reagent transfection reagent operation instructions: soon blended plasmid and transfection reagent add in the COS-1 cell, put to contain 5%CO ₂, in 37 ℃ of incubators, cultivate 24h after, scrape cells transfected and inoculate 10 age in days SPF chicken embryos; The results allantoic fluid continues inoculation 10 age in days SPF chicken embryos after cultivating 48h, observes chicken embryo death and pathology situation every day, collects chick embryo allantoic liquid in good time and carries out the virus evaluation, and the virus of being rescued is called for short the D3/F-R2/6 strain.

Virus is identified:

Blood clotting of D3/F-R2/6 strain (HA) and blood clotting suppress (HI) test to be undertaken by the OIE standard.The plasmid of pHW504-HA, pHW506-NA that contains the plasmid of 6 genes of F strain and D3 strain was in 1: 1 ratio cotransfection COS-1 cell, and the first-generation 10 age in days SPF chick embryo allantoic liquid hemagglutinative titers of inoculation reach 2 ⁸, with the first-generation 10 age in days SPF chick embryo allantoic liquids dilution 10 ³～10 ⁵Doubly, after aseptic inoculation 10 age in days SPF chicken embryos went down to posterity, hemagglutinative titer was up to 2 ¹¹Make the HI test of D3/F-R2/6 pnca gene reprovision AIV respectively of H1 and H5AIV positive serum, the D3/F-R2/6 strain can be suppressed by the H5 positive serum, and it is 2 that HI tires ⁹, but can not be suppressed by the H1 positive serum.

Sequence Identification:, identify that by the order-checking of associating gene Shanghai connection polygene research institute method is seen step 2 with HA and the NS gene among the RT-PCR method acquisition D3/F-R2/6 strain AIV.The HA gene of the AIV of D3/F-R2/6 strain as a result is the HA gene of D3 strain, the sequence PQIETR ↓ GL of its cracking site for having suddenlyd change; The NS gene is the NS gene of F strain, and accession number is red for Lu AY253756[builds, Liu Xiu Buddhist, and Shao Weixing waits the genetic analysis of .H9N2 hypotype AIV genome full length sequence mensuration and each gene. microorganism journal, 2003,43 (4): 434～41.].Illustrate that D3/F-R2/6 strain AIV is F strain and D3 strain reprovision virus.

Step 6: the biological characteristics of D3/F-R2/6 strain AIV is measured

The virulence of D3/F-R2/6 strain AIV is measured:

Press the OIE standard, with the aseptic D3/F-R2/6 strain allantoic fluid of 0.2mL dilution in 1: 10, observed 10 days continuously behind the SPF chicken through age 10 6 weeks of intravenous inoculation, do not find the inoculation chicken death, its IVPI is 0, and growing of chicken is normal.

D3/F-R2/6 strain AIV duplicates in that the SPF chicken is intravital:

With tracheae and the cloaca cotton swab sample of the inoculation chicken of gathering in the 3rd, 5,7,9,12 day after the inoculation D3/F-R2/6 strain, inoculate 10 age in days SPF chicken embryos, with isolated viral.Toxin expelling for some time after the inoculation in inoculation chicken tracheae, but promptly separated less than virus in the 9th day; Toxin expelling for some time after the inoculation in inoculation chicken cloaca, but promptly separated in the 12nd day less than virus (table 1).

Table 1 D3/F-R2/6 strain AIV duplicates situation in the chicken body

Table 1 Replication of the D3/F-R2/6 AIV in chickens

The inoculation back time (my god)	Tracheae virus is separated (%)	Cloaca virus is separated (%)
			3 5 7 9 12	75 13 13 0 0	87 100 100 25 0

D3/F-R2/6 strain AIV inoculates 10 age in days SPF chickens 3 week back HI test: recording by the OIE standard that average HI tires is 2 ⁹

The ELD of D3/F-R2/6 strain AIV ₅₀And EID ₅₀Measure: the ELD of D3/F-R2/6 strain AIV ₅₀/ EID ₅₀All be 10 ⁸/ 0.2mL, the mean time to death of chicken embryo is at 80～84h..Dead chicken embryo whole body Mild edema, cephalemia, abdominal surface have blutpunkte, lung's extravasated blood and liver slightly downright bad.

