CN1297944A - Calcium binding/actin crosslinking protein and its encoding polynucleotide sequence - Google Patents

Abstract

The present invention discloses polynucleotides sequence of one novel calcium binding actin linked protein gene and the encoded polypeptide as well as the method of preparing this kind of polypeptide. The present invention also discloses the method of diagnosing the diseases related to the abnormal nucleic acid of the gene and encoded polypeptide through detecting the mutation of the gene necleic acid level and the change in the polypeptide level. The present invention also discloses the application of the polynucleotide sequence and polypeptide of the gene in treating the gene related diseases and the medicine composite for the said treatment.

Description

A kind of calcium binding/actin crosslinking protein and its polynucleotide sequence of encoding

The invention discloses a kind of new CBACP (being designated hereinafter simply as CBACP) and its polynucleotide sequence of encoding, also relate to the application in diagnosis, prevention and treatment and the unusual relative disease of this protein expression of described protein and polynucleotide.

Calcium comprises in the processes such as gene regulating, DNA synthesize, the release of brain neurotransmitter, cell cycle regulating, Muscle contraction, protein excretion, mitotic division playing an important role at various cellular activities.The adjusting of calcium relates to one group of homologous calcium binding protein, and these albumen all have an EF hand calcium binding domains.The α spiral that each 12 amino acid of ring that EF hand calcium binding domains is made up of 12 amino acid and both sides thereof are formed constitutes, and these two spirals almost form an angle of 90 degrees.The pentagonal bipyramid conformation of calcium and the fashionable formation of this loops.In the structural domain the 1st, 3,5,7,9,12 residues participate in combined function.The 12nd conserved residues L-glutamic acid (Glu) or aspartic acid (Asp) provide two Sauerstoffatoms and calcium coordination.(people (1995) Protein Prof.2:305-490 such as Kawasaki H.), (people (1990) J.Mol.Evol such as Moncrief N.D., 30:522-562).

Actin filament is the main component part of cytoskeleton, and it is cross-linked into pencil and reticulated structure by actin crosslinking protein in cell, for organoid scaffolding structure fixedly is provided, also be some protein synthesis and metabolic place simultaneously.All actin crosslinking proteins all have two Actin muscle binding sites at least, generally also contain the structural domain of oligomerization function, the structural domain of calcium regulatory function, the structural domain of membrane-binding function etc.(Matsudaira, P. (1991) biological chemistry science trend (Trends Biochem.Sci) .16,87-92).Contain a conservative actin binding structural domain as the spectrin family in the actin crosslinking protein superfamily, and the spectrin repeat region is arranged, calcium adjustment structure territory (EF hand calcium binding domains) etc.Studies show that actin binding structural domain function homology, the binding site on Actin muscle is identical.(Matsudaira, P. (1994) cytobiology magazine (J.Cell Biol.) 126,285-287)

Actin crosslinking protein superfamily albumen is relevant with many genetic diseasess.The dystrophin defective cause Du Xingshi and becker type muscular dystrophy (Monaco, people such as A.P. (1988) Adv.Hum.Genet.17,61-89).The spectrin defective causes hereditary hemolytic anemia (Palek, people such as J. (1993) Semin.Hematol.30.249-283).Therefore, significant for therapeutic purpose research and development CBACP.

What being separated into of a kind of new calcium binding/actin crosslinking protein (hereinafter to be referred as CBACP) encoding gene determined that this albumen acts under healthy and morbid state provides the foundation.This albumen may constitute the basis of exploitation medical diagnosis on disease and/or curative, and it is very important therefore separating its coding DNA.Can be used for the diagnosis and the treatment of its relative disease.

Purpose of the present invention just provides a kind of new CBACP CBACP and encodes its polynucleotide.Polypeptide of the present invention contains the characteristic primitive of calcium binding protein family, and promptly EF hand calcium is in conjunction with primitive, thereby CBACP of the present invention is a newcomer in this family.

The present invention relates to a kind of isolated polypeptide, it comprises: polypeptide or its examples of conservative variations, bioactive fragment or derivative with SEQ ID No.2 aminoacid sequence.

