CN1302869A - Polypeptide-NADP hydrogenase subunit 50 and polynucleotide for coding it - Google Patents
Polypeptide-NADP hydrogenase subunit 50 and polynucleotide for coding it Download PDFInfo
- Publication number
- CN1302869A CN1302869A CN 99119893 CN99119893A CN1302869A CN 1302869 A CN1302869 A CN 1302869A CN 99119893 CN99119893 CN 99119893 CN 99119893 A CN99119893 A CN 99119893A CN 1302869 A CN1302869 A CN 1302869A
- Authority
- CN
- China
- Prior art keywords
- polypeptide
- polynucleotide
- nadp
- sequence
- hydrogenase
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0067—Oxidoreductases (1.) acting on hydrogen as donor (1.12)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Abstract
A new polypeptide-NADP hydrogenase subunit 50, the polynucleotide for encoding it, the process for preparing said polypeptide by DNA recombination, the application of said polypeptide to treating diseases (cancer, HIV infection, etc), the antagonist against the said polypeptide and its medical action, and the usage of said polynucleotide are disclosed.
Description
The invention belongs to biological technical field, specifically, the invention describes a kind of new polypeptide--NADP hydrogenase subunit 50, and the polynucleotide sequence of this polypeptide of encoding.The invention still further relates to the preparation method and the application of these polynucleotide and polypeptide.
Hydrogenase (Hyds) is iron atom-sulphur enzyme, and it can act on the oxidation of hydrogen atom, and can act on the reduction of proton during the generation of hydrogen atom.Hyds plays an important role in the energy metabolism of the sulphate reducing bacteria of desulfuration Vibrio, and the bacterium of desulfuration Vibrio utilizes the sulphate complex of oxidation as their final electron acceptors (Widdel, F.et a1., 1993).The bacterium available hydrogen atom of many desulfuration Vibrios is as they main energy derives, and the oxidation of hydrogen atom relates to the electronics that passes through film and passes on the generation (Brandis, A.et al., 1981) of moving energy with proton.The bacterium of desulfuration Vibrio can grow in lactic acid salt or acetone, and utilizes their to produce hydrogen atom in the oxidation of kytoplasm, and hydrogen atom may play regulating and controlling effect in electronics passes on the circulation of redoxomorphic stage of chain or hydrogen atom, and the latter can drive the synthetic of ATP.Nicotinamide adenine dinucleotide phosphoric acid (NADP)-reduction hydrogenase is a kind of Hyd (Malki, S.etal., 1995) that finds in sulphate reducing bacteria.
The NADP-hydrogenase is by the hndABCD coded by said gene of desulfuration Vibrio fructosovorans, the hndABCD gene has four open reading frame sequences h ndA, hndB, hndC, hndD on same direction, they guide by the potential ribosome bind site, 513,378,1434,1749 base pairs are respectively arranged, and their intergenic region is respectively 38,24,19 base pairs, four region height homologies on four zones and the hndA gene order are arranged, their all encode big subunits of [Fe] Hyd on the hndD gene order.
The HndA proteins encoded is 18.8KD, and one [2Fe-2S] bunch arranged, and it is piled into by the conservative halfcystine of distance C end 98,103,139,143.HndA albumen has 21% homology, 21% homology is arranged, with the 24KD subunit of ox plastosome complex 24% homology is arranged with the N end of NAD-reduction hydrogenase HoxF subunit with the 25KD subunit of NADH hydrogenase Class1.
The HndC proteins encoded is 51.7KD, and there is vitamin B2 phosphate (FMN) binding site in the zone of being rich in glycine on amino acid/11 70-218, on amino acid 54-91 NAD is arranged
+Binding site also relates to the formation of ADP bag, sequence domains CysXXCysXXCys on amino acid 348-354 and 392 halfcystines can be in conjunction with one [4Fe-4S] bunch, and two CysXXCysXXCysXXXCys structural domains forming at eight halfcystines of C end can be in conjunction with two [4Fe-4S] bunch.The C end of HndC and NAD-reduction hydrogenase HoxF subunit has 37% homology, with the 51KD subunit of ox plastosome complex 33% homology is arranged.Structural domain on HndA and the hndC dimer has formed NAD
+Reductase activity.
The HndD proteins encoded is 63.6KD, and the N of HndD end has 117 amino acid, comprises seven conservative halfcystines, and it can be in conjunction with one [2Fe-2S] bunch, one [4Fe-4S] bunch; Sequence subsequently comprises eight conservative halfcystines by 118-239, and its distinctive domain C ysXXCysXXCysXXXCys can be in conjunction with two [4Fe-4S] bunch; Five paired cysteine residues are arranged, above hydrogen atom activation bunch is located on sequence 24 0-520.The big subunit (hndA) of monomer [Fe] Hyd (hndC) of the Hyd I of HndD and fusobacterium pasteurianum, desulfuration Vibrio vulgarisHildenborough, dimer [Fe] Hyd respectively has 40%, 42%, 48% homology (Malki, S.et al., 1995).
The NADP-hydrogenase can reduce NAD when hydrogen atom exists
+, hndA and hndC reduce subunit as NAD-, and hndD is as hydrogenase subunit.The NAD of no hydrogen atom mediation
+Reductive action also takes place but speed is low.Because NADPH
2Be used in anabolism, desulfuration Vibrio fructosovorans can utilize the reduction energy of hydrogen atom to come synthetic biological molecule single-mindedly.
The NADP-hydrogenase is active high when desulfuration Vibrio fructosovorans fructose exponential phase of growth is sufficient, active decline (Gilles de Luca, et al., 1999) when carbon atom and energy concentration are restricted.
Because NADP-reduction hydrogenase gene family has following characteristic structural domain-HndA albumen one [2Fe-2S] bunch is arranged; HndC albumen has a FMN binding site in the zone of being rich in glycine, NAD is arranged
+Binding site also relates to the formation of ADP bag, has the characteristic domain C ysXXCysXXCys can be in conjunction with one [4Fe-4S] bunch, and two CysXXCysXXCysXXXCys structural domains forming at eight halfcystines of C end can be in conjunction with two [4Fe-4S] bunch; The proteic N end of HndD comprises seven conservative halfcystines, it can be in conjunction with one [2Fe-2S] bunch, one [4Fe-4S] bunch, sequence subsequently comprises eight conservative halfcystines, its distinctive domain C ysXXCysXXCysXXXCys can be in conjunction with two [4Fe-4S] bunch, and follow-up sequence has hydrogen atom activation bunch.And human polypeptides gene of the present invention has sequence and the protein expression of height similar in appearance to the HndD gene, so think that new gene of the present invention is the gene of a coding NADP-reduction hydrogenase gene family, names to be people NADP-reduction hydrogenase subunit 50.And infer that with this it has the similar biological function of NADP-reduction hydrogenase gene family.
The polynucleotide of coding people NADP-reduction hydrogenase subunit 50, and coded people NADP-reduction hydrogenase subunit 50 be found to be the differentiation of research cell under normal and pathological conditions, the physiological and biochemical procedure of propagation provides a kind of method, also comprises that with the disease that the disorder of cytodifferentiation propagation causes cancer provides a kind of new way for diagnosis, treatment.
An object of the present invention is to provide isolating new polypeptide--NADP hydrogenase subunit 50 with and fragment, analogue and derivative.
Another object of the present invention provides the polynucleotide of this polypeptide of coding.
Another object of the present invention provides the recombinant vectors of the polynucleotide that contain coding NADP hydrogenase subunit 50.
Another object of the present invention provides the genetically engineered host cell of the polynucleotide that contain coding NADP hydrogenase subunit 50.
Another object of the present invention provides the method for producing NADP hydrogenase subunit 50.
Another object of the present invention provides at polypeptide of the present invention--the antibody of NADP hydrogenase subunit 50.
Another object of the present invention has provided at polypeptide of the present invention--simulated compound, antagonist, agonist, the inhibitor of NADP hydrogenase subunit 50.
Another object of the present invention provides the method for the unusual relevant disease of diagnoses and treatment and NADP hydrogenase subunit 50.
In a first aspect of the present invention, novel isolated NADP hydrogenase subunit 50 is provided, this polypeptide is the people source, and it comprises: have the polypeptide of SEQ ID NO:2 aminoacid sequence or its conservative property variation polypeptide or its active fragments or its reactive derivative, analogue.Preferably, this polypeptide is the polypeptide with SEQ ID NO:2 aminoacid sequence.