More than test explanation D3/F-R2/6 strain AIV is weak pathogenic H5N1 hypotype AIV.

Pathogenic to the SPF chicken of the stability that D3/F-R2/6 strain AIV goes down to posterity at SPF chicken embryo and the back of going down to posterity:

By the first-generation 10 age in days SPF chick embryo allantoic liquids of transfection COS-1 cell inoculation, the HA hemagglutinative titer reaches 2 ⁸The first-generation 10 age in days SPF chick embryo allantoic liquids were passed for 20 generations continuously, and the HA of dead chick embryo allantoic liquid tires and reaches 2 ¹¹(1: 2048) (table 2), the mean time to death 80～84h of chicken embryo.Illustrate that D3/F-R2/6 strain AIV has very high replication in the chicken embryo.

Obtain the HA gene of the 20th generation D3/F-R2/6 strain AIV with the RT-PCR method, by the order-checking of associating gene Shanghai connection polygene research institute, the result prove the HA gene of D3/F-R2/6 strain AIV be the D3 strain causing weak HA gene, its cracking site is PQIETR ↓ GL.D3/F-R2/6 strain AIV is described through going down to posterity, its sequence does not change.To 6 age in week the SPF chicken pathogenic test show that in 10 days that observe, 10 SPF chickens of inoculation do not see death, its IVPI is 0.D3/F-R2/6 strain AIV is described through going down to posterity, its weak pathogenic biological characteristics is very stable.

The HA that table 2 D3/F-R2/6 strain AIV goes down to posterity in SPF chicken embryo tires (2 ¹¹)

Table 2 HA titer of D3/F-R2/6 AIV in embronating chicken egg of SPF origin at 5，10，15，20 Passages(2 ¹¹)

Algebraically goes down to posterity	F1		F5		F10		F15		F20
											Extent of dilution	10 -5	10 -6	10 -5	10 -6	10 -5	10 -6	10 -5	10 -6	10 -5	10 -6
Hemagglutinative titer	2 8	2 8	2 8	2 8	2 9	2 10	2 10	2 11	2 11	2 11

Step 7: D3/F-R2/6 strain AIV is to immunoprotection test and the cross immunity protection test of SPF chicken

50 1 age in days SPF chickens are divided into 5 groups, every group 10, during 7 ages in days wherein two groups respectively through each 0.3mL of deactivation oil seepage of neck subcutaneous vaccination D3/F-R2/6 strain AIV deactivation oil seepage, a winding kind D3 strain, one group is made as not vaccination and directly attacks malicious H5N1 hypotype AIV, one group is the normal healthy controls group.Immunity blood sampling in back 21 days separation of serum is surveyed antibody titer, uses 10 respectively ⁷ELD ₅₀The D3 strain is to the D3/F-R2/6 strain, and D3 strain inactivated vaccine immune group and not vaccination attack directly that the poison group is carried out collunarium, eye drip is attacked poison.Observed 14 days statistics morbidity and death condition continuously.

D3/F-R2/6 strain AIV inactivated vaccine sees Table 3 to immunity and the cross immunity protection test of SPF chicken.The average HI antibody titer 2 that the immunity of D3/F-R2/6 strain AIV deactivation oil seepage is back 21 days ^7:0.25, do antigen with the H5N1 hypotype AIV G5 strain of goose source, the average HI antibody titer 2 that records ^{6.5 ± 0.3}The average HI antibody titer 2 that the immunity of D3 strain deactivation oil seepage is back 21 days ^{5.5 ± 0.2}The immune protective rate that D3/F-R2/6 strain AIV and its maternal wild virus D3 strain deactivation oil seepage provide for the SPF chicken all is 100%; H5N1 hypotype AIV attacks poison with the goose source, and its cross immunity protection ratio is 100%.Immune group is all not dead in 7 days after poison is attacked in the D3 strain, and normal healthy controls group chicken is normal.HI antibody titers after the immunity shows D3/F-R2/6 strain AIV inactivated vaccine, and bird flu has the better protection effect to H5N1 hypotype HP.