The invention still further relates to a kind of isolating polynucleotide, it comprises a kind of nucleotide sequence or its variant that is selected from down group:

(a) coding has the polynucleotide of the polypeptide of SEQ ID No.2 aminoacid sequence;

(b) with polynucleotide (a) complementary polynucleotide;

(c) with (a) or polynucleotide sequence (b) have the polynucleotide of at least 80% homogeny.

The present invention relates to a kind of carrier that contains polynucleotide of the present invention, particularly expression vector in addition; The host cell that this carrier of a kind of usefulness is genetically engineered comprises the host cell of conversion, transduction or transfection; A kind of method for preparing polypeptide of the present invention of cultivating described host cell and reclaiming expression product that comprises.

The invention still further relates to a kind of can with polypeptid specificity bonded antibody of the present invention.

The invention still further relates to a kind of simulation, activation, antagonism of screening or suppress the method for the active compound of this actin crosslinking protein, it comprises and utilizes polypeptide of the present invention.The invention still further relates to the compound that obtains with this method.

The invention still further relates to a kind of vitro detection disease relevant or the method for disease susceptibility with this actin crosslinking protein unconventionality expression, comprise the sudden change in polypeptide described in the detection of biological sample or its coded polynucleotide sequence, perhaps the amount or the biological activity of polypeptide of the present invention in the detection of biological sample.

The present invention also relates to a kind of pharmaceutical composition, it contains polypeptide of the present invention or its stand-in, agonist, antagonist or inhibitor and pharmaceutically acceptable carrier.

The invention still further relates to the purposes of polypeptide of the present invention and/or the polynucleotide aspects such as medicine of the disease that existence causes of excessive Actin muscle outside preparation is used for the treatment of tumour, infertility, recovery or enhancing neural function, disease of immune system, hypertension, kidney depletion, amyotrophy, malnutrition, neurocyte signal conduction disturbance, virus and infectation of bacteria or born of the same parents.

The invention still further relates to the purposes in the medicine of the antagonist of polypeptide of the present invention or the antisense polynucleotides disease that existence causes of excessive Actin muscle outside preparation is used for the treatment of virus and infectation of bacteria such as poxvirus infection or born of the same parents.

The present invention above-mentioned with other the aspect for a person skilled in the art, see it is very clearly from this paper the following detailed description.

Fig. 1 is for making homology relatively result with the aminoacid sequence (row of going up represents with Query) of CBACP CBACP with the aminoacid sequence of mouse microtubule-actin crosslinking factor (row represents with Sbjct down) with the gap program in the GCG software package.

Following term used has following implication unless stated otherwise in the specification and claims:

" nucleotide sequence " refers to oligonucleotides, nucleotides or polynucleotides and fragment or part, and also can Zhi genome or synthetic DNA or RNA, and they can be strand or two strands, have represented Yi chain or antisense strand. Similarly, term " amino acid sequence " refers to oligopeptides, Tai, polypeptide or protein sequence and fragment or part. When Zhong of the present invention " amino acid sequence " related to the amino acid sequence of the naturally occurring protein molecule of Yi Zhong, this " polypeptide " or " protein " did not mean that the complete natural amino acid that amino acid sequence Xian Wei processed Yu described protein molecule Xiang are closed.

Protein or polynucleotides " variant " refer to that Yi Zhong has the amino acid sequence that Yi or a plurality of amino acid or nucleotides change or the polynucleotide sequence of encoding it. Described change can comprise disappearance, insertion or the replacement of amino acid sequence or nucleotide sequence Zhong amino acid or nucleotides. Variant can have " conservative " and change, and the amino acid of wherein replacing has Yu Yuan amino acid similar structure or chemical property, as the Yong leucine, replaces isoleucine. Variant also can have non-conservation and change, and as the Yong tryptophan, replaces glycine.

" disappearance " refers to the Zai amino acid sequence or nucleotide sequence Zhong Yi is individual or the disappearance of a plurality of amino acid or nucleotides.

" insertion " or " interpolation " refers to that the change of Zai amino acid sequence or nucleotide sequence Zhong causes Yu naturally occurring molecule Xiang ratio, and Yi Zeng individual or a plurality of amino acid or nucleotides adds.

The amino acid that " replacement " Zhi You is different or nucleotides are replaced Yi or a plurality of amino acid or nucleotides.

