CN1305898C - Stimulated polypeptide, its coding genes and use of capsule protein HVR1 of hepatitis C virus - Google Patents
Stimulated polypeptide, its coding genes and use of capsule protein HVR1 of hepatitis C virus Download PDFInfo
- Publication number
- CN1305898C CN1305898C CNB031505333A CN03150533A CN1305898C CN 1305898 C CN1305898 C CN 1305898C CN B031505333 A CNB031505333 A CN B031505333A CN 03150533 A CN03150533 A CN 03150533A CN 1305898 C CN1305898 C CN 1305898C
- Authority
- CN
- China
- Prior art keywords
- hvr1
- hepatitis
- mimic peptide
- envelope protein
- thr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Peptides Or Proteins (AREA)
Abstract
The present invention discloses eight analog polypeptides in hepatitis C virus capsular protein hypervariable region 1 (HVR 1) and coding genes thereof. The analog polypeptides can generate wide cross reaction with patient's blood serum. Simultaneously, the present invention also provides application of the analog polypeptides.
Description
Technical field
The present invention relates to the genetically engineered field, particularly have hepatitis C virus envelope protein HVR1 mimic peptide, its encoding gene and their purposes of extensive cross reactivity.
Background technology
Hepatitis C virus (hepatitis C virus, HCV) be the main pathogen that causes post-transfusion hepatitis and sporadic non-A non-B hepatitis, infection rate among the crowd is widely different all over the world, from less than 1% to 20%, at least the HCV of 70%-80% infects and to cause virus to continue to exist and chronic hepatopathy, and wherein the people of 20%-30% can make progress and is liver cirrhosis even hepatocellular carcinoma.
HCV is tunicate sub-thread positive chain RNA virus, belongs to the flaviviridae Hepacivirus, and genome has 9500 bases approximately, is divided into 5 ' non-translational region, an open reading frame (0RF) and 3 ' non-translational region.ORF one the about 3000 amino acid whose polyprotein precursor of encoding is processed into 10 kinds of viral proteins under host cell signalase and virus protease acting in conjunction, be followed successively by Core, E1, E2, p7, NS2, NS3, NS4A, NS4B, NS5A, NS5B.
Hypervariable region 1 (hypervariable region 1 HVR1) is positioned at the N end of E2, nt1150-1230, and aa384-410 is right after the downstream of signal peptide sequence (aa370-383), about 27aa.HVR1 is the maximum fragment of whole viral genome variation, between virus strain, between individuality or even the different times of same individuality very big-difference is all arranged, be the major cause that causes infective virus heterogeneity between individuality and in individual.Studies show that HVR1 is the important target position of host body fluids immunity neutralizing antibody, but its strain specificity can cause part virus to escape host's immunity identification and continuing of infecting.However, there is conservative site in the HVR1 sequence, by appropriate H VR1 immune programme for children, still may induce out protection antibody (Farci P, Prevention ofhepatitis C virus infection in chimpanzees by hyperimmune serum againstthe hypervariable region l of the envelope E2 protein.Proc Natl Acad SciUSA 1996,96:15394-15399; Esumi M, Experimental vaccine activities ofrecombinant E1 and E2 glycoproteins and hypervariable region 1peptides of hepatitis C virus in chimpanzees.Arch Virol1999,144:973-980; Cerino A, Monoclonal antibodies with broadspecificity for hepatitis C virus hypervariable region 1 variants canrecognize viral particles.J Immunol.2001,167:3878-3886).
Existing many research and utilization HVR1 natural sequences or simulating peptide sequence, seek the HVR1 sequence of high cross reactivity, to obtain candidate's immunogen (Puntoriero G as prevention of hepatitis C specific immunity and treatment, Towards a solution for hepatitis C virushypervariability:mimotopes of the hypervariable region l can induceantibodies cross-reacting with a large number of viral variants.EMBO J.1998,17:3521-3533).Method commonly used is synthetic HVR1 peptide section, but the expense costliness, and variation type is limited.Adopt DNA shuffling or claim molecule go down to posterity (molecularbreeding) method (Fig. 1) (Stemmer WPC..DNA shuffling by randomfragmentation and reassembly:in vitro recombination for molecularevolution.Proc Natl Acad Sci USA.1994,91:10747-10751; Minshull J, Stemmer WPC..Protein evolution by molecular breeding.CurrentOpinion in Chem biol 1999 3:284-290.), does not appear in the newspapers as yet.
Still do not have effective HCV vaccine at present, also quite limited at the treatment means of HCV, it is most important to develop effective HCV vaccine and medicine.
Therefore, this area presses for to develop and has immunogenic mimic peptide of HCV and encoding sequence thereof.