In a second aspect of the present invention, the polynucleotide of isolating these polypeptide of coding are provided, these polynucleotide comprise a nucleotide sequence, and this nucleotide sequence is shown at least 70% homogeny with a kind of nucleotides sequence that is selected from down group: (a) polynucleotide of the above-mentioned NADP hydrogenase subunit 50 of coding; (b) with polynucleotide (a) complementary polynucleotide.Preferably, this polynucleotide encoding has the polypeptide of aminoacid sequence shown in the SEQ ID NO:2.More preferably, the sequence of these polynucleotide is be selected from down group a kind of: the sequence that (a) has 105-1475 position among the SEQ ID NO:1; (b) has the sequence of 1-1577 position among the SEQ ID NO:1.
In a third aspect of the present invention, the carrier that contains above-mentioned polynucleotide is provided, and has been transformed or host cell of transduceing or the host cell that is directly transformed or transduce by above-mentioned polynucleotide by this carrier.
Others of the present invention are because disclosing of the technology of this paper is conspicuous to those skilled in the art.
As used herein, " isolating " are meant that material separates (if natural substance, primal environment promptly is a natural surroundings) from its primal environment.Do not have separation and purification as polynucleotide under the native state in the active somatic cell and polypeptide, but same polynucleotide or polypeptide as from native state with in other materials that exist separately, then for separation and purification.
As used herein, " isolating NADP hydrogenase subunit 50 " is meant that NADP hydrogenase subunit 50 is substantially free of natural relative other albumen, lipid, carbohydrate or other material.Those skilled in the art can use the purified technology of protein purifying NADP hydrogenase subunit 50 of standard.Basically pure polypeptide can produce single master tape on non-reduced polyacrylamide gel.The purity of NADP hydrogenase subunit 50 polypeptide can be used amino acid sequence analysis.
The invention provides a kind of new polypeptide--NADP hydrogenase subunit 50, it is made up of the aminoacid sequence shown in the SEQ ID NO:2 basically.Polypeptide of the present invention can be recombinant polypeptide, natural polypeptides, synthetic polypeptide, preferred recombinant polypeptide.Polypeptide of the present invention can be the product of natural purifying, or the product of chemosynthesis, or uses recombinant technology to produce from protokaryon or eucaryon host (for example, bacterium, yeast, higher plant, insect and mammalian cell).The host used according to the recombinant production scheme, polypeptide of the present invention can be glycosylated, maybe can be nonglycosylated.Polypeptide of the present invention also can comprise or not comprise initial methionine residues.
The present invention also comprises fragment, derivative and the analogue of NADP hydrogenase subunit 50.As used herein, term " fragment ", " derivative " and " analogue " are meant biological function or the active polypeptide that keeps NADP hydrogenase subunit of the present invention 50 identical basically.The fragment of polypeptide of the present invention, derivative or analogue can be: (I) is a kind of like this, wherein one or more amino-acid residues are replaced by conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the amino acid that replaces can be also can not encoded by genetic codon; Perhaps (II) is a kind of like this, and certain group on wherein one or more amino-acid residues is replaced by other group and comprises substituting group; Perhaps (III) is a kind of like this, and wherein mature polypeptide and another kind of compound (such as the compound that prolongs the polypeptide transformation period, for example polyoxyethylene glycol) merge; Perhaps (IV) is a kind of like this, wherein additional aminoacid sequence is integrated into mature polypeptide and the peptide sequence that forms (as leader sequence or secretion sequence or be used for the sequence or the proteinogen sequence of this polypeptide of purifying) by the elaboration of this paper, such fragment, derivative and analogue are considered within those skilled in the art's ken.
The invention provides isolating nucleic acid (polynucleotide), substantially the polynucleotide that have a polypeptide of SEQ ID NO:2 aminoacid sequence by coding are formed.Polynucleotide sequence of the present invention comprises the nucleotide sequence of SEQ ID NO:1.Polynucleotide of the present invention are to find from the cDNA library of people's fetal brain tissue.The polynucleotide sequence total length that it comprises is 1577 bases, its open reading frame (105-1475) 456 amino acid of having encoded.Find relatively that according to amino acid sequence homologous this polypeptide and NADP-hydrogenase subunit D have 30% homology, deducibility goes out this NADP hydrogenase subunit 50 and has the similar 26S Proteasome Structure and Function of NADP-hydrogenase subunit D.
Polynucleotide of the present invention can be dna form or rna form.Dna form comprises the DNA of cDNA, genomic dna or synthetic.DNA can be strand or double-stranded.DNA can be coding strand or noncoding strand.The coding region sequence of encoding mature polypeptide can be identical with the coding region sequence shown in the SEQ ID NO:1 or the varient of degeneracy.As used herein, " varient of degeneracy " are meant that in the present invention coding has protein or the polypeptide of SEQ ID NO:2, but with the differentiated nucleotide sequence of coding region sequence shown in the SEQ ID NO:1.
The polynucleotide of the mature polypeptide of coding SEQ ID NO:2 comprise: the encoding sequence that has only mature polypeptide; The encoding sequence of mature polypeptide and various additional code sequence; Encoding sequence of mature polypeptide (with optional additional code sequence) and non-coding sequence.
Term " polynucleotide of coded polypeptide " is meant polynucleotide that comprise this polypeptide of encoding and the polynucleotide that comprise additional code and/or non-coding sequence.
The invention still further relates to the varient of foregoing description polynucleotide, its coding has the polypeptide of identical aminoacid sequence or segment, analogue and the derivative of polypeptide with the present invention.The varient of these polynucleotide can be the allelic variant of natural generation or the varient that non-natural takes place.These nucleotide diversity bodies comprise and replace varient, deletion mutation body and insert varient.As known in the art, allelic variant is the replacement form of polynucleotide, and it may be replacement, disappearance or the insertion of one or more Nucleotide, but can be from not changing the function of its encoded polypeptides in fact.
The invention still further relates to and the polynucleotide (have at least 50% between two sequences, preferably have 70% homogeny) of sequence hybridization described above.The present invention be more particularly directed under stringent condition and the interfertile polynucleotide of polynucleotide of the present invention.In the present invention, " stringent condition " is meant: (1) than hybridization under low ionic strength and the comparatively high temps and wash-out, as 0.2 * SSC, and 0.1%SDS, 60 ℃; Or (2) hybridization the time adds and to use denaturing agent, as 50% (v/v) methane amide, 0.1% calf serum/0.1%Ficoll, 42 ℃ etc.; Or (3) only at the homogeny between the two sequences at least more than 95%, be more preferably 97% and just hybridize when above.And the polypeptide of interfertile polynucleotide encoding has identical biological function and activity with the mature polypeptide shown in the SEQ ID NO:2.
The invention still further relates to nucleic acid fragment with sequence hybridization described above.As used herein, " nucleic acid fragment " length contain 10 Nucleotide at least, better be 20-30 Nucleotide at least, be more preferably 50-60 Nucleotide at least, preferably more than at least 100 Nucleotide.Nucleic acid fragment also can be used for the amplification technique (as PCR) of nucleic acid to determine and/or to separate the polynucleotide of coding NADP hydrogenase subunit 50.
Polypeptide among the present invention and polynucleotide preferably provide with isolating form, more preferably are purified to homogeneous.
The special polynucleotide sequence of coding NADP hydrogenase subunit 50 of the present invention can obtain with several different methods.For example, separate polynucleotide with hybridization technique well known in the art.These technology including, but not limited to: 1) with probe and genome or the hybridization of cDNA library to detect homologous polynucleotide sequence and 2) antibody screening of expression library to be to detect the polynucleotide passage of the clone with common structure feature.
Sequence dna fragment of the present invention also can obtain with following method: 1) separate double chain DNA sequence from genomic dna; 2) the chemical synthesising DNA sequence is to obtain the double-stranded DNA of described polypeptide.
In the above-mentioned method of mentioning, isolation of genomic DNA is least commonly used.The direct chemical of dna sequence dna is synthetic to be the method for often selecting for use.The more frequent method of selecting for use is the separation of cDNA sequence.The standard method that separates interested cDNA is from the donorcells separating mRNA of this gene of high expression level and carries out reverse transcription, forms plasmid or phage cDNA library.Extract the existing multiple proven technique of method of mRNA, test kit also can obtain (Qiagene) from commercial channels.And the construction cDNA library also is usual method (Sambrook, et al., MolecularCloning, A Laboratory Manual, Cold Spring Harbor Laboratory.New York, 1989).Also can obtain the cDNA library of commercial offers, as the different cDNA library of Clontech company.When being used in combination the polymeric enzyme reaction technology, even few expression product also can be cloned.