" biologically active " refers to have the protein of structure, regulation and control or the biochemical function of natural molecule. Similarly, term " immunologic competence " refer to natural, Chong Zu's or synthetic protein and the suitable animal of fragment Zai thereof or the Xi born of the same parents Zhong You ability leading specific immune response Yi and Yu specific antibody, be combined.

" activator " refers to when when CBACP is combined, but thereby Yi Zhong Yin plays this protein changes the molecule of regulating this protein active. Activator can comprise protein, nucleic acid, carbohydrate or any other can be in conjunction with the molecule of CBACP.

" antagonist " or " mortifier " refers to that when when CBACP is combined, Yi Zhong can seal or regulate the BA of CBACP or the molecule of immunologic competence. Antagonist and mortifier can comprise protein, nucleic acid, carbohydrate or any other can be in conjunction with the molecule of CBACP.

" adjusting " refers to that the function of CBACP changes, and comprises the change of any other biological property, function or the immune property of the change of the rising of protein active or reduction, binding characteristic and CBACP.

" basically pure " refers to basically not conform to natural other albumen, Zhi class, carbohydrate or other Wu Zhi that closes Yu its Xiang. The purified technology of protein purifying CBACP of those skilled in the art's energy Yong standard. Basically can produce single Zhu band on pure CBACP Zai irreducibility polyacrylamide gel. The purity available amino end acid sequence analysis of CBACP polypeptide.

" complementary " or " complementation " refers to Xia the Yan concentration of Zai Yun Xu and temperature conditions by the natural combination of the polynucleotides of base pairing. For example, Xu row " C-T-G-A " but Xu row " G-A-C-T " combination of Yu complementation. Complementation between Zhi two single chain molecules can be part or whole. Complementary degree between Zhi nucleic acid chains leads and the obvious Ying Xiang of intensity You for the Xiao of nucleic acid chains Zhi intermolecular hybrid.

" homology " refers to complementary degree, can be homeologous or complete homology. " homeologous " refers to the partly Xu row of complementation of Yi Zhong, but the fully complementary Xu row of the few part Yi Zhi of its Zhi are Yu the Za friendship of target nucleic acid. The Yi Zhi that this Za hands over can carry out Za and hand over (Southern Yin mark or Northern Yin mark etc.) to detect Xia the condition of Zai Yan lattice degree reduction. Basically the Xu of homology row or hybridization probe can be competed Xu row with the complete homology of Yi Zhi Yu the combination Xia the condition that the Yan lattice degree of target sequence Zai reduces. Zhe and the conditions permit non-specific binding that reduces of Wei Yan lattice degree unexpectedly, Yin the conditional request two sequences that reduces Wei Yan lattice degree Xiang mutual be combined into specificity or Xuan Ze Xiang mutual effect.

" homogeny percentage " refers to the relatively same or analogous percentage of Zhong Xu row of two or more amino acid of Zai or nucleotide sequence. The available electron method is measured the homogeny percentage, as passing through MEGALIGN program (Lasergene software kit, DNASTAR, Inc., Madison Wis.). The MEGALIGN program can compare two or more Xu row (Higgins, D.G. and P.M.Sharp (1988) gene 73:237-244) according to diverse ways such as Cluster method. The Cluster method is arranged cluster by checking the distance between all pairings with each Zu Xu row. Then each bunch Yi is distributed in pairs or in groups. Homogeny percentage between Zhi two amino acid sequences such as Xu row A and Xu row B by Xia formula calculate:

Also can be by the Cluster method or with the homogeny percentage (Hein J., (1990) Enzymology method (Methods inenzymology) 183:625-645) between known method in this area such as the Jotun Hein mensuration nucleotide sequence.

" similarity " is meant the degree that the identical or conservative property of corresponding position amino-acid residue when arranging contrast between the aminoacid sequence replaces.For example be used for amino acid that conservative property replaces, electronegative amino acid can comprise aspartic acid and L-glutamic acid; Positively charged amino acid can comprise Methionin and arginine; Having uncharged head group has similar hydrophilic amino acid can comprise leucine, Isoleucine and Xie Ansuan; Glycine and L-Ala; L-asparagine and glutamine; Serine and Threonine; Phenylalanine and tyrosine.