Summary of the invention
Purpose of the present invention just provide a class have HCV immunogenic, have mimic peptide and an encoding sequence thereof with the extensive cross reactivity of patients serum.
Another object of the present invention just provides the purposes of this analoglike polypeptide and encoding sequence thereof.
In a first aspect of the present invention, a class hepatitis C virus envelope protein HVR1 mimic peptide is provided, it is characterized in that this mimic peptide has the aminoacid sequence shown in the SEQ N0:2,4,6,8,10,12,14 or 16.
In a second aspect of the present invention, the fusion rotein of described mimic peptide is provided, it is characterized in that this fusion rotein comprises and is selected from any two or more aminoacid sequences shown in the SEQ N0:2,4,6,8,10,12,14,16.Preferably, described fusion rotein comprises the aminoacid sequence shown in SEQ NO:2 and the SEQ NO:4.
In another preference, described fusion rotein comprises and is selected from any three or four aminoacid sequences shown in the SEQ NO:2,4,6,8,10,12,14,16.
In a third aspect of the present invention, class hepatitis C virus envelope protein HVR1 simulation gene is provided, it is characterized in that this simulation genes encoding mimic peptide of the present invention.
In a preference, described simulation gene has the nucleotide sequence shown in the SEQ NO:1,3,5,7,9,11,13 or 15.
In a fourth aspect of the present invention, the application of described mimic peptide is provided, it is characterized in that the application of described mimic peptide in preparing the medicine that detects, prevents and/or treats hepatitis C.
In a preference, described mimic peptide is used to prepare the vaccine that prevents and/or treats hepatitis C.
In a fifth aspect of the present invention, the application of described fusion rotein is provided, it is characterized in that the application of described fusion rotein in preparing the medicine that detects, treats and/or prevents hepatitis C.
In a preference, described fusion rotein is used to prepare the vaccine that prevents and/or treats hepatitis C.
In a sixth aspect of the present invention, the application of described simulation gene is provided, it is characterized in that the application of described simulation gene in preparing the medicine that detects, treats and/or prevents hepatitis C.
In a seventh aspect of the present invention, a kind of carrier is provided, it is characterized in that it contains simulation gene of the present invention.
In a eighth aspect of the present invention, a kind of genetically engineered host cell is provided, it is characterized in that it is the host cell that carrier described by the present invention transforms or transduces.
In a ninth aspect of the present invention, a kind of preparation method who prepares hepatitis C virus envelope protein HVR1 mimic peptide is provided, it is characterized in that this method comprises:
(a) under the condition that is fit to expression hepatitis C virus envelope protein HVR1 mimic peptide, cultivate host cell of the present invention;
(b) from culture, isolate hepatitis C virus envelope protein HVR1 mimic peptide.
In a tenth aspect of the present invention, provide a kind of can with mimic peptide specificity bonded antibody of the present invention, comprise monoclonal antibody and polyclonal antibody.
In a eleventh aspect of the present invention, a kind of detection kit is provided, it is characterized in that it contains mimic peptide of the present invention, antibody of the present invention, fusion rotein of the present invention or its combination.Preferably, described detection kit contains mimic peptide of the present invention.
In a twelveth aspect of the present invention, the method that whether has hepatitis C virus antigen or anti-hepatitis C virus antibody in a kind of vitro detection sample is provided, it is characterized in that, comprise step:
(a) sample is contacted with the material that is selected from down group: mimic peptide of the present invention, antibody of the present invention, fusion rotein of the present invention or its combination.
(b) detect whether form antigen-antibody complex, wherein form mixture and just represent to exist in the sample hepatitis C virus antigen or anti-hepatitis C virus antibody.
In a preference, described sample is a serum.
In another preference, described material is a mimic peptide of the present invention.
In another preference, described material is a fusion rotein of the present invention.
In another preference, the detection method of described step (b) is ELISA method or fluorescence detection.
Polypeptide of the present invention is meant " hepatitis C virus envelope protein HVR1 mimic peptide " or " hepatitis C virus envelope protein HVR1 simulates gene product ".
Polypeptide of the present invention can be the product of chemosynthesis, or uses recombinant technology to produce from protokaryon or eucaryon host (for example, bacterium, yeast, higher plant, phage, insect and mammalian cell).
In the present invention, term " hepatitis C virus envelope protein HVR1 mimic peptide " refers to have the polypeptide of aminoacid sequence shown in the SEQ ID NO:2,4,6,8,10,12,14 or 16.This term also comprises having and hepatitis C virus envelope protein HVR1 mimic peptide variant form identical function, above-mentioned aminoacid sequence.These variant forms comprise (but being not limited to): several (being generally 1-5) amino acid whose disappearances, insertion and/or replacement, and add one or several at C-terminal and/or N-terminal and (be generally in 15, preferably being in 10, more preferably is in 5) amino acid.Such as, add one or several amino acid at C-terminal and/or N-terminal and also can not change proteinic function usually.For example, the present invention replaces the envelope protein that the original HVR1 sequence of envelope protein obtains to contain the mimic peptide sequence with described mimic peptide sequence.