Available ordinary method is screened gene of the present invention from these cDNA libraries.These methods include, but is not limited to: (1) DNA-DNA or DNA-RNA hybridization; (2) appearance of marker gene function or forfeiture; (3) level of the transcript of mensuration NADP hydrogenase subunit 50; (4), detect the protein product of genetic expression by immunological technique or mensuration biologic activity.Aforesaid method can singly be used, but also several different methods combined utilization.
In (1) kind method, hybridizing used probe is and any a part of homology of polynucleotide of the present invention that at least 10 Nucleotide of its length better are at least 30 Nucleotide, are more preferably at least 50 Nucleotide, preferably at least 100 Nucleotide.In addition, within 2000 Nucleotide, preferable is within 1000 Nucleotide to the length of probe usually.Probe used herein is the dna sequence dna of chemosynthesis on the basis of gene order information of the present invention normally.Gene of the present invention itself or fragment are certainly as probe.The mark of dna probe can be used radio isotope, fluorescein or enzyme (as alkaline phosphatase) etc.
In (4) kind method, detect the protein product of NADP hydrogenase subunit 50 genetic expressions and can use immunological technique such as Western blotting, radioimmunoprecipitation, enzyme-linked immunosorbent assay (ELISA) etc.
Use method (Saiki, the et al.Science1985 of round pcr DNA amplification/RNA; 230:1350-1354) be optimized for acquisition gene of the present invention.When particularly being difficult to from the library, obtain the cDNA of total length, can preferably use RACE method (the terminal rapid amplifying method of RACE-cDNA), the primer that is used for PCR can suitably be selected according to polynucleotide sequence information of the present invention disclosed herein, and available ordinary method is synthetic.Available ordinary method is as the DNA/RNA fragment by gel electrophoresis separation and purifying amplification.
The gene of the present invention that obtains as mentioned above, perhaps the polynucleotide sequence of various dna fragmentations etc. can with ordinary method such as dideoxy chain termination (Sanger et al.PNAS, 197 7,74:5463-5467) measure.This class polynucleotide sequence is measured also available commercial sequencing kit etc.In order to obtain the cDNA sequence of total length, order-checking need be carried out repeatedly.Sometimes need to measure a plurality of clones' cDNA sequence, just can be spliced into the cDNA sequence of total length.
The present invention also relates to comprise the carrier of polynucleotide of the present invention, and with carrier of the present invention or directly with the host cell of NADP hydrogenase subunit 50 encoding sequences through the genetically engineered generation, and the method that produces polypeptide of the present invention through recombinant technology.
Among the present invention, the polynucleotide sequence of coding NADP hydrogenase subunit 50 can be inserted in the carrier, contains the recombinant vectors of polynucleotide of the present invention with formation.Term " carrier " refers to that bacterial plasmid well known in the art, phage, yeast plasmid, vegetable cell virus, mammalian cell virus are as adenovirus, retrovirus or other carrier.The carrier of Shi Yonging includes but not limited in the present invention: and the expression vector based on the T7 promotor of in bacterium, expressing (Rosenberg, et al.Gene, 1987,56:125); The pMSXND expression vector of in mammalian cell, expressing (Lee and Nathans, J Bio Chem.263:3521,1988) and at the carrier that derives from baculovirus of expressed in insect cells.In a word, as long as can duplicate in host and stablize, any plasmid and carrier may be used to make up recombinant expression vector.A key character of expression vector is to contain replication origin, promotor, marker gene and translational control element usually.
Method well-known to those having ordinary skill in the art can be used to make up the dna sequence dna that contains coding NADP hydrogenase subunit 50 and the expression vector of suitable transcribing/translational control element.These methods comprise (Sambroook, et al.Molecular Cloning, aLaboratory Manual, cold Spring Harbor Laboratory.New York, 1989) such as extracorporeal recombinant DNA technology, DNA synthetic technology, the interior recombinant technologys of body.Described dna sequence dna can effectively be connected on the suitable promotor in the expression vector, and is synthetic to instruct mRNA.The representative example of these promotors has: colibacillary lac or trp promotor; The P of lambda particles phage
LPromotor; Eukaryotic promoter comprises LTRs and some other known may command gene expression promoter in prokaryotic cell prokaryocyte or eukaryotic cell or its virus of CMV immediate early promoter, HSV thymidine kinase promoter, early stage and late period SV40 promotor, retrovirus.Expression vector also comprises ribosome bind site that translation initiation is used and transcription terminator etc.Inserting enhancer sequence in carrier will make its transcribing in higher eucaryotic cells be enhanced.Enhanser is the cis acting factor that DNA expresses, and nearly 10 to 300 base pairs act on promotor transcribing with enhancing gene usually.Can for example be included in the SV40 enhanser of 100 to 270 base pairs of replication origin side in late period one, at the polyoma enhanser of replication origin side in late period one and adenovirus enhanser etc.
In addition, expression vector preferably comprises one or more selected markers, to be provided for selecting the phenotypic character of transformed host cells, cultivate Tetrahydrofolate dehydrogenase, neomycin resistance and the green fluorescent protein (GFP) of usefulness as eukaryotic cell, or be used for colibacillary tsiklomitsin or amicillin resistance etc.
Persons skilled in the art all know how to select appropriate carriers/transcriptional regulatory element (as promotor, enhanser etc.) and selected marker.
Among the present invention, the polynucleotide of coding NADP hydrogenase subunit 50 or the recombinant vectors that contains these polynucleotide can transform or transduce into host cell, contain the genetically engineered host cell of these polynucleotide or recombinant vectors with formation.Term " host cell " refers to prokaryotic cell prokaryocyte, as bacterial cell; Or eukaryotic cell such as low, as yeast cell; Or higher eucaryotic cells, as mammalian cell.Representative example has: intestinal bacteria, streptomyces; Bacterial cell such as Salmonella typhimurium; Fungal cell such as yeast; Vegetable cell; Insect cell such as fruit bat S2 or Sf9; Zooblast such as CHO, COS or Bowes melanoma cells etc.
Can carry out with routine techniques well known to those skilled in the art with dna sequence dna of the present invention or the recombinant vectors transformed host cell that contains described dna sequence dna.When the host was prokaryotic organism such as intestinal bacteria, the competent cell that can absorb DNA can be used CaCl in exponential growth after date results
2Method is handled, and used step is well-known in this area.Alternative is to use MgCl
2If desired, transforming also the method for available electroporation carries out.When the host is an eukaryote, can select following DNA transfection method for use: coprecipitation of calcium phosphate method, perhaps conventional mechanical method such as microinjection, electroporation, liposome packing etc.
By the recombinant DNA technology of routine, utilize polynucleotide sequence of the present invention to can be used to express or produce NADP hydrogenase subunit 50 (Science, 1984 of reorganization; 224:1431).In general following steps are arranged:
(1). with the polynucleotide (or varient) of coding of the present invention people NADP hydrogenase subunit 50, or with the recombinant expression vector that contains these polynucleotide proper host cell that transforms or transduce;
(2). in suitable medium, cultivate host cell;
(3). separation, protein purification from substratum or cell.
In step (2), according to used host cell, used substratum can be selected from various conventional substratum in the cultivation.Under the condition that is suitable for the host cell growth, cultivate.After host cell grows into suitable cell density, induce the promotor of selection with suitable method (as temperature transition or chemical induction), cell is cultivated for some time again.
In step (3), recombinant polypeptide can wrap and be expressed or be secreted into the extracellular in cell or on cytolemma.If desired, can utilize its physics, the separating by various separation methods with other characteristic and the albumen of purification of Recombinant of chemistry.These methods are well-known to those skilled in the art.These methods include, but are not limited to: conventional renaturation is handled, protein precipitant is handled (salt analysis method), centrifugal, the broken bacterium of infiltration, the combination of ultrasonication, super centrifugal, sieve chromatography (gel-filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography (LC) technology and these methods.
The antagonist of polypeptide of the present invention and this polypeptide, agonist and inhibitor can be directly used in disease treatment, for example, can treat malignant tumour, adrenal gland defect, tetter, all kinds of inflammation, HIV infection and immunological disease etc.
NADP-reduction hydrogenase plays an important role in the energy metabolism in bacterium, Mammals, and meaningful in biomolecules is synthetic.NADP-reduction hydrogenase is higher in cell index activity in vegetative period, active decline when carbon atom and energy concentration are restricted.