" antisense " is meant and specific DNA or RNA sequence complementary nucleotide sequence." antisense strand " is meant and " sense strand " complementary nucleic acid chains.

" derivative " is meant CBACP or encodes its chemical modification object of nucleic acid.This chemical modification object can be with alkyl, acyl group or the amino hydrogen atom of replacing.The nucleic acid derivative codified keeps the polypeptide of the main biological characteristics of natural molecule.

" antibody " is meant complete antibody molecule and fragment thereof, as Fa, F (ab ') ₂And Fv, its energy specificity is in conjunction with the antigenic determinant of CBACP.

" isolating " speech refers to material is shifted out among its original environment (for example, if spontaneous its natural surroundings that just refers to).Such as it is exactly not to be separated that spontaneous polynucleotide or polypeptide are present in the Live Animals, but same polynucleotide or polypeptide with some or all in natural system with it the material of coexistence separately be exactly isolating.Such polynucleotide may be the parts of a certain carrier, the part that also possible such polynucleotide or polypeptide are a certain composition.Since carrier or composition are not the compositions of its natural surroundings, they are still isolating.

One aspect of the present invention provides a kind of new CBACP, and biologically active fragment, analogue and derivative.Another aspect of the present invention provides the isolated nucleic acid molecule of these polypeptide of encoding, and comprises mRNA, DNA, cDNA and genomic dna, and the fragment of biologically active, analogue and derivative.The probe that nucleic acid is provided on the one hand more of the present invention, it comprises the nucleic acid molecule of sufficient length and carries out the sequence of specific hybrid with the CBACP gene order.

According to an aspect of of the present present invention, it provides a kind of isolating polynucleotide, and these nucleotide codings have the polypeptide of the aminoacid sequence of inferring shown in the SEQ ID No.2.

The polynucleotide of coding CBACP can separate from the cDNA library of many adults and fetus, as people's tire brain cDNA library.Polynucleotide sequence total length shown in the SEQ ID No.1 is 6006 base pairs, has open reading frame that contains the polypeptide of 1281 amino-acid residues of coding, and wherein 87-138 amino acids residue is speculated as this proteinic signal peptide part.Find relatively that according to amino acid sequence homology this polypeptide and mouse microtubule-actin crosslinking factor have 69% homogeny, 82% similarity, polypeptide wherein of the present invention has the characteristic primitive of calsequestrin family, i.e. EF hand calcium binding domains.

Polynucleotide of the present invention can RNA or the form of DNA exist, wherein DNA comprises cDNA, genomic dna and synthetic DNA.DNA can be two strands or strand, and strand also can be sense strand or antisense strand.The polynucleotide sequence of coded polypeptide can be identical with the polynucleotide sequence shown in the SEQ IDNo.1, perhaps one because the redundancy of genetic code or degeneracy and different polynucleotide sequences, but its and the SEQ ID No.1 identical mature polypeptide of encoding.

The polynucleotide of the polypeptide of coding SEQ ID No.2 can comprise: the only polynucleotide sequence of encoding mature polypeptide (as 1147-4992 position polynucleotide among the SEQ ID No.1), the polynucleotide sequence that comprises the encoding mature polypeptide and optional other encoding sequence or the polynucleotide sequence (as 1-6006 position polynucleotide among the SEQ ID No.1) of non-coding sequence (for example the polynucleotide sequence 5 ' end of intron or encoding mature polypeptide and/or the non-coding sequence of 3 ' end).

The invention further relates to the various variants of polynucleotide described above, their codings contain fragment, analogue and the derivative of the aminoacid sequence polypeptide of inferring shown in the SEQ ID No.2.These polynucleotide variants can be the polynucleotide variants that naturally occurring allele variant or non-natural exist.

The polynucleotide of code book invention polypeptide also may merge in same frame mutually with the specific markers sequence, and flag sequence can help the purifying of polypeptide of the present invention.Flag sequence can be six polyhistidine tags of pQE carrier when using host bacterium, be beneficial to merge the purifying of markd mature polypeptide, perhaps when using mammals host (as the fibroblastic COS-7 clone of monkey kidney), flag sequence can be a kind of hemagglutinin (HA) mark.In addition, the polynucleotide sequence that comprises code book invention polypeptide also can comprise homology or allogenic signal specific peptide sequence, is secreted into outside prokaryotic cell prokaryocyte or the eukaryotic cell membrane to help target protein matter.Those of ordinary skills know, and above-mentioned flag sequence and signal peptide sequence also can be added on the carrier that is used to express polypeptide of the present invention by recombination method or chemical method.