The coding region sequence of code book invention polypeptide can be identical with the coding region sequence shown in the SEQ ID NO:1,3,5,7,9,11,13 or 15 or the varient of degeneracy.As used herein, " varient of degeneracy " is meant that in the present invention coding has the protein of aminoacid sequence shown in the SEQ ID NO:2,4,6,8,10,12,14 or 16, but with the differentiated nucleotide sequence of encoding sequence shown in the SEQ IDNO:1,3,5,7,9,11,13 or 15.
Term " polynucleotide of code book invention polypeptide " can be the polynucleotide that comprise this polypeptide of encoding, and also can be the polynucleotide that also comprise additional code and/or non-coding sequence.
Hepatitis C virus envelope protein HVR1 simulation gene nucleotide series can obtain with the method for pcr amplification method, recombination method or synthetic usually.
In case obtained relevant sequence, just can obtain relevant sequence in large quantity with recombination method.This normally is cloned into carrier with it, changes cell again over to, separates obtaining relevant sequence then from the host cell after the propagation by ordinary method.
At present, can obtain the dna sequence dna of code book invention polypeptide fully by chemosynthesis.This dna sequence dna can be introduced in various existing dna moleculars as known in the art (or as carrier) and the cell then.In addition, also can will suddenly change and introduce in the peptide sequence of the present invention by chemosynthesis.
The present invention also relates to comprise the carrier of polynucleotide of the present invention, and the host cell that produces through genetically engineered with the encoding sequence of carrier of the present invention or hepatitis C virus envelope protein HVR1 mimic peptide, and the method that produces polypeptide of the present invention through recombinant technology.
Recombinant DNA technology (Science, 1984 by routine; 224:1431), can utilize polymerized nucleoside acid sequence of the present invention to express or produce the hepatitis C virus envelope protein HVR1 mimic peptide of reorganization.In general following steps are arranged:
(1). with the polynucleotide (or varient) of coding hepatitis C virus envelope protein HVR1 mimic peptide of the present invention, or transform or the transduction proper host cell with the recombinant expression vector that contains these polynucleotide;
(2). the host cell of in suitable medium, cultivating;
(3). separation, purifying hepatitis C virus envelope protein HVR1 mimic peptide from substratum or cell.
Particularly, hepatitis C virus envelope protein HVR1 mimic peptide of the present invention can be by introducing corresponding coding sequence host cell (directly introducing or contain by introducing the carrier of hepatitis C virus envelope protein HVR1 mimic peptide encoding sequence), and under appropriate condition, cultivate transformed host cells to express hepatitis C virus envelope protein HVR1 mimic peptide, separate then and be purified into hepatitis C virus envelope protein HVR1 mimic peptide.
The transformant that obtains can be cultivated with ordinary method, expresses the polypeptide of coded by said gene of the present invention.According to used host cell, used substratum can be selected from various conventional substratum in the cultivation.Under the condition that is suitable for the host cell growth, cultivate.After host cell grows into suitable cell density, induce the promotor of selection with suitable method (as temperature transition or chemical induction), cell is cultivated for some time again.
The present invention not only comprises complete mono-clonal or polyclonal antibody, but also comprises having immunocompetent antibody fragment, as Fab ' or (Fab)
2Fragment; Heavy chain of antibody; Light chain of antibody; Or chimeric antibody, as have the murine antibody binding specificity but still keep antibody from people's antibody moiety.
Antibody of the present invention can be prepared by the known various technology of those skilled in that art.For example, the hepatitis C virus envelope protein HVR1 of purifying simulates gene product, can be applied to animal to induce the generation of polyclonal antibody.Similarly, the cell of expression hepatitis C virus envelope protein HVR1 mimic peptide can be used to immune animal and produces antibody.
Monoclonal antibody of the present invention can utilize hybridoma technology to prepare.Each antibody-like of the present invention can utilize hepatitis C virus envelope protein HVR1 simulation gene product, obtains by the routine immunization technology.These simulation gene products can be utilized recombinant methods or utilize Peptide synthesizer synthetic.Can come immune animal and produce with the gene product of production in the prokaryotic cell prokaryocyte (for example E.Coli) with the unmodified form bonded antibody of hepatitis C virus envelope protein HVR1 simulation gene product; With posttranslational modification form bonded antibody (as the polypeptide of glycosylation or phosphorylation), can come immune animal and obtain with the gene product that produces in the eukaryotic cell (for example yeast or insect cell).