So the abnormal expression of people NADP-reduction hydrogenase subunit 50 of the present invention will produce various diseases especially energy metabolism and embryo's material in period dyssynthesis disease.These diseases include but not limited to:
The carbohydrate metabolism disease: glycogen stores up disease, galactosemia, heredity fructose intolerance, primary lactic acidosis
Abnormalities of sugar/lipid metabolism disease: fat boat acid oxidase obstacle, hypobetalipoproteinemia
Aminoacidopathy: pku, tyrosine metabolic deficiency disease such as the high junket base acidaemia of newborn infant's one property crossed, the subacute and chronic tyrosinemia of acute tyrosine, albinism, the sulfur-containing amino acid metabolic defect, the tryptophane metabolic defect, glycine metabolic defect, glutamic acid metabolism defective disease, the metabolic defect of ornithine cycle, the Histidine metabolic defect, Methionin metabolic defect, and other amino acid metabolism defective disease.
Grow disorders: congenital miscarriage, spina bifida, the cranium fissure, the brain bulging, the hole deformity of brain, congenital hydrocephalus, the aqueduct deformity, achondroplastic dwarf's disease, spondyloepiphyseal dysplasia disease, pseudocartilage underdevelopment disease, hypogenitalism, adrenal,congenital hyperplasia, epispadia, latent, congenital glaucoma or cataract, congenital little fissura palpebrae, retinal development is unusual, atrophia nervi optici congenita, congenital sensory nerve hearing loss, ulcuscuris, monster, the Williams syndromes, shellfish syndrome Weis two.
The present invention also provides SCREENED COMPOUND to identify the method that improves (agonist) or check the medicament of (antagonist) NADP hydrogenase subunit 50.Agonist improves NADP hydrogenase subunit 50 biological function such as stimulate cellular proliferation, and antagonist prevention disorder such as the various cancer relevant with cell hyperproliferation with treatment.For example, can in the presence of medicine, the film preparation of mammalian cell or expression NADP hydrogenase subunit 50 be cultivated with the NADP hydrogenase subunit 50 of mark.Measure the medicine raising then or check this interactional ability.
The antagonist of NADP hydrogenase subunit 50 comprises antibody, compound, acceptor disappearance thing and the analogue etc. that filter out.The antagonist of NADP hydrogenase subunit 50 can combine and eliminate its function with NADP hydrogenase subunit 50, or suppresses the generation of this polypeptide, or combines with the avtive spot of this polypeptide and to make this polypeptide can not bring into play biological function.
In screening during as the compound of antagonist, NADP hydrogenase subunit 50 can be added during bioanalysiss measure, determine to interactional influence between NADP hydrogenase subunit 50 and its acceptor whether compound is antagonist by measuring compound.With the same quadrat method of above-mentioned SCREENED COMPOUND, can filter out the acceptor disappearance thing and the analogue of antagonist action.Can be incorporated into the rondom polypeptide storehouse that solid formation forms by the various amino acid that may make up by screening with NADP hydrogenase subunit 50 bonded peptide molecules obtains.During screening, generally tackle NADP hydrogenase subunit 50 molecules and carry out mark.
The invention provides and use polypeptide, and fragment, derivative, analogue or their cell are as the method for antigen with production antibody.These antibody can be polyclonal antibody or monoclonal antibody.The present invention also provides the antibody at NADP hydrogenase subunit 50 antigenic determinants.These antibody include, but is not limited to: the fragment that polyclonal antibody, monoclonal antibody, chimeric antibody, single-chain antibody, Fab fragment and Fab expression library produce.
The method of the available NADP hydrogenase of the production of polyclonal antibody subunit 50 direct injection immune animals (as rabbit, mouse, rat etc.) obtains, and multiple adjuvant can be used for the enhancing immunity reaction, includes but not limited to freund's adjuvant etc.The technology of the monoclonal antibody of preparation NADP hydrogenase subunit 50 include but not limited to hybridoma technology (Kohler and Milstein.Nature, 1975,256:495-497), three knurl technology, people B-quadroma technology, EBV-hybridoma technology etc.With the variable region bonded chimeric antibody in human constant region and inhuman source can with existing technology production (Morrison et al, PNAS, 1985,81:6851).And the technology of existing manufacture order chain antibody (U.S.Pat No.4946778) also can be used for producing the single-chain antibody of anti-NADP hydrogenase subunit 50.
The antibody of anti-NADP hydrogenase subunit 50 can be used in the immunohistochemistry technology, detects the NADP hydrogenase subunit 50 in the biopsy specimen.
With the also available labelled with radioisotope of NADP hydrogenase subunit 50 bonded monoclonal antibodies, inject in the body and can follow the tracks of its position and distribution.This radiolabeled antibody can be used as a kind of atraumatic diagnostic method and is used for the location of tumour cell and has judged whether transfer.
Antibody also can be used for designing the immunotoxin at a certain privileged sites in the body.As the monoclonal antibody of NADP hydrogenase subunit 50 high-affinities can with bacterium or plant poison (as diphtheria toxin, ricin, abrine etc.) covalent attachment.A kind of usual method is with sulfydryl linking agent such as SPDP, attacks the amino of antibody, by the exchange of disulfide linkage, toxin is incorporated on the antibody, and this hybrid antibody can be used for killing NADP hydrogenase subunit 50 positive cells.
The disease that antibody among the present invention can be used for treating or prevention and NADP hydrogenase subunit 50 are relevant.The antibody that gives suitable dosage can stimulate or block the generation or the activity of NADP hydrogenase subunit 50.
The invention still further relates to the diagnostic testing process of quantitative and detection and localization NADP hydrogenase subunit 50 levels.These tests are known in the art, and comprise that FISH measures and radioimmunoassay.NADP hydrogenase subunit 50 levels that detected in the test can be with laying down a definition the importance of NADP hydrogenase subunit 50 in various diseases and be used to the disease of diagnosing NADP hydrogenase subunit 50 to work.
Polypeptide of the present invention also can be used as the peptide spectrum analysis, for example, the polypeptide available physical, chemistry or enzyme carry out the specificity cutting, and carries out the two-dimentional or three-dimensional gel electrophoresis analysis of one dimension, be more preferably and carry out mass spectroscopy.
The polynucleotide of coding NADP hydrogenase subunit 50 also can be used for multiple therapeutic purpose.Gene therapy technology can be used for treating because cell proliferation, growth or the metabolic disturbance due to the nothing expression of NADP hydrogenase subunit 50 or the unusual/non-activity expression.The gene therapy vector (as virus vector) of reorganization can be designed for the NADP hydrogenase subunit 50 of expressing variation, to suppress endogenic NADP hydrogenase subunit 50 activity.For example, a kind of NADP hydrogenase subunit 50 of variation can be the NADP hydrogenase subunit 50 that shortens, lacked signal conduction function territory, though can combine with the substrate in downstream, lacks signaling activity.Therefore the gene therapy vector of reorganization can be used for treating the disease of 50 expression of NADP hydrogenase subunit or active caused by abnormal.Deriving from viral expression vector such as retrovirus, adenovirus, adeno-associated virus (AAV), hsv, parvovirus etc. can be used for the polynucleotide of coding NADP hydrogenase subunit 50 are transferred in the cell.The method of recombinant viral vector that structure carries the polynucleotide of coding NADP hydrogenase subunit 50 be found in existing document (Sambrook, etal.).The polynucleotide of reorganization coding NADP hydrogenase subunit 50 can be packaged in the liposome and be transferred in the cell in addition.
Polynucleotide import tissue or intracellular method comprises: directly be injected into polynucleotide in the in-vivo tissue; Or external by carrier (as virus, phage or plasmid etc.) earlier with the polynucleotide transfered cell in, again cell is transplanted in the body etc.
Suppress the oligonucleotide (comprising sense-rna and DNA) of NADP hydrogenase subunit 50 mRNA and ribozyme also within the scope of the invention.Ribozyme is the enzyme sample RNA molecule that a kind of energy specificity is decomposed specific RNA, and its mechanism of action is to carry out the endonuclease effect after ribozyme molecule and the hybridization of complementary target RNA-specific.The RNA of antisense and DNA and ribozyme can obtain with existing any RNA or DNA synthetic technology, as the technology widespread use of solid phase phosphoamide chemical synthesis synthetic oligonucleotide.Antisense rna molecule can be transcribed acquisition by the dna sequence dna of this RNA that encodes in external or body.This dna sequence dna has been incorporated into the downstream of rna polymerase promoter of carrier.In order to increase the stability of nucleic acid molecule, available several different methods is modified it, and as increasing the sequence length of both sides, the connection between the ribonucleoside is used phosphoric acid thioester bond or peptide bond but not phosphodiester bond.