Polynucleotide sequence of the present invention also comprises the fragment of full-length cDNA, among the SEQ IDNo.2 that for example encodes at least 20, and preferably at least 30, more preferably at least 50, best at least 80 amino acid whose polynucleotide passages.These fragments for example have shown in the SEQ ID No.1 in the sequence at least 10 of successive, preferred at least 20 Nucleotide, preferred at least 50 Nucleotide, particularly at least 60,90,150 or 240 Nucleotide.

The invention further relates to can with the polynucleotide of above-mentioned sequence hybridization, have 70% at least between these two sequences, more preferably at least 80%, preferably at least 90%, more preferably at least 95% homology.The present invention be more particularly directed under stringent condition can with the polynucleotide of above-mentioned multi-nucleotide hybrid.Terminology used here " stringent condition " means between two sequences have 95%, and preferably at least 97% homology could be hybridized.In an embodiment preferred, kept substantially and identical biological function or the activity of polypeptide shown in the SEQ ID No.2 with the polypeptide of the polynucleotide encoding of above-mentioned polynucleotide complementary strand hybridization.

In addition, the present invention relates to can with the polynucleotide of multi-nucleotide hybrid of the present invention, it contains 20 bases at least, preferred at least 30 bases, more preferably at least 50 bases and have homology described above, it can keep or retentive activity not.For example, such polynucleotide can be used as the probe of the similar sequences that detects polynucleotide shown in the SEQ ID No.1 or other source; And for example, it can be used for the recovery of polynucleotide of the present invention or as a kind of diagnostic probe or PCR primer.

Dna sequence dna of the present invention can obtain with several different methods.For example, with hybridization technique DNA isolation well known in the art.These technology including, but not limited to: 1) with probe and genome or the hybridization of cDNA library to detect homology polynucleotide sequence and 2) antibody screening of expression library to be to detect the dna fragmentation of the clone with common structure feature.

The specific DNA fragment sequence of coding CBACP also can obtain with following method: 1) separate double chain DNA sequence from genomic dna; 2) the chemical synthesising DNA sequence is to obtain the double-stranded DNA of required polypeptide.

The standard method that separates interested cDNA is a separating mRNA and carry out reverse transcription from the donorcells of this gene of high expression level, forms plasmid or phage cDNA library.Extract the existing multiple proven technique of method of mRNA, test kit also can obtain (Qiagene) from commercial channels.And the construction cDNA library also is the known method of those skilled in the art (people such as Sambrook, " molecular cloning laboratory manual " (Molecular Cloning, a Laboratory Manual), cold spring harbor laboratory, New York, 1989).Also can obtain the cDNA library of commercial offers, as the different cDNA library of Clontech company.When being used in combination the polymeric enzyme reaction technology, even few expression product also can be cloned.

Available ordinary method is screened polynucleotide sequence of the present invention from these cDNA libraries.These methods include but not limited to: (1) DNA-DNA or DNA-RNA hybridization; (2) function of marker gene occurs or forfeiture; (3) level of the transcript of mensuration CBACP; (4) applied immunology technology or mensuration biologic activity detect the protein product of genetic expression.Aforesaid method can use separately, but also several different methods combined utilization.

In (1) kind method, hybridizing used probe can have homogeny with any part of polynucleotide of the present invention, and its length is 15 Nucleotide at least, preferably 20-30 Nucleotide, being more preferably 50-60 Nucleotide, most preferably is 100 more than the Nucleotide.Probe used herein is the dna sequence dna of chemosynthesis on the basis of gene DNA sequence information of the present invention normally.Gene of the present invention itself or fragment certainly are used as probe.Dna probe can be used radio isotope, fluorescein or enzyme marks such as (as alkaline phosphatases).In (4) the kind method, the protein product that detects CBACP genetic expression can be with immunological technique such as Western trace, radioimmunoprecipitation, enzyme-linked immunosorbent assay (ELISA) etc.