The available hepatitis C virus envelope protein of the production of polyclonal antibody HVR1 mimic peptide immune animal, as rabbit, sheep etc.Multiple adjuvant can be used for the enhancing immunity reaction, includes but not limited to freund's adjuvant etc.
Hepatitis C virus envelope protein HVR1 mimic peptide or described fusion rotein, described simulation gene can be used for the medicine for preparing the detection, prevent and/or treat hepatitis C.Prevent and/or treat the vaccine of hepatitis C in particular for preparation.
The present invention also provides a kind of pharmaceutical composition, and it contains the hepatitis C virus envelope protein HVR1 mimic peptide of the present invention of safe and effective amount, described fusion rotein or its antisense nucleic acid, and pharmaceutically acceptable carrier or vehicle.This class carrier comprises (but being not limited to): salt solution, damping fluid, glucose, water, glycerine, ethanol and combination thereof.Pharmaceutical preparation should be complementary with administering mode.Pharmaceutical composition of the present invention can be made into the injection form, for example is prepared by ordinary method with the physiological saline or the aqueous solution that contains glucose and other assistant agents.Pharmaceutical composition such as tablet and capsule can be prepared by ordinary method.Pharmaceutical composition such as injection, solution, tablet and capsule should be made under aseptic condition.The dosage of activeconstituents is the treatment significant quantity, for example every day about 0.1 microgram/kg body weight-Yue 1.0 mg/kg body weight.In addition, polypeptide of the present invention also can use with the other treatment agent.Certainly, concrete dosage also should be considered factors such as route of administration, patient health situation, and these all are within the skilled practitioners skill.
The method that whether has the specific antibody of hepatitis C virus envelope protein HVR1 in a kind of test sample is to utilize hepatitis C virus envelope protein HVR1 mimic peptide to detect, and it comprises: sample is contacted with hepatitis C virus envelope protein HVR1 mimic peptide; Observe whether form antibody complex, formed antibody complex and just represented to exist in the sample hepatitis C virus.
The polynucleotide of hepatitis C virus envelope protein HVR1 mimic peptide can be used for the diagnosis and the treatment of hepatitis C virus envelope protein HVR1 relative disease.
The contriver is by using DNA shuffling or claiming molecule (molecularbreeding) technology that goes down to posterity can change gene order fast, and its most significant progress is the multifarious external conversion of nature, promptly as far as possible near the simulation of natural sequence.Its ultimate principle is one group of genes involved by the section of cutting into pieces at random, and the homologous sequence during annealing on each fragment is primer each other, and the mode by mutual reorganization reconnects, and forms new sequence.Fig. 1 is the basic principle schematic of present technique.
The HVR1 cDNA natural sequence that the present invention adopts method vitro recombination 31 strains of DNA shuffling to obtain from third hepatopath's serum, make up HVR1 simulated series phage display library, affine screening by anti-HVR1 polyclonal antibody, obtain the HVR1 mimic peptide and the encoding gene thereof of eight extensive cross reactivities, its reactivity is brought up to 53.3%-80% from original 46.7%-66.7%.The highest HVR1 simulating peptide of two strain reactivities is SEQ NO:2 (80%) and SEQ NO:4 (76.7%), and pointing out them may be important immunogenic peptide section, and its sequence may be to cause its extensive reactive reason with common recognition sequence height homology.On this basis, can pass through two or more sequence tandem expression (amalgamation and expression), constitute multi-epitope antigen (fusion rotein), further improve reactivity.Simultaneously, prepare antibody, observe ability of antibody neutralization (capturing) virus, lay the first stone for further in body, inducing the extensive reactive corresponding antibodies of generation with accordingly synthetic peptide or expression product.
Description of drawings
The basic principle schematic of Fig. 1 .DNA shuffling (molecule go down to posterity technology)
Fig. 2. the agarose gel electrophoresis result of original HVR1 fragment PCR amplified production.
1 is PCR Marker; 2 for DNase I digestion after there is not the primer PCR amplified fragments; 3 is the Auele Specific Primer pcr amplified fragment; 4 negative contrasts; The original HVR1 fragment of 5-11 for from the pGEMT-E plasmid, amplifying.
Embodiment
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.