Table 3 D3/F-R2/6 strain AIV deactivation oil seepage is to immunity and the cross immunity protection efficient of SPF chicken

Table 3 Protective efficacy of D3/F-R2/6 inactivated vaccine in oil emulsion in SPF chickens

Group	The immunity age in days (my god)	Attack malicious age in days (my god)	Attack toxic agent amount (ELD 50)	Protection efficient (%)		Back 21 days average HI (2 of immunity 11)
								Poison is attacked in the D3 strain	Poison is attacked in the G5 strain	D3 strain antigen	G5 strain antigen
				D3/F-R2/6 strain vaccine D3/F-R2/6 strain vaccine D3 strain vaccine is attacked the poison contrast	7 7 7	28 28 28 28	10 7 10 7 10 7 10 7					100 100 0	100	7±0.25 7±0.25 5.5±0.2	6.5±0.3 6.5±0.3

Step 8: D3/F-R2/6 strain AIV is to the immunoprotection test and the cross immunity protection test of commercial chicken

Test design is with step 7, and test of the immunoprotection of commercial chicken and cross immunity protection test the results are shown in Table 4.The maternal antibody of commercial chicken is 2 ^1-3The back 21 days antibody titer of D3/F-R2/6 strain AIV deactivation oil seepage immunity is 2 ^{6.5 ± 0.3}, do antigen with the H5N1 hypotype AIVG5 strain of goose source, the average HI antibody titer that records is 2 ^{6 ± 0.2}The back 21 days average HI antibody titer of D3 strain deactivation oil seepage immunity is 2 ^{4.2 ± 0.5}The immune protective rate of commercial chicken and cross immunity protection ratio all are 100%.Immune group is all not dead in 7 days after D3 strain and G5 strain AIV attack poison, and normal healthy controls group chicken is normal.HI antibody titers after the immunity shows D3/F-R2/6 strain AIV inactivated vaccine, and bird flu has the better protection effect to H5N1 hypotype HP.

Table 4 D3/F-R2/6 strain AIV deactivation oil seepage is renderd a service the immunity and the cross immunity protection of commercial chicken

Table 4 Protective efficacy of D3/F-R2/6 inactivated vaccine in oil emulsion in commercial broiler

chickens

Group	The immunity age in days (my god)	Attack malicious age in days (my god)	Attack toxic agent amount (ELD 50)	Protection efficient (%)		Back 21 days average HI (2 of immunity 11)
								Poison is attacked in the D3 strain	Poison is attacked in the G5 strain	D3 strain antigen	G5 strain antigen
				D3/F-R2/6 strain vaccine D3/F-R2/6 strain vaccine D3 strain vaccine is attacked the poison contrast	7 7 7	28 28 28 28	10 7 10 7 10 7 10 7					100 100 0	100	6.5±0.3 6.5±0.3 4.2±0.5 2.2±0.15	6±0.2 6±0.2 2.2±0.15 2.2±0.15

Claims (4)

1, a kind of avian influenza virus gene resortment strain D3/F-R2/6, it is characterized in that its preserving number is CGMCC NO:1386, genome length is 13.5Kb, is made of two the outside genes of H5N1 hypotype AIV and 6 internal gene PB2, PB1, PA, NP, M, NS of MPAIV chicken embryo height adapted strain A/Chicken/Shanghai/F/98 H9N2 hypotype; Two outside genes of described H5N1 hypotype AIV are respectively the NA genes of HPAIV epidemic strain A/Duck/Huadong/D3/00H5N1 hypotype and cause weak HA gene;