Because the application provides the full length cDNA sequence of CBACP, (Saiki waits the people to the method for application round pcr DNA amplification/RNA, science (Science) 1985; 230:1350-1354) preferentially be used to obtain gene of the present invention.When particularly being difficult to from the library, obtain the cDNA of total length, can preferably use RACE method (the terminal rapid amplifying method of RACE:cDNA), can suitably select according to sequence information of the present invention disclosed herein at primer used aspect the above-mentioned PCR, and available ordinary method is synthetic.Available ordinary method is as the DNA/RNA fragment by gel electrophoresis separation and purifying amplification.

The gene of the present invention that obtains as mentioned above, perhaps available ordinary method of the mensuration of the nucleotide sequence of various dna fragmentations such as dideoxy chain termination (people such as Sanger, institute of NAS newspaper, 1977,74:5463-5467).This class nucleotide sequencing is available commercial sequencing kit etc. also.In order to obtain the cDNA sequence of total length, order-checking need be carried out repeatedly.Sometimes need to measure a plurality of clones' cDNA sequence, to be spliced into the cDNA sequence of total length.

The all or part of of polynucleotide sequence of the present invention also can be by the known chemical process in this area synthetic (Caruthers, people such as M.H., (1980) Nucl.Acids Res.Symp.Ser.215-223; Horn, people such as T., (1980) Nucl.Acid Res.Symp.Ser.225-232).

The invention further relates to polypeptide and active fragments, analogue and derivative with putative amino acid sequence shown in the SEQ ID No.2.The polypeptide of putative amino acid sequence shown in the SEQ ID No.2 is a polypeptide that contains 1281 amino-acid residues.

" fragment " of polypeptide shown in the SEQ ID No.2, " derivative " and " analogue " refer to keep substantially the biological function of this polypeptide or the precursor of active polypeptide or non-activity.Thus, polypeptide of the present invention has comprised forms such as its preceding former albumen, preceding albumen and proteinogen, and it can be activated through processing back (as proteolysis or modification), produces an activated mature polypeptide.

Polypeptide of the present invention can be recombinant polypeptide, naturally occurring polypeptide or synthetic polypeptide, is preferably recombinant polypeptide.Fragment, derivative and the analogue of the polypeptide shown in the SEQ ID No.2 can be: (ⅰ) one or more amino-acid residues are replaced the polypeptide of (preferably conservative amino acid residue) by conservative property or non-conservation amino-acid residue, and the amino-acid residue yes or no of replacement is by the coded amino acid of genetic code.For example, can obtain silent mutation body or the function equivalent of CBACP by insertion, replacement and/or the deletion of amino-acid residue.Can replace based on carrying out conservative amino acid in the similarity of polarity, electric charge, solvability, hydrophobicity, wetting ability and/or aspect such as amphipathic between the amino-acid residue, as long as keep the activity of CBACP; Or (ⅱ) one or more amino-acid residues have the polypeptide of substituted radical; Or (ⅲ) mature polypeptide and other functional compound, the polypeptide that merges as the compound (for example polyoxyethylene glycol) that improves the polypeptide half life; Or (ⅳ) polypeptide that merges mutually of mature polypeptide and other aminoacid sequence, wherein said other aminoacid sequence comprises such as aminoacid sequence that helps the purifying maturation protein or proteinogen sequence etc.These help the structural domain of purifying to include but not limited to: metal-chelate is closed peptide, as is used for the Histidine-tryptophane module of purifying on immobilization metal; Be used for the albumin A structural domain of purifying on the immobilization immunoglobulin (Ig) and be used for FLAGS extension/affinity purification system structural domain (IMMUNEX company, Seattle, Wash).The fracture joint sequence that is specific to factor XA or enteropeptidase also can be used for helping the purifying of target protein matter (Porath, people such as J. (1992), Prot.Exp.Purif.3:263-281).From these disclosures, in the ken that should be in those skilled in the art of such fragment, derivative and analogue.