Embodiment 1:DNA shuffling preparation simulation HVR1 fragment
This research adopts primer HCp7, HCp8 pcr amplification from the pGEMT-E plasmid (will increase from hepatitis C patients serum and obtain HCV tunicle district eDNA fragment insertion pGEM-T carrier (Promega company)) of reorganization to obtain 31 HVR1cDNA sequences, digest with DNase I behind the purifying, get 10 μ l digestion products, 2% agarose gel electrophoresis, be extremely light Smear shape, after no primer annealing extends, use again with a pair of primer and carry out pcr amplification, obtain the simulation HVR1 fragment identical with original length.Experimental result is seen Fig. 2.1 is PCRMarker among Fig. 2; 2 for DNase I digestion after there is not the primer PCR amplified fragments; 3 is the Auele Specific Primer pcr amplified fragment; 4 negative contrasts; The original HVR1 fragment of 5-11 for from the pGEMT-E plasmid, amplifying.
HCp7：5’ATAC
GGCCCAGCCGGCCATGGCCGCCGTTGACGGG 3’
Sfi I
HCp8：5’CATTGAAT
GCGGCCGCGTTTACAAGCTG 3’
Not I
The structure of embodiment 2:HVR1 simulating peptide phage display library
The HVR1 fragment that regains is cloned between the Sfi I and Not I site of pCANTAB 5E carrier (Pharmacia company), make it to be blended in 5 ' end of main coating protein (pIII) gene of M13 phage, the connection product desalts behind the purifying, electricity transformed competence colibacillus intestinal bacteria XLl-blue (Stratagene company), original storehouse size is 1.96 * 10
6For quality and the complexity of verifying this HVR1 library, 10 clones of our picked at random evaluation of checking order.The result shows that the HVR1 sequence of 10 clone's insertions is all inequality, therefore thinks that there is higher complexity in constructed library.
After the phage library amplification, behind polyoxyethylene glycol (PEG8000) deposition and purification, precipitation is resuspended in 5ml TBSB.Get 10 μ l dilution back titration, concentration is 1.46 * 10
12Cfu/ml.
The biological screening in embodiment 3:HVR1 simulating peptide storehouse
As mentioned before, the four kinds of DHFR-HVR1 fusion roteins (SH1b, BJ1b, SD1b, SD2a) at expression in escherichia coli are respectively 66.7% (20/30), 60% (18/30), 53.3% (16/30) and 46.7% (14/30) with the combination rate that resists the positive third hepatopathy human serum of a HCV.Select and four four parts of HCV infected person anteserums that the HVR1 fusion rotein all can react, successively affine screening is carried out in the HVR1 library.For the reactivity of further enhancing simulating peptide with different HVR1 antibody, the phage after we adopt different serum to enrichment carries out second and takes turns affine screening, and with healthy blood donor's serum in contrast, accumulation rate is by 10 of the first round
-7To 10 of four-wheel
-3, improved 10
4Doubly (table 1).
| Round of panning | phage applied | phage eluted | |
| 1 2 3 4 | 8.8×10 10 5.3×10 10 2.9×10 10 2.5×10 10 | 3.0×10 4 1.3×10 6 3.9×10 6 4.0×10 7 | 3.4×10 -7 2.4×10 -5 1.3×10 -4 1.6×10 -3 |
The biological screening result of table 1 HVR1 phage display library
The evaluation of embodiment 4:HVR1 simulating peptide
Behind the four-wheel biological screening, select 8 different phage clones, respectively it is increased.8 expressed simulation Toplink are extensively discerned by the HVR1 antibody in HCV the infected's blood.Detect the phage clone of purifying and the combination rate of whose anti-HCV positive serum with the ELISA method, the reactivity of 8 clones and 30 parts of serum is respectively 53.3%-80.0% (table 2) as a result.Wherein, No. 1 cloning reaction is the highest.The measurement result of inserting the simulating peptide dna sequence dna is shown the none coding HVR1 peptide section identical among the selected clone with the protovirus strain.
30 parts of serum are different with the reactivity of 8 HVR1 simulating peptide (sequence sees Table 3), can there be 10 parts with the serum that all 8 phage clones react, can 12 parts of serum be arranged with 5-7 clone reacts, there are 4 parts with the serum of 1-4 cloning reaction, not with the 4 parts of serum that have of arbitrary phage clone reaction.Concrete experimental result sees Table 2.
Table 2 is depicted as the reactivity of 8 strain HVR1 simulating peptide and 30 part of third hepatopath's serum.The simulating peptide title marks the top in each post.Every row left side is depicted as the numbering of every part of serum.Shown in the table every part of sample and the negative on average ratio of OD value.Each row bottom indicated 8 simulating peptide respectively with the reactivity of serum and total reactivity thereof.