The polynucleotide of coding NADP hydrogenase subunit 50 can be used for the diagnosis with the relative disease of NADP hydrogenase subunit 50.The unconventionality expression of the expression that the polynucleotide of coding NADP hydrogenase subunit 50 can be used for detecting NADP hydrogenase subunit 50 NADP hydrogenase subunit 50 whether or under morbid state.As the dna sequence dna of the NADP hydrogenase subunit 50 of encoding can be used for biopsy specimen is hybridized to judge the expression situation of NADP hydrogenase subunit 50.Hybridization technique comprises the Southern blotting, Northern blotting, in situ hybridization etc.These technological methods all are disclosed mature technologies, and relevant test kit all can obtain from commercial channels.Part or all of polynucleotide of the present invention can be used as probe stationary on microarray (Microarray) or DNA chip (being called " gene chip " again), is used for analyzing the differential expression analysis and the gene diagnosis of tissue gene.Carry out the transcription product that RNA-polymerase chain reaction (RT-PCR) amplification in vitro also can detect NADP hydrogenase subunit 50 with NADP hydrogenase subunit 50 special primers.
The sudden change that detects NADP hydrogenase subunit 50 genes also can be used for diagnosing the relevant disease of NADP hydrogenase subunit 50.The form of NADP hydrogenase subunit 50 sudden change comprises that the point mutation compared with normal wild type NADP hydrogenase subunit 50 dna sequence dnas, transposition, disappearance, reorganization and other are any unusual etc.Available existing technology such as Southern blotting, dna sequence analysis, PCR and in situ hybridization detect sudden change.In addition, sudden change might influence proteic expression, therefore can judge indirectly that with Northern blotting, Western blotting gene has or not sudden change.
Sequence of the present invention identifies it also is valuable to karyomit(e).This sequence can be specifically at certain bar human chromosome particular location and and can with its hybridization.At present, need to identify the concrete site of each gene on the karyomit(e).Now, have only chromosomal marker thing seldom to can be used for the marker chromosomes position based on actual sequence data (repetition polymorphism).According to the present invention, for these sequences are associated with disease related gene, its important the first step is positioned these dna sequence dnas on the karyomit(e) exactly.
In brief, prepare PCR primer (preferred 15-35bp), sequence can be positioned on the karyomit(e) according to cDNA.Then, these primers are used for the somatocyte hybrid cell that the PCR screening contains each bar human chromosome.Have only those hybrid cells that contain corresponding to the people's gene of primer can produce the fragment of amplification.
The PCR localization method of somatocyte hybrid cell is that DNA is navigated to concrete chromosomal quick method.Use Oligonucleolide primers of the present invention,, can utilize one group to realize inferior location from specific chromosomal fragment or a large amount of genomic clone by similar approach.Other the similar strategy that can be used for chromosomal localization comprises in situ hybridization, uses the karyomit(e) prescreen and the hybridization preliminary election of the airflow classification of mark, thereby makes up the special cDNA storehouse of karyomit(e).
The cDNA clone is carried out fluorescence in situ hybridization (FISH) with Metaphase Chromosome, can in a step, accurately carry out chromosomal localization.The summary of this technology is referring to Verma etc., Human Chromosomes:a Manualof Basic Techniques, Pergamon Press, New York (1988).
In case sequence is positioned to chromosome position accurately, the physical location of this sequence on karyomit(e) just can be associated with the gene map data.These data for example are found in, V.Mckusick, MendelianInheritance in Man (can by with the online acquisition of Johns Hopkins University Welch Medical Library).Can pass through linkage analysis then, determine gene and navigated to relation between the disease on the chromosomal region already.
Then, need to measure ill and not cDNA between diseased individuals or genome sequence difference.If observe certain sudden change in some or all of diseased individuals, and this sudden change is not observed in any normal individual, then this sudden change may be the cause of disease of disease.More ill and diseased individuals not is usually directed at first seek the variation of structure in the karyomit(e), as from the horizontal visible of karyomit(e) or use based on detectable disappearance of the PCR of cDNA sequence or transposition.Resolving power according to present physical mapping and assignment of genes gene mapping technology, being accurately positioned to the cDNA of the chromosomal region relevant with disease, can be a kind of (the supposing that 1 megabasse mapping resolving power and every 20kb are corresponding to a gene) between 50 to 500 potential Disease-causing genes.
Polypeptide of the present invention, polynucleotide and stand-in thereof, agonist, antagonist and inhibitor and suitable pharmaceutical carrier combination back can be used.These carriers can be water, glucose, ethanol, salt, damping fluid, glycerine and their combination.Composition comprises the polypeptide or the antagonist of safe and effective amount and carrier and the vehicle that does not influence effect of drugs.These compositions can be used as medicine and are used for disease treatment.
The present invention also provides medicine box or the test kit that contains one or more containers, and one or more medicinal compositions compositions of the present invention are housed in the container.With these containers, can have by the given indicative prompting of government authorities of making, using or selling medicine or biological products, the government authorities that this prompting reflects production, uses or sells permits it to use on human body.In addition, polypeptide of the present invention can be used in combination with other treatment compound.
Pharmaceutical composition can be with mode administration easily, as by in part, intravenously, intraperitoneal, intramuscular, subcutaneous, the nose or the route of administration of intracutaneous.NADP hydrogenase subunit 50 comes administration with the amount that treats and/or prevents concrete indication effectively.The amount and the dosage range that are applied to patient's NADP hydrogenase subunit 50 will depend on many factors, as administering mode, person's to be treated healthiness condition and diagnostician's judgement.
Following accompanying drawing is used to illustrate specific embodiments of the present invention, and is not used in qualification by the scope of the invention that claims defined.
Fig. 1 is the amino acid sequence homology comparison diagram of NADP hydrogenase subunit 50 of the present invention and NADP-hydrogenase subunit D.The top sequence is a NADP hydrogenase subunit 50, and the below sequence is NADP-hydrogenase subunit D.Same amino acid represents with monocase amino acid that between two sequences similar amino acid is represented with "+".
Fig. 2 is the polyacrylamide gel electrophoresis figure (SDS-PAGE) of isolating NADP hydrogenase subunit 50.50kDa is proteinic molecular weight.The arrow indication is isolated protein band.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:ColdSpring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.The clone of embodiment 1:NADP hydrogenase subunit 50
Extract the total RNA of people's tire brain with guanidinium isothiocyanate/phenol/chloroform single stage method.From total RNA, separate poly (A) mRNA with Quik mRNA Isolation Kit (Qiegene company product).2ug poly (A) mRNA forms cDNA through reverse transcription.CDNA fragment orientation is inserted on the multiple clone site of pBSK (+) carrier (Clontech company product) with Smart cDNA clone's test kit (available from Clontech), transforms DH5 α, bacterium forms the cDNA library.Measure all clones' 5 ' and 3 ' terminal sequence with Dyeterminate cycle reaction sequencing kit (Perkin-Elmer company product) and ABI 377 automatic sequencers (Perkin-Elmer company).CDNA sequence and the existing public dna sequence data storehouse (Genebank) measured are compared, found that the cDNA sequence of one of them clone 0898A02 is new DNA.By synthetic a series of primers the contained insertion cDNA fragment of this clone is carried out two-way mensuration.The result shows, the contained full-length cDNA of 0898A02 clone is 1577bp (shown in Seq ID NO:1), from 105bp to 1475bp the open reading frame (ORF) of a 137lbp, the new protein (shown in Seq ID NO:2) of encoding arranged.We are with this clone's called after pBS-0898A02, encoded protein matter called after NADP hydrogenase subunit 50.
Embodiment 2:cDNA clone's homology retrieval
With the sequence and the encoded protein sequence thereof of NADP hydrogenase subunit 50 of the present invention, with Blast program (Basiclocal Alignment search tool) [Altschul, SF et al.J.Mol.Biol.1990; 215:403-10], carry out the homology retrieval at databases such as Genbank, Swissport.The gene the highest with NADP hydrogenase subunit 50 homologys of the present invention is a kind of known NADP-hydrogenase subunit D, and its encoded protein number is AE001705 in the access of Genbank.Protein homology the results are shown in Fig. 1, both height homologies, and its homogeny is 30%; Similarity is 50%.Embodiment 3: with the gene of RT-PCR method clones coding NADP hydrogenase subunit 50
Total RNA is a template with fetus brain cell, is that primer carries out the synthetic cDNA of reverse transcription reaction with oligo-dT, with behind the test kit purifying of Qiagene, carries out pcr amplification with following primer:
Primer1: 5’-?GGGGGGAGGACAACAAAGGGCCG?-3’ (SEQ?ID?NO:3)
Primer2: 5’-?TTTTCTTAAGTGTCTTTAATACT?-3’ (SEQ?ID?NO:4)
Primer1 is the forward sequence that begins of 1bp that is positioned at the 5 ' end of SEQ ID NO:1;
Primer2 be SEQ ID NO:1 in 3 ' end reverse sequence.