The weak HA gene DNA sequence that causes of HPAIV epidemic strain A/Duck/Huadong/D3/00 H5N1 hypotype is:

atggagaaaa tagtgcttct tcttgcaata gtcagtcttg ttaaaagtga tcagatttgc 60

attggttacc atgcaaacaa ctcgacagag caggttgaca caataatgga aaagaacgtt 120

actgttacgc atgcccaaga catactggaa aaggcacaca acgggaaact ctgcgatcta 180

gatggagtga agcctctaat tttgggagat tgtagtgtagc tggatggctc ctcggaaac 240

cctatgtgtg acgaattcat caatgtgccg gaatggtctt acatagtggg gaaggccagt 300

ccagccaatg acctctgtta cccaggggat ttcaacgact atgaagaact gaaacaccta 360

ttgagcagaa taaaccactt tgagaaaatt cagatcatcc ccaaaagttc ttggtccaat 420

catgaagcct catcaggggt gagcgcggca tgtccatacc atgggaagcc ctcctttttc 480

agaaatgtgg tatggcttat caaaaagaac agtgcatacc caacaataaa gaggagctac 540

aataacacca accaagaaga tcttttggta ctgtggggga ttcaccatcc taatgatgca 600

gcagagcaga caaagctcta tcaaaaccca accacctata tctccgttgg aacatcaaca 660

ttaaaccaga gattggtccc aaaaatagct actagatcca gagtaaacgg gcaaagtgga 720

agaatggagt tcttctggac aattttaaag ccgaatgatg ccataaattt cgagagtaat 780

gggaatttca ttgctccaga atacgcatac aaaattgtca agaaagggga ctcagcaatt 840

atgaaaagtg aattggaata tggtaactgc aacaccaagt gtcaaactcc aatgggggcg 900

ataaactcta gtatgccatt ccacaacata caccctctca ccatcgggga atgccccaaa 960

tatgtgaaat caaacagatt agtccttgcg actagactca gaaatacccc tcaaagagag 1020

agaaggagaa aaaagagagg actatttgga gctatagcag gttttataga gggaggatgg 1080

cagggaatgg tagatggttg gtatgggtac caccatagca atgagcaggg gagtggatac 1140

gctgcagaca aagaatccac tcaaaaggca atagatggag tcaccaataa ggtcaactcg 1200

atcattgaca aaatgaacac tcagtttgag gccgttggaa gggaatttaa taacttagaa 1260

aggaggatag aaaatttaaa caagaagatg gaagacggat tcctagatgt ctggacttat 1320

aatgctgaac ttctggttct catggaaaat gagagaactc tagactttca tgattcaaat 1380

gtcaagaacc tttacaacaa ggtccgacta cagcttaggg ataatgcaaa ggagctgggt 1440

aatggttgtt tcgagttcta tcacaaatgt gataatgaat gtatggaaag tgtaaaaaac 1500

gggacgtatg actacccgca gtattcagaa gaagcaagac taaacagaga ggaaataaat 1560

ggagtaaaat tggaatcaat gggaacttac caaatactgt caatttattc aacagtggcg 1620

agttccctag cactggcaat catggtagct ggtctatctt tatggatgtg ctccaatgga 1680

tcgttacaat gcagaatttg catttaa

The NA gene DNA sequence of HPAIV epidemic strain A/Duck/Huadong/D3/00 H5N1 hypotype is:

agcaaaagca ggagttcaaa atgaatccaa atcaaaagat aataaccacc ggatcaatct 60

gtatggtaatt ggaatggtta gcttgatgtt gcaaattgg gaacataatc tcaatatggg 120

ttagtcattc aattcagaca gggactcaac accgagctga accatgcaat cgaagcatta 180

ttaattatga aaacaacacc tgggtaaatc agacatatgt caaaatcagc aacaccaatt 240

ttcttactga gaaagctgtg gcttcagtaa gattagtggg caattcatct ctttgcccca 300

tgtttgttat aagagagccg ttcatctcat gctcccactt ggaatgccga accttctttt 360

tgactcaggg agccttgctg aatgataagc actccaatgg gaccgtcaaa gacagaagcc 420

cttacagaac attgatgagc tgtcctgtgg gtgaggcccc ctccccatat aactcgaggt 480

ttgagtctgt tgcttggtcg gcaagtgctt gtcatgatgg cactagttgg ttgacaattg 540

gaatttctgg cccagacaat ggggctgtgg ctgtattgaa atacaatggc ataataacag 600

acactatcaa gagttggagg aacaacatac tgagagctca agagtctgaa tgtgcatgtg 660

taaatggctc ttgctttact gtaatgactg acggaccaag taatgggcag gcttcatata 720

agatcttcaa aatagaaaaa gggaaagtag ttaaatcagt cgaattgaat gcccctaatt 780

atcactatga ggagtgctcc tgttatcctg atgctggcga aatcacatgt gtgtgcaggg 840

ataattggca tggctcaaat cggccatggg tatctttcaa tcaaaatttg gagtaccaaa 900

taggatatat atgcagtgga gttttcggag acaatccacg ccccaatgat ggaacaggca 960

gttgtggtcc ggtgtcccct aacggggcat atggagtaaa agggttttca tttaaatacg 1020

gcaatggtgt ttggatcggg agaaccaaaa gcactaattc caggagcggc tttgaaatga 1080

tttgggatcc aaatgggtgg actggaacgg acagtaattt ttcggtgaag caagatatcg 1140

tagctataac tgattggtca ggatatagcg ggagttttgt ccagcatcca gaactgacag 1200

gattagattg cataagacct tgtttctggg ttgagctaat cagagggcgg cccaaagaga 1260

gcacaatttg gactagtggg agcagcatat ctttttgtgg tgtaaatagt gacactgtgg 1320

gttggtcttg gccagacggt gctgagttgc cattcaccat tgacaagtag tttgttcaaa 1380

aaactccttg tttctact。

2, the construction process of avian influenza virus gene resortment strain D3/F-R2/6 according to claim 1, it is characterized in that the NA gene of 6 internal gene PB2, PB1, PA, NP, M, NS and the HPAIV epidemic strain A/Duck/Huadong/D3/00 H5N1 hypotype of MPAIV chicken embryo height adapted strain A/Chicken/Shanghai/F/98 H9N2 hypotype and cause weak HA gene carrying out reprovision, be built into avian influenza virus gene resortment strain D3/F-R2/6.

3, according to the construction process of the described avian influenza virus gene resortment of claim 2 strain D3/F-R2/6, it is characterized in that comprising following concrete steps:

1) 6 internal gene PB2, PB1, PA, NP, M, the NS of amplification MPAIV chicken embryo height adapted strain A/Chicken/Shanghai/F/98 H9N2 hypotype, the amplimer sequence is as follows:

Bm-PB2-1 5’-TATT CGTCTCAGGGAGCGAAAGCAGGTC-3’；

Bm-PB2-2 5’-ATAT CGTCTCGTATTAGTAGAAACAAGGTCGTTT-3’；

Bm-PB1-1 5’-TATT CGTCTCAGGGAGCGAAAGCAGGCA-3’；

Bm-PB1-2 5’-ATAT CGTCTCGTATTAGTAGAAACAAGGCATTT-3’；

Bm-PA-1 5’-TATT CGTCTCAGGGAGCGAAAGCAGGTACTGAT-3’；

Bm-PA-2 5’-ATAT CGTCTCGTATTAGTAGAAACAAGGTACTTTT-3’；

Bm-NP-1 5’-TATT CGTCTCAGGGAGCAAAAGCAGGGTAGATAATC-3’；

Bm-NP-2 5’-ATAT CGTCTCGTATTAGTAGAAACAAGGGTATTTTTC-3’；

Bm-M-1 5’-TATT CGTCTCAGGGAGCAAAAGCAGGTAG-3’；

Bm-M-2 5’-ATAT CGTCTCGTATTAGTAGAAACAAGGTAGTTTTT-3’；

Bm-NS-1 5’-TATT CGTCTCAGGGAGCAAAAGCAGGGTG-3’；

Bm-NS-2 5’-ATAT CGTCTCGTATTAGTAGAAACAAGGGTGTTTT-3’；

2) increase respectively the HA gene and the NA gene of HPAIV strain A/Duck/Huadong/D3/00 H5N1 hypotype, the primer sequence of amplification HA and NA gene is as follows:

Bm-HA-1 5’-TATT CGTCTCAGGGAGCAAAAGCAGGGG-3’；

Bm-HA-2 5’-ATAT CGTCTCGTATTAGTAGAAACAAGGGTGTTTT-3’；

Bm-NA-1 5’-TATT CGTCTCAGGGAGCAAAAGCAGGAGT-3’；

Bm-NA-2 5’-ATAT CGTCTCGTATTAGTAGAAACAAGGAGTTTTTT-3’；

3) the HA gene of modification H5N1 hypotype HPAIV A/Duck/Huadong/D3/00 H5N1 hypotype strain: the cracking site PQIETR ↓ GL that the cracking site PQRERRRKKR ↓ GL of HA gene is sported non-virulent influenza virus A/Teal/Hong Kong/W312/97 H6N1 hypotype strain HA;

4) the HA gene cDNA of the H5N1 hypotype HPAIV A/Duck/Huadong/D3/00 H5N1 hypotype strain after will modifying is cloned into pHW2000 through 3 molecule connection methods, makes up the strain of HPAIVA/Duck/Huadong/D3/00 H5N1 hypotype and causes weak HA gene transcription/expression plasmid pHW504-HA;

5) make up transcribing/expression plasmid of 6 internal gene: transcribe at 8 plasmids/expression vector pHW2000 in, insert MPAIV chicken embryo height adapted strain A/Chicken/Shanghai/F/98H9N2 hypotype 6 internal gene PB2, PB1, PA, NP, M, NS cDNA respectively, form 6 and transcribe/expression plasmid, be i.e. pHW201-PB2, pHW202-PB1, pHW203-PA, pHW205-NP, pHW207-M, pHW208-NS;

6) make up the NA gene transcription/expression plasmid of HPAIV A/Duck/Huadong/D3/00 H5N1 hypotype strain: the NA gene of transcribing/inserting among the expression vector pHW2000 strain of HPAIVA/Duck/Huadong/D3/00 H5N1 hypotype at 8 plasmids forms pHW506-NA;

7) 6+2 gene resortment: will be from 6 plasmid pHW201-PB2, pHW202-PB1 of F strain, pHW203-PA, pHW205-NP, pHW207-M, pHW208-NS with from 2 plasmid pHW504-HA, pHW506-NA of A/Duck/Huadong/D3/00 H5N1 hypotype strain, mixed by 1: 1, blended plasmid and transfection reagent are added in the COS-1 cell, put and contain 5%CO ₂, in 37 ℃ of incubators, cultivate switching kind of 10 age in days SPF chicken embryos behind the 24h, promptly obtain avian influenza virus gene resortment strain D3/F-R2/6.

4, according to the construction process of the described avian influenza virus gene resortment of claim 3 strain D3/F-R2/6, it is characterized in that in the step 4) by two pairs of mutant primers increase respectively HA1 1.05kb and two fragments of HA2 0.65kb, HA1 and HA2 that gel electrophoresis is reclaimed cut, reclaim through the BsmBI enzyme, with equally carry out 3 molecule ligations, 16 ℃ of effect 12h through transcribing of cutting of BsmBI enzyme/expression vector pHW2000; Two pairs of mutant primers are respectively:

Bm-HA-1 5’-TATTCGTCTCAGGGAGCAAAAGCAGG-3’；

Bm-HA-2 5’-ATATCGTCTCGTATTAGTAGAAACAAGGGTGTTTT-3’；

P-MG4-1 5’-ACATCGTCTCACTAGAGGATTATTTGGAGCTAT-3’；

P-MG4-2 5’-AGATCGTCTCTTCAATTTGAGGGCTTTTTCTGAGTCC-3’。

Images