Polypeptide of the present invention comprises the polypeptide (referring in particular to mature polypeptide) shown in the SEQ ID No.2, also comprise the polypeptide that has 70% similarity (preferably 70% homogeny) with SEQ ID No.2 polypeptide at least, the polypeptide that preferably has 90% similarity (preferably 90% homogeny) at least, the polypeptide that more preferably has 95% similarity (preferably 95% homogeny) at least, the some parts that also comprises these polypeptide, these polypeptide portions contain 30 amino acid, preferred at least 50 amino acid at least usually.

Polypeptide of the present invention, its examples of conservative variations and bioactive fragment and derivative can prepare with conventional peptide synthetic method, for example solid-phase peptide is synthesized (Merrifield J. (1963), American Chemical Society's magazine (J.Am.Chem.Soc.) 85:2149-2154; Roberge, people such as J.Y., (1995) science, 269:202-204).Protein synthesis can be finished by hand, also can utilize automatic peptide synthesizer such as Applied Biosystems 431A peptide synthesizer to carry out (Perkin Elmer).Polypeptide of the present invention also can obtain through separation and purification from natural biologic material, but preferably utilizes polynucleotide provided by the invention to prepare with recombinant DNA technology.According to host's difference used in the recombinant method for production, the polypeptide among the present invention may be by glycosylation or not by glycosylation.This polypeptide also may have initial methionine residues.

According to common recombinant DNA technology, utilize polynucleotide sequence of the present invention can express or prepare CBACP polypeptide (science, 1984 of reorganization; 224:1431).The present invention thereby relate to the method for preparing CBACP polypeptide of the present invention generally comprises following steps:

(1) transforms proper host cell with the encode polynucleotide (or variant) of CBACP or the recombinant expression vector that contains these polynucleotide of the present invention;

(2) in suitable medium and under the suitable culture condition, cultivate host cell;

(3) separation, purifying target protein matter from substratum or cell.

The present invention also relates to comprise polynucleotide of the present invention recombinant vectors, have the genetically engineered host cell of recombinant vectors of the present invention and prepare the method for polypeptide of the present invention by recombinant technology.

Polynucleotide of the present invention can be used for producing polypeptide through recombinant technology.For example, these polynucleotide may reside in and are selected from the multiple arbitrary carrier that is used for the expression vector of express polypeptide, these carriers comprise chromosomal, achromosomal and synthetic dna sequence dna, for example, the derivative of SV40, bacterial plasmid, phage DNA, yeast plasmid, be derived from plasmid and phage DNA bonded carrier, viral DNA, baculovirus, vaccinia virus, adenovirus, fowlpox virus and Pseudorabies virus include but not limited to pQE series (Qiagen), pBS, pD10, phagescript, psiX174, pBluescript SK, pBSKS, pNH series (Stratagene), pTRC99a, pKK223-3, pDR540, pRIT5 (Pharmacia); PWLNEO, pSV2CAT, pOG44, pXT1, pSG (Stratagene), pSVK3, pBPV, pMSG, pSVL (Pharmacia).But, so long as can duplicate in the host and survive, other plasmid or carrier also can be used.

The present invention also comprises the recombinant precursor that contains polynucleotide of the present invention.This construct comprises carrier, as above-mentioned plasmid or virus vector, wherein can insert polynucleotide sequence of the present invention forward or backwards.Also comprise the adjusting sequence in the construct, for example, be connected to the promotor (comprising composing type and inducible promoter) on the polynucleotide sequence of the present invention effectively, mediate transcribing of downstream configurations sequence.Suitable promotor includes but not limited to, the PL promotor of lambda particles phage, baculovirus polyhedrin body protein promotor; The bacterium promotor as; LacI, LacZ, T3, T7, gpt, λ PR, PL and trp; Eukaryotic promoter is as: CMV immediate early promoter, HSV thymidine kinase promoter, early stage and late period SV40 promotor, retroviral LTR and mouse metallothionein(MT) I promotor; Also comprise derived from the promotor in the vegetable cell genome, as heat shock protein(HSP), RUBISCO promotor.