The condition of amplified reaction: in the reaction volume of 50 μ l, contain 50mmol/L KCl, 10mmol/LTris-Cl, (pH8.5), 1.5mmol/L MgCl
2, 200 μ mol/L dNTP, 10pmol primer, the Taq archaeal dna polymerase of 1U (Clontech company product).Go up by 25 cycles of following conditioned response at PE9600 type DNA thermal cycler (Perkin-Elmer company): 94 ℃ of 30sec; 55 ℃ of 30sec; 72 ℃ of 2min.When RT-PCR, establish the blank negative contrast of positive contrast of β-actin and template simultaneously.Amplified production is connected to (Invitrogen company product) on the pCR carrier with the test kit purifying of QIAGEN company with TA clone test kit.The dna sequence analysis result shows that the dna sequence dna of PCR product and the 1-1577bp shown in the SEQ ID NO:1 are identical.Embodiment 4:Northern blotting is analyzed NADP hydrogenase subunit 50 expression of gene:
Extract total RNA[Anal.Biochem 1987,162,156-159 with single stage method].This method comprises acid guanidine thiocyanate phenol-chloroform extracting.Promptly use 4M guanidinium isothiocyanate-25mM Trisodium Citrate, 0.2M sodium acetate (pH4.0) carries out homogenate to tissue, adds the phenol of 1 times of volume and the chloroform-primary isoamyl alcohol (49: 1) of 1/5 volume, and is centrifugal after mixing.The sucking-off aqueous phase layer adds Virahol (0.8 volume) and with the centrifugal RNA precipitation that obtains of mixture.With RNA precipitation 70% washing with alcohol that obtains, dry and soluble in water.With 20 μ g RNA, on 1.2% sepharose that contains 20mM 3-(N-morpholino) propanesulfonic acid (pH7.0)-5mM sodium acetate-1mM EDTA-2.2M formaldehyde, carry out electrophoresis.Be transferred on the nitrocellulose filter then.With α-
32P dATP prepares by random priming
32The dna probe of P-mark.Used dna probe is NADP hydrogenase subunit 50 coding region sequences (105bp to 1475bp) of pcr amplification shown in Figure 1.Probe (about 2 * 10 with the 32P-mark
6Cpm/ml) spend the night in 42 ℃ of hybridization in a solution with the nitrocellulose filter that has shifted RNA, this solution comprises 50% methane amide-25mM KH
2PO
4(pH7.4)-5 * SSC-5 * Denhardt ' s solution and 200 μ g/ml salmon sperm DNAs.After the hybridization, filter membrane is washed 30min in 55 ℃ in 1 * SSC-0.1%SDS.Then, analyze with quantitative with Phosphor Imager.Embodiment 5: vivoexpression, separation and the purifying of reorganization NADP hydrogenase subunit 50
According to SEQ ID NO:1 and coding region sequence shown in Figure 1, design a pair of specificity amplification primer, sequence is as follows:
Primer3:?5’-?CCCCATATGATGAAGTGTGAGCACTGCACGCGC?-3’?(Seq?ID?No:5)
Primer4:?5’-?CCCGGATCCAGCTGGAAGGCCCTGGCCTGACTT?-3’?(Seq?ID?No:6)
5 ' end of these two sections primers contains Nde I and BamH I restriction enzyme site respectively, be respectively the encoding sequence of target gene 5 ' end and 3 ' end thereafter, Nde I and BamH I restriction enzyme site are corresponding to expression vector plasmid pET-28b (+) (Novagen company product, Cat.No.69865.3) the selectivity restriction enzyme site on.With the pBS-0898A02 plasmid that contains the total length goal gene is template, carries out the PCR reaction.The PCR reaction conditions is: contain pBS-0898A02 plasmid 10pg, primer Primer-3 and Primer-4 among the cumulative volume 50 μ l and be respectively 10pmol, AdvantageDolymerase Mix (Clontech company product) 1 μ l.Loop parameter: 94 ℃ of 20s, 60 ℃ of 30s, 68 ℃ of 2min, totally 25 circulations.Respectively amplified production and plasmid pET-28 (+) are carried out double digestion with Nde I and BamH I, reclaim big fragment respectively, and connect with the T4 ligase enzyme.Connect product and transform, after the dull and stereotyped overnight incubation of the LB that contains kantlex (final concentration 30 μ g/ml), use the colony polymerase chain reaction (PCR) method screening positive clone, and check order with the big enterobacterial DH5 of Calcium Chloride Method α.Select the correct positive colony of sequence (pET-0898A02) with Calcium Chloride Method with recombinant plasmid transformed e. coli bl21 (DE3) plySs (Novagen company product).In the LB liquid nutrient medium that contains kantlex (final concentration 30 μ g/ml), host bacterium BL21 (pET-0898A02) is cultured to logarithmic phase at 37 ℃, adds IPTG to final concentration 1mmol/L, continues to cultivate 5 hours.Centrifugal collection thalline, through the broken bacterium of ultrasonic wave, centrifugal collection supernatant with carrying out chromatography with 6 Histidines (6His-Tag) bonded affinity column His.Bind Quick Cartridge (Novagen company product), has obtained the target protein NADP hydrogenase subunit 50 of purifying.Through the SDS-PAGE electrophoresis, obtain a single band (Fig. 2) at the 50kDa place.This band is transferred on the pvdf membrane carries out the n terminal amino acid sequential analysis with the Edams hydrolysis method, 15 amino acid of N-end hold 15 amino-acid residues identical with the N-shown in the SEQ ID NO:2 as a result.Embodiment 6 anti-NADP hydrogenase subunit 50 production of antibodies
With synthetic following NADP hydrogenase subunit 50 specific polypeptide: the NH of Peptide synthesizer (PE company product)
2-Met-Lys-Cys-Glu-His-Cys-Thr-Arg-Lys-Glu-Cys-Ser-Lys-Lys-Thr-COOH
(SEQ?ID?NO:7)。Form compoundly with hemocyanin and bovine serum albumin coupling this polypeptide respectively, method is referring to Avrameas, et al.Immunochemistry, 1969; 6:43.Add the complete Freund's adjuvant immunizing rabbit with the above-mentioned hemocyanin polypeptide complex of 4mg, add the incomplete Freund's adjuvant booster immunization once with the hemocyanin polypeptide complex again after 15 days.Employing is done the titre that ELISA measures antibody in the rabbit anteserum through the titer plate of 15 μ g/ml bovine serum albumin polypeptide complex bag quilts.From the rabbit anteserum of antibody positive, separate total IgG with albumin A-Sepharose.Polypeptide is incorporated on the Sepharose4B post of cyanogen bromide-activated, from total IgG, separates anti-peptide antibody with affinity chromatography.Immuno-precipitation proof antibody purified can combine with NADP hydrogenase subunit 50 specifically.