Table 2:HCV HVR1 simulating peptide and hepatitis C patients serum reactivity measurement result
| Sequence | Aminoacid sequence | |
| 1 | | |
| 2 | | |
| 3 | | |
| 4 | | |
| 5 | STRVSGGGARPYHLGLHVPLYTWAISE |
| 6 | |
| 7 | |
| 8 | GTYTTGGAQGRATQGLASLFSRGSARK |
Table 3 hepatitis C virus envelope protein HVR1 mimic peptide aminoacid sequence table
All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
SEQUENCE LISTING
＜110〉Shanghai Inst. of Life Science, CAS
＜120〉hepatitis C virus envelope protein HVR1 mimic peptide, its encoding gene and purposes
<130>030811
<160>18
<170>PatentIn version 3.1
<210>1
<211>81
<212>DNA
＜213〉HCV HVR1 simulation gene
<220>
<221>CDS
<222>(1)..(81)
<223>
<400>1
gag acc tac gtg tcg ggg gga tcg gca gcc cgt aac gcc tat ggg ctc 48
Glu Thr Tyr Val Ser Gly Gly Ser Ala Ala Arg Asn Ala Tyr Gly Leu
1 5 10 15
acg tcc ttg ttc acg gtt ggg ccg gct cag aag 81
Thr Ser Leu Phe Thr Val Gly Pro Ala Gln Lys
20 25
<210>2
<211>27
<212>PRT
＜213〉HCV HVR1 simulation gene
<400>2
Glu Thr Tyr Val Ser Gly Gly Ser Ala Ala Arg Asn Ala Tyr Gly Leu
1 5 10 15
Thr Ser Leu Phe Thr Val Gly Pro Ala Gln Lys
20 25
<210>3
<211>81
<212>DNA
＜213〉HCV HVR1 simulation gene
<220>
<221>CDS
<222>(1)..(81)
<223>
<400>3
gag acc tac gtg acg ggg ggg gtg gca ggc agg act acc ctt ggg ttc 48
Glu Thr Tyr Val Thr Gly Gly Val Ala Gly Arg Thr Thr Leu Gly Phe
1 5 10 15
acg tcc ttg ttt acg cct ggg ccg tct cag 78
Thr Ser Leu Phe Thr Pro Gly Pro Ser Gln
20 25
<210>4
<211>26
<212>PRT
＜213〉HCV HVR1 simulation gene
<400>4
Glu Thr Tyr Val Thr Gly Gly Val Ala Gly Arg Thr Thr Leu Gly Phe
1 5 10 15
Thr Ser Leu Phe Thr Pro Gly Pro Ser Gln
20 25
<210>5
<211>81
<212>DNA
＜213〉HCV HVR1 simulation gene
<220>
<221>CDS
<222>(1)..(81)
<223>
<400>5
gag acc tac gtg acg ggg ggg atg gca ggc agg act acc ctt ggg ttc 48
Glu Thr Tyr Val Thr Gly Gly Met Ala Gly Arg Thr Thr Leu Gly Phe
1 5 10 l5
acg tcc ttg tct acg cct ggg ccg tct cag aag 81
Thr Ser Leu Ser Thr Pro Gly Pro Ser Gln Lys
20 25
<210>6
<211>27
<212>PRT
＜213〉HCV HVR1 simulation gene
<400>6
Glu Thr Tyr Val Thr Gly Gly Met Ala Gly Arg Thr Thr Leu Gly Phe
1 5 10 15
Thr Ser Leu Ser Thr Pro Gly Pro Ser Gln Lys
20 25
<210>7
<211>81
<212>DNA
＜213〉HCV HVR1 simulation gene
<220>
<221>CDS
<222>(1)..(81)
<223>
<400>7
aac acc cgc acg ata ggg ggg aca gca ggc tct acc gcc ttt aag ttc 48
Asn Thr Arg Thr Ile Gly Gly Thr Ala Gly Ser Thr Ala Phe Lys Phe
1 5 10 15
acg tcc ctc ttt acg tca ggg ccg act cag aaa 81
Thr Ser Leu Phe Thr Ser Gly Pro Thr Gln Lys
20 25
<210>8
<211>27
<212>PRT
＜213〉HCV HVR1 simulation gene
<400>8
Asn Thr Arg Thr Ile Gly Gly Thr Ala Gly Ser Thr Ala Phe Lys Phe
1 5 10 15
Thr Ser Leu Phe Thr Ser Gly Pro Thr Gln Lys
20 25
<210>9
<211>81
<212>DNA
＜213〉HCV HVR1 simulation gene
<220>
<221>CDS
<222>(1)..(81)
<223>
<400>9
agc aca cgt gtg tcg ggg ggg ggt gca agg cca tac cat ctg ggg ctt 48
Ser Thr Arg Val Ser Gly Gly Gly Ala Arg Pro Tyr His Leu Gly Leu
1 5 10 15
cac gtc cct ctt tac acc tgg gcc atc tca gaa 81
His Val Pro Leu Tyr Thr Trp Ala Ile Ser Glu
20 25
<210>10
<211>27
<212>PRT
＜213〉HCV HVR1 simulation gene
<400>10
Ser Thr Arg Val Ser Gly Gly Gly Ala Arg Pro Tyr His Leu Gly Leu
1 5 10 15
His Val Pro Leu Tyr Thr Trp Ala Ile Ser Glu