Sequence table (1) general information:
(ⅱ) denomination of invention: NADP hydrogenase subunit 50 and encoding sequence thereof
(ⅲ) sequence number: the information of 7 (2) SEQ ID NO:1:
(ⅰ) sequence signature:
(A) length: 1577bp
(B) type: nucleic acid
(C) chain: two strands
(D) topological framework: linearity
(ⅱ) molecule type: cDNA
( ⅹⅰ ) :SEQ ID NO:1: 1 GGGGGGAGGACAACAAAGGGCCGCGGGCGGCGGGCAGTGGTGTCCCAGTCTCCCGGTGCT 61 TCCCTGAGGCTGAGGCGCCCGGCCTCCCGCCCGCCGCGCTCCAGATGAAGTGTGAGCACT121 GCACGCGCAAGGAATGTAGTAAGAAAACAAAAACTGATGACCAAGAGAATGTGTCAGCCG181 ATGCACCGAGTCCAGCCCAGGAAAATGGAGAGAAGGGAGAATTCCACAAGTTGGCTGATG241 CCAAGATATTTTTGAGCGACTGCCTGGCATGTGACAGCTGTATGACTGCAGAGGAAGGAG301 TCCAACTTTCCCAGCAAAATGCCAAGGACTTCTTCCGCGTTCTGAACCTTAACAAGAAAT361 GTGATACCTCAAAGCACAAAGTGCTGGTAGTGTCTGTGTGTCCTCAATCTTTGCCTTATT421 TTGCTGCTAAATTCAACCTCAGTGTAACTGATGCATCCAGAAGACTCTGTGGTTTCCTCA481 AAAGTCTTGGGGTGCACTATGTATTTGATACGACGATAGCTGCGGATTTTAGTATCCTGG541 AGAGTCAAAAAGAATTCGTGCGTCGCTATCGCCAGCACAGTGAGGAGGAACGCACCCTGC601 CCATGCTGACCTCTGCCTGTCCTGGCTGGGTCCGATACGCCGAGCGGGTGCTGGGTCGCC661 CCATCACTGCCCACCTCTGCACCGCCAAGTCCCCCCAGCAGGTCATGGGCTCTTTGGTGA721 AGGATTATTTCGCCAGACAGCAGAACCTGTCTCCAGAGAAGATTTTCCACGTCATTGTGG781 CCCCTTGTTATGACAAGAAGCTGGAGGCTCTTCAGGAAAGCCTTCCCCCTGCTTTGCATG841 GCTCCCGGGGCGCTGACTGCGTGTTAACATCAGGTGAAATTGCTCAAATAATGGAGCAAG901 GTGACCTCTCAGTGAGAGATGCTGCCGTCGACACTCTGTTTGGAGACTTGAAGGAGGACA 961 AAGTGACGCGTCATGATGGAGCCAGCTCAGACGGGCACCTGGCACACATCTTCAGACATG1021 CGGCCAAGGAGCTGTTCAACGAGGATGTGGAGGAGGTCACTTACCGAGCCCTGAGAAACA1081 AAGACTTCCAAGAGGTCACCCTTGAGAAGAACGGAGAGGTGGTGTTACGCTTTGCTGCAG1141 CCTATGGCTTTCGAAACATCCAGAACATGATCCTGAAGCTTAAGAAGGGCAAGTTCCCAT1201 TCCACTTTGTGGAGGTCCTCGCCTGTGCTGGAGGATGCTTAAATGGCAGAGGCCAAGCCC1261 AGACTCCAGACGGACATGCGGATAAGGCCCTGCTGCGGCAGATGGAAGGCATTTACGCTG1321 ACATCCCTGTGCGGCGTCCGGAGTCCAGTGCACACGTGCAGGAGCTGTACCAGGAGTGGC1381 TGGAGGGGATCAACTCCCCCAAGGCCCGAGAGGTGCTGCATACCACGTACCAGAGCCAGG1441 AGCGTGGCACACACAGCCTGGACATCAAGTGGTGAAGTCAGGCCAGGGCCTTCCAGCTGC1501 TTTTGGGGCCAGAGCCAAGAGCCTTTCAGTAGAGGGAGGGGCTGCCCTGAGTGGAGTATT1561 AAAGACACTTAAGAAAA ( 3 ) SEQ ID N0:2:
(ⅰ) sequence signature:
(A) length: 456 amino acid
(B) type: amino acid
(D) topological framework: linearity
(ⅱ) molecule type: polypeptide
( ⅹⅰ ) :SEQ ID NO:2: 1 Met Lys Cys Glu His Cys Thr Arg Lys Glu Cys Ser Lys Lys Thr 16 Lys Thr Asp Asp Gln Glu Asn Val Ser Ala Asp Ala Pro Ser Pro 31 Ala Gln Glu Asn Gly Glu Lys Gly Glu Phe His Lys Leu Ala Asp 46 Ala Lys Ile Phe Leu Ser Asp Cys Leu Ala Cys Asp Ser Cys Met 61 Thr Ala Glu Glu Gly Va1 Gln Leu Ser Gln Gln Asn Ala Lys Asp 76 Phe Phe Arg Val Leu Asn Leu Asn Lys Lys Cys Asp Thr Ser Lys 91 His Lys Val Leu Val Val Ser Val Cys Pro Gln Ser Leu Pro Tyr106 Phe Ala Ala Lys Phe Asn Leu Ser Val Thr Asp Ala Ser Arg Arg121 Leu Cys Gly Phe Leu Lys Ser Leu Gly Va1 His Tyr Val Phe Asp136 Thr Thr Ile Ala Ala Asp Phe Ser Ile Leu Glu Ser Gln Lys Glu151 Phe Val Arg Arg Tyr Arg Gln His Ser Glu Glu Glu Arg Thr Leu166 Pro Met Leu Thr Ser Ala Cys Pro Gly Trp Val Arg Tyr Ala Glu181 Arg Val Leu Gly Arg Pro Ile Thr Ala His Leu Cys Thr Ala Lys196 Ser Pro Gln Gln Val Met Gly Ser Leu Val Lys Asp Tyr Phe Ala211 Arg Gln Gln Asn Leu Ser Pro Glu Lys Ile Phe His Val Ile Val226 Ala Pro Cys Tyr Asp Lys Lys Leu Glu Ala Leu Gln Glu Ser Leu241 Pro Pro Ala Leu His Gly Ser Arg Gly Ala Asp Cys Val Leu Thr256 Ser Gly Glu Ile Ala Gln Ile Met Glu Gln Gly Asp Leu Ser Val271 Arg Asp Ala Ala Val Asp Thr Leu Phe Gly Asp Leu Lys Glu Asp286 Lys Val Thr Arg His Asp Gly Ala Ser Ser Asp Gly His Leu Ala301 His Ile Phe Arg His Ala Ala Lys Glu Leu Phe Asn Glu Asp Val316 Glu Glu Val Thr Tyr Arg Ala Leu Arg Asn Lys Asp Phe Gln Glu331 Val Thr Leu Glu Lys Asn Gly Glu Val Val Leu Arg Phe Ala Ala346 Ala Tyr Gly Phe Arg Asn Ile Gln Asn Met Ile Leu Lys Leu Lys361 Lys Gly Lys Phe Pro Phe His Phe Val Glu Val Leu Ala Cys Ala376 Gly Gly Cys Leu Asn Gly Arg Gly Gln Ala Gln Thr Pro Asp Gly391 His Ala Asp Lys Ala Leu Leu Arg Gln Met Glu Gly Ile Tyr Ala406 Asp Ile Pro Val Arg Arg Pro Glu Ser Ser Ala His Val Gln Glu421 Leu Tyr Gln Glu Trp Leu Glu Gly Ile Asn Ser Pro Lys Ala Arg436 Glu Val Leu His Thr Thr Tyr Gln Ser Gln Glu Arg Gly Thr His451 Ser Leu Asp Ile Lys Trp ( 4 ) SEQ ID NO:3
(ⅰ) sequence signature
(A) length: 23 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(ⅱ) molecule type: oligonucleotide
(ⅹ ⅰ) sequence description: the information of SEQ ID NO:3:GGGGGGAGGACAACAAAGGGCCG 23 (5) SEQ ID NO:4
(ⅰ) sequence signature
(A) length: 23 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(ⅱ) molecule type: oligonucleotide
(ⅹ ⅰ) sequence description: the information of SEQ ID NO:4:TTTTCTTAAGTGTCTTTAATACT 23 (6) SEQ ID N0:5
(ⅰ) sequence signature
(A) length: 33 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(ⅱ) molecule type: oligonucleotide
(ⅹ ⅰ) sequence description: the information of SEQ ID N0:5:CCCCATATGATGAAGTGTGAGCACTGCACGCGC 33 (7) SEQ ID N0:6
(ⅰ) sequence signature
(A) length: 33 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(ⅱ) molecule type: oligonucleotide
(ⅹ ⅰ) sequence description: the information of SEQ ID NO:6:CCCGGATCCAGCTGGAAGGCCCTGGCCTGACTT 33 (8) SEQ ID NO:7:
(ⅰ) sequence signature:
(A) length: 15 amino acid
(B) type: amino acid
(D) topological framework: linearity
(ⅱ) molecule type: polypeptide
(ⅹ ⅰ) sequence description: SEQ ID N0:7:Met-Lys-Cys-Glu-His-Cys-Thr-Arg-Lys-Glu-Cys-Ser-Lys-Lys-Thr 15
Claims (18)
1, a kind of isolated polypeptide-NADP hydrogenase subunit 50 is characterized in that it includes: SEQ ID NO:2
The polypeptide of shown aminoacid sequence or the active fragments of its polypeptide, analogue or derivative.
2, polypeptide as claimed in claim 1 is characterized in that the amino acid of described polypeptide, analogue or derivative
Sequence has the homogeny with the aminoacid sequence at least 95% shown in the SEQ ID NO:2.
3, polypeptide as claimed in claim 2 is characterized in that it comprises and has the amino shown in the SEQ ID NO:2
The polypeptide of acid sequence.
4, a kind of isolating polynucleotide, it is characterized in that described polynucleotide comprise be selected from down the group in a kind of:
(a) coding have aminoacid sequence shown in the SEQ ID NO:2 polypeptide or its fragment, analogue, derive
The polynucleotide of thing;
(b) with polynucleotide (a) complementary polynucleotide; Or
(c) with (a) or the polynucleotide of at least 70% homogeny (b) are arranged.