20 25
<210>11
<211>81
<212>DNA
＜213〉HCV HVR1 simulation gene
<220>
<221>CDS
<222>(1)..(81)
<223>
<400>11
gac aca tat gtg acg ggg ggg gcg cag ggc cgt acc acc cgg ggc ttc 48
Asp Thr Tyr Val Thr Gly Gly Ala Gln Gly Arg Thr Thr Arg Gly Phe
1 5 10 15
gcg ggc ctc ttt aca tct ggg cca gct cag aaa 81
Ala Gly Leu Phe Thr Ser Gly Pro Ala Gln Lys
20 25
<210>12
<211>27
<212>PRT
＜213〉HCV HVR1 simulation gene
<400>12
Asp Thr Tyr Val Thr Gly Gly Ala Gln Gly Arg Thr Thr Arg Gly Phe
1 5 10 15
Ala Gly Leu Phe Thr Ser Gly Pro Ala Gln Lys
20 25
<210>13
<211>81
<212>DNA
＜213〉HCV HVR1 simulation gene
<220>
<221>CDS
<222>(1)..(81)
<223>
<400>13
agc acc cgt gtg acg ggg gag gtg caa ggc cac tcc ctc cgg ggc ctc 48
Ser Thr Arg Val Thr Gly Glu Val Gln Gly His Ser Leu Arg Gly Leu
1 5 10 15
acg tcc ttc ttt gca tct ggg cca gct cag agg 81
Thr Ser Phe Phe Ala Ser Gly Pro Ala Gln Arg
20 25
<210>14
<211>27
<212>PRT
＜213〉HCV HVR1 simulation gene
<400>14
Ser Thr Arg Val Thr Gly Glu Val Gln Gly His Ser Leu Arg Gly Leu
1 5 10 15
Thr Ser Phe Phe Ala Ser Gly Pro Ala Gln Arg
20 25
<210>15
<211>81
<212>DNA
＜213〉HCV HVR1 simulation gene
<220>
<221>CDS
<222>(1)..(81)
<223>
<400>15
ggc acc tat acg acg ggg ggg gcg cag ggc cgt gcc acc cag ggc ctc 48
Gly Thr Tyr Thr Thr Gly Gly Ala Gln Gly Arg Ala Thr Gln Gly Leu
1 5 10 15
gcg tcc ctc ttt tca cgt ggg tcg gct cgg aaa 81
Ala Ser Leu Phe Ser Arg Gly Ser Ala Arg Lys
20 25
<210>16
<211>27
<212>PRT
＜213〉HCV HVR1 simulation gene
<400>16
Gly Thr Tyr Thr Thr Gly Gly Ala Gln Gly Arg Ala Thr Gln Gly Leu
1 5 10 15
Ala Ser Leu Phe Ser Arg Gly Ser Ala Arg Lys
20 25
<210>17
<211>35
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
<222>(1)..(35)
＜223〉primer
<400>17
atacggccca gccggccatg gccgccgttg acggg 35
<210>18
<211>28
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
<222>(1)..(28)
＜223〉primer
<400>18
cattgaatgc ggccgcgttt acaagctg 28
Claims (8)
1. a class hepatitis C virus envelope protein HVR1 mimic peptide is characterized in that this mimic peptide is arbitrary aminoacid sequence shown in the SEQ NO:2,4,6,8,10,12,14 or 16.
2. class hepatitis C virus envelope protein HVR1 simulation gene is characterized in that, the described mimic peptide of this simulation genes encoding claim 1.
3. simulation gene as claimed in claim 2 is characterized in that this simulation gene is an arbitrary nucleotide sequence shown in the SEQNO:1,3,5,7,9,11,13 or 15.
4. the application of mimic peptide as claimed in claim 1 is characterized in that the application of described mimic peptide in the medicine of preparation detection hepatitis C.
5. a carrier is characterized in that, it contains claim 2 or 3 described simulation genes.
6. a genetically engineered host cell is characterized in that, the host cell that it is transformed or transduce by the described carrier of claim 5.
7. preparation method who prepares hepatitis C virus envelope protein HVR1 mimic peptide is characterized in that this method comprises:
(a) be fit to express under the condition of hepatitis C virus envelope protein HVR1 mimic peptide the described host cell of cultivation claim 6:
(b) from culture, isolate hepatitis C virus envelope protein HVR1 mimic peptide.