5, polynucleotide as claimed in claim 4 is characterized in that described polynucleotide comprise coding and have SEQ
The polynucleotide of aminoacid sequence shown in the ID NO:2.
6, polynucleotide as claimed in claim 4 is characterized in that the sequence of described polynucleotide includes SEQ ID
The sequence of 1-1577 position among the sequence of 105-1475 position or the SEQ ID NO:1 among the NO:1.
7, a kind of recombinant vectors that contains exogenous polynucleotide is characterized in that it is by appointing among the claim 4-6
The recombinant vectors that described polynucleotide of one claim and plasmid, virus or vehicle expression vector establishment form.
8, a kind of genetically engineered host cell that contains exogenous polynucleotide, it is characterized in that it be selected from following
A kind of host cell:
(a) host cell that transforms or transduce with the described recombinant vectors of claim 7; Or
(b) host cell that transforms or transduce with the described polynucleotide of the arbitrary claim among the claim 4-6.
9, a kind of preparation method with NADP hydrogenase subunit 50 active polypeptide is characterized in that described method
Comprise:
(a) expressing under NADP hydrogenase subunit 50 conditions, cultivate the described through engineering approaches host of claim 8
Cell;
(b) from culture, isolate and have NADP hydrogenase subunit 50 active polypeptide.
10, a kind of can with polypeptide bonded antibody, it is characterized in that described antibody be can with NADP hydrogenase subunit 50
Specificity bonded antibody.
11, an analoglike or regulate polypeptide active or the compound of expression, it is characterized in that they are simulations, promote,
The active compound of antagonism or inhibition NADP hydrogenase subunit 50.
12, compound as claimed in claim 11 is characterized in that it is the multinuclear glycosides shown in the SEQ ID NO:1
Acid sequence or its segmental antisense sequences.
13, the described application of compound of a kind of claim 11 is characterized in that described compound is used to regulate NADP
Hydrogenase subunit 50 in vivo, the method for external activity.
14, a kind of detect with claim 1-3 in relevant disease or the disease-susceptible humans of the described polypeptide of arbitrary claim
The property method, it is characterized in that it comprises the described polypeptide expression amount that detects, perhaps detect the activity of described polypeptide,
Perhaps detect and cause described expression of polypeptides amount or active unusual nucleotide diversity in the polynucleotide.
15,, it is characterized in that it is applied to sieve as the application of polypeptide as described in the arbitrary claim among the claim 1-3
Select stand-in, the agonist of NADP hydrogenase subunit 50, antagonist or inhibitor; Perhaps be used for the peptide fingerprint image
Spectrum is identified.
16,, it is characterized in that its work as the application of the described nucleic acid molecule of arbitrary claim among the claim 4-6
For primer is used for nucleic acid amplification reaction, perhaps be used for hybridization as probe, perhaps be used to make gene chip
Or microarray.
17, as the described polypeptide of arbitrary claim, polynucleotide or compound in claim 1-6 and 11
Use, it is characterized in that with described polypeptide, polynucleotide or its stand-in, agonist, antagonist or inhibitor
Form as diagnosis or treatment and NADP hydrogenase subunit with safe and effective dosage and pharmaceutically acceptable carrier
The pharmaceutical composition of 50 unusual relevant diseases.
18, the described polypeptide of arbitrary claim, polynucleotide or the compound among the claim 1-6 and 11 should
With, it is characterized in that being used for the treatment of as malignant tumour blood with described polypeptide, polynucleotide or compound
Disease, the medicine of HIV infection and immunological disease and all kinds of inflammation.
Priority Applications (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 99119893 CN1302869A (en) | 1999-10-28 | 1999-10-28 | Polypeptide-NADP hydrogenase subunit 50 and polynucleotide for coding it |
PCT/CN2000/000377 WO2001030824A1 (en) | 1999-10-28 | 2000-10-27 | A novel polypeptide-nadp hydrogenase subunit 50 and the polynucleotide encoding said polypeptide |
AU12642/01A AU1264201A (en) | 1999-10-28 | 2000-10-27 | A novel polypeptide-nadp hydrogenase subunit 50 and the polynucleotide encoding said polypeptide |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 99119893 CN1302869A (en) | 1999-10-28 | 1999-10-28 | Polypeptide-NADP hydrogenase subunit 50 and polynucleotide for coding it |
Publications (1)
Publication Number | Publication Date |
---|---|
CN1302869A true CN1302869A (en) | 2001-07-11 |
Family
ID=5281184
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN 99119893 Pending CN1302869A (en) | 1999-10-28 | 1999-10-28 | Polypeptide-NADP hydrogenase subunit 50 and polynucleotide for coding it |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1302869A (en) |
AU (1) | AU1264201A (en) |
WO (1) | WO2001030824A1 (en) |
-
1999
- 1999-10-28 CN CN 99119893 patent/CN1302869A/en active Pending
-
2000
- 2000-10-27 WO PCT/CN2000/000377 patent/WO2001030824A1/en active Application Filing
- 2000-10-27 AU AU12642/01A patent/AU1264201A/en not_active Abandoned
Also Published As
Publication number | Publication date |
---|---|
WO2001030824A1 (en) | 2001-05-03 |
AU1264201A (en) | 2001-05-08 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN1297916A (en) | Human bromo structure domain-containing protein 95 as one new kind of polypeptide and polynucleotides encoding this polypeptide | |
CN1302868A (en) | Polypeptide-human F1F0 ATP synthetase subunit 15 and polynucleotide for coding it | |
CN1302897A (en) | Polypeptide-human phosphodiesterase 21 similar to acidic sphingomyelinase and polynucleotide for coding it | |
CN1302869A (en) | Polypeptide-NADP hydrogenase subunit 50 and polynucleotide for coding it | |
CN1297914A (en) | Human zinc-finger protein 58 as one new kind of polypeptide and polynucleotides encoding this polypeptide | |
CN1303937A (en) | Novel polypeptide-human tissue anion transport polypeptide 41 and polynucleotide coding said polypeptide | |
CN1303930A (en) | Novel polypeptide-zinc finger protein 57 and polynucleotide coding said polypeptide | |
CN1303925A (en) | Novel polypeptide-arginyl tRNA synthetase 44 and polynucleotide coding said polypeptide | |
CN1302879A (en) | Polypeptide-human F-actin binding factor 75 and polynucleotide for coding it | |
CN1302877A (en) | Polypeptide-human nuclein II precursor protein 25 and polynucleotide for coding it | |
CN1293204A (en) | Polypeptide-human bromo-functional protein 72 and polynucleotide for coding this polypeptide | |
CN1303933A (en) | Novel polypeptide-human muscle BOP protein 41 and polynucleotide coding said polypeptide | |
CN1297917A (en) | Human zinc-finger protein 38 as one new kind of polypeptide and polynucleotides encoding this polypeptide | |
CN1470520A (en) | Polypeptide-zine finger protein 40 and polynucleotide encoding this polypeptide | |
CN1302881A (en) | Polypeptide-human beta-galactoside binding protein and polynucleotide for coding it | |
CN1302894A (en) | Polypeptide-human dehydrogenase 35 and polynucleotide for coding it | |
CN1303926A (en) | Novel polypeptide-NADH-cytochrome B5 reductase 33 and polynucleotide coding said polypeptide | |
CN1303945A (en) | Novel polypeptide-serine/threonine kinase 39 and polynucleotide coding said polypeptide | |
CN1470524A (en) | Polypeptide-human transcriptional elongation factor IIS51 and polynucleotide encoding this polypeptide | |
CN1297904A (en) | Human cytokinin inducing-gene expressing protein 25 as one new kind of polypeptide and polynucleotides encoding this polypeptide | |
CN1303863A (en) | Novel polypeptide-human transcriptional elongation factor IIS51 and polynucleotide for coding this polypeptide | |
CN1293246A (en) | Polypeptide-human calcium ion protein 48 for regulating secretion and polynucleotide for coding this polypeptide | |
CN1292386A (en) | New polypeptide-HRMT 35 and polynucleotide coding this polypeptide | |
CN1303938A (en) | Novel polypeptide-human MATH37 and polynucleotide coding said polypeptide | |
CN1303934A (en) | Novel polypeptide-human Ra1BPI related protein 82 and polynucleotide coding said polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C06 | Publication | ||
PB01 | Publication | ||
C12 | Rejection of a patent application after its publication | ||
RJ01 | Rejection of invention patent application after publication |