8. a detection kit is characterized in that, it contains the described mimic peptide of claim 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB031505333A CN1305898C (en) | 2003-08-22 | 2003-08-22 | Stimulated polypeptide, its coding genes and use of capsule protein HVR1 of hepatitis C virus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB031505333A CN1305898C (en) | 2003-08-22 | 2003-08-22 | Stimulated polypeptide, its coding genes and use of capsule protein HVR1 of hepatitis C virus |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1583787A CN1583787A (en) | 2005-02-23 |
| CN1305898C true CN1305898C (en) | 2007-03-21 |
Family
ID=34597573
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB031505333A Expired - Fee Related CN1305898C (en) | 2003-08-22 | 2003-08-22 | Stimulated polypeptide, its coding genes and use of capsule protein HVR1 of hepatitis C virus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1305898C (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106011089A (en) * | 2016-05-18 | 2016-10-12 | 中国人民解放军第四军医大学 | Preparation and application of chimeric VLPs (virus-like particles) expressing multiple series-connected HCV (hepatitis C virus) neutralization antigenic epitopes |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6110465A (en) * | 1995-06-07 | 2000-08-29 | The United States Of America As Represented By The Department Of Health And Human Services | Nucleotide and deduced amino acid sequences of hypervariable region 1 of the envelope 2 gene of isolates of hepatitis C virus and the use of reagents derived from these hypervariable sequences in diagnostic methods and vaccines |
| CN1274387A (en) * | 1998-05-19 | 2000-11-22 | P·安杰莱蒂分子生物学研究所 | HCVE mimotopes of hypervariable region 1 and uses |
-
2003
- 2003-08-22 CN CNB031505333A patent/CN1305898C/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6110465A (en) * | 1995-06-07 | 2000-08-29 | The United States Of America As Represented By The Department Of Health And Human Services | Nucleotide and deduced amino acid sequences of hypervariable region 1 of the envelope 2 gene of isolates of hepatitis C virus and the use of reagents derived from these hypervariable sequences in diagnostic methods and vaccines |
| CN1274387A (en) * | 1998-05-19 | 2000-11-22 | P·安杰莱蒂分子生物学研究所 | HCVE mimotopes of hypervariable region 1 and uses |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1583787A (en) | 2005-02-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1178956C (en) | Cancer antigens based on tumor suppressor gene WT1 product | |
| CN1118572A (en) | HLA-A2.1 combination peptide and application thereof | |
| CN1492923A (en) | Attenuated live vaccine | |
| CN1136778A (en) | Sperm antigen corresponding to sperm zone binding protein autoantigenic epitope | |
| CN101045156A (en) | Special target medicine and its use | |
| CN101054582A (en) | A-type kreotoxin receptor combination region Hc, coding protein and application thereof | |
| CN1738833A (en) | HCV vaccine | |
| CN1249781A (en) | Epitopes of protein pre-M/M of dengue virus, synthetic peptides | |
| CN101062952A (en) | Fusion protein comprised of human serum and interferon and its coding gene and application | |
| CN1255540C (en) | Vaccine-induced hepatitis B viral strain and uses thereof | |
| CN1733798A (en) | Hepatitis B virus surface L protein related peptide | |
| CN1874787A (en) | Composition for the prophylaxis/treatment of HBV infections and HBV-mediated diseases | |
| CN1948333A (en) | New hPEBP4 protein source HLA-A2 limiting epi-polypeptide and its application | |
| CN1803195A (en) | Immunity regulating type Eimeria tenella DNA vaccine for preventing and treating chicken coccidiosis | |
| CN1274387A (en) | HCVE mimotopes of hypervariable region 1 and uses | |
| CN1305898C (en) | Stimulated polypeptide, its coding genes and use of capsule protein HVR1 of hepatitis C virus | |
| CN1570115A (en) | Optimized SARS coronavirus spike protein gene | |
| CN1555415A (en) | Synthetic HCV envelope proteins and their use for vaccination | |
| CN1737144A (en) | Composite multiple epitope bivalent nucleic acid vaccine construction for foot-and-mouth disease | |
| CN1258317A (en) | Process for expression of genes of dengue viruses | |
| CN1030093A (en) | The production of peptide | |
| CN1249240C (en) | Expression vector pBVTB, its construction method and use in HCV vaccin research | |
| CN1159333C (en) | Trichina antigen gene Ts 87 and use thereof | |
| CN1631438A (en) | 0157 bacterium gene engineering multivalence subunit vaccine of human and sensitive animals and its preparing method | |
| CN1462636A (en) | Vaccine of recombined albumen for preventing and treating infection of human C type hepatitis virus and its usage |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20070321 Termination date: 20130822 |