Expression vector also comprises needed ribosome bind site of translation initiation and transcription terminator, and it can also have the proper sequence that strengthens expression, as enhanser.Enhanser is the cis acting factor of DNA, and about 10-300bp is arranged usually, acts on promotor, improves transcribing of it.For example, be positioned at the enhanser at replication orgin rear side 100-270bp place among the SV40, the sub-enhanser of cytomegalovirus early promoter, the polyoma enhanser that is positioned at the replication orgin rear side and adenovirus enhanser.In addition, expression vector preferably also comprises one or more selected genes, resistant gene and/or the marker gene that phenotypic characteristic can be provided, so that the screening of transformed host cell.Selected gene utilizes trpB, the hisD (Hartman, S.C., and institute of R.C.Mulligan (1988) NAS reports 85:8047-51) of indoles or histidinol as helping cell, is used for tk ^-Or aprt ^-Liver simplexvirus thymidine kinase of cell (Wigler, people such as M. (1977) cell 11:223-32) and adenine phosphoribosyltransferase (Lowy, people such as I. (1980) cell 22:817-23); Resistant gene is as giving the Tetrahydrofolate dehydrogenase DHFR (Wigler of methotrexate resistance, M. wait people (1989), institute of NAS newspaper, 77:3567-70) or compose the npt (Colbere-Garapin of sub-Xin Meisu and G-418 resistance, F. wait people (1981) molecular biology magazine (J.Mol.Biol.), 150:1-14), and tsiklomitsin or ampicillin resistance gene.The mammals expression vector generally comprises replication orgin, suitable promotor, enhanser and any essential ribosome bind site, polyadenous glycosidation site, splicing donor and acceptor site, transcription termination sequence and 5 ' flank non-transcribed sequence.The dna sequence dna and the polyadenous glycosidation site that are derived from SV40 splicing sequence can be used for providing needed non-transcribed genetic elements.In addition, the carrier that comprises the nucleotide sequence of code book invention polypeptide also can comprise homology or allogenic signal specific peptide sequence, is secreted into outside prokaryotic cell prokaryocyte or the eukaryotic cell membrane to help target protein matter.Those of ordinary skills know, and flag sequence that contains in above-mentioned expression carrying agent and the construct and signal peptide sequence also can be added on the polynucleotide of code book invention polypeptide by recombination method or chemical method.

Suitable carrier and promotor to be chosen as those of ordinary skills known.The effective expression carrier that bacterium is suitable for can make up like this: the structural DNA sequence of the target protein of will encoding is inserted in the steerable reading frame that has function in company with suitable translation initiation and termination signal.Those of ordinary skills are known to be used to make up and to contain nucleotide sequence of the present invention and suitable transcribing and the method for translational control element.These methods comprise genetic recombination techniques (Sambrook, J. (1989), " molecular cloning, laboratory manual ", Cold Spring Harbor Press in extracorporeal recombinant DNA technology, synthetic technology and the body; Plainview, N.Y.; Ausubel, F.M. (1989) modern molecular biology method (Current Protocols in MolecularBiology), John Wiley﹠amp; Sons, N.Y.).

Comprise above-mentioned suitable dna sequence dna, suitable promotor or the carrier of control sequence and can be used to transform appropriate host, allow this albumen of host expresses.

Those skilled in the art know, and the expression vector that dna sequence dna inserted according to the present invention or the kind of construct and characteristic select appropriate host to express target protein matter.The host who is suitable for expressing polypeptide of the present invention includes but not limited to: prokaryotic hosts, such as intestinal bacteria, bacillus, streptomyces etc.; Eucaryon host, such as: yeast belong, Aspergillus, insect cell, such as fruit bat S2 and fall army worm Sf9; Zooblast can be expressed the clone of compatible carrier, for example C127,3T3, CHO, HeLa, BHK, Bowes melanoma cells as CHO, COS (monkey kidney fibroblast, Gluzman, cell, 23:175,1981) and other; Vegetable cell and adenovirus or the like.The culture systems of various mammalian cells also can be used for express recombinant protein.From these instruction, the selection of suitable host should be in those skilled in the art's ken.

Having aforesaid carrier or the construct that contains nucleotide sequence of the present invention can import in the proper host cell to produce recombinant products by traditional method.The method that construct is imported above-mentioned host cell is known for those skilled in the art, include but not limited to: transfection, electroporation, microinjection, particle bombardment method or the particle gun method (Sambrook of the conversion of calcium chloride mediation, calcium phosphate transfection, the mediation of DEAE-dextran, J. (1989), " molecular cloning, laboratory manual ", Cold Spring Harbor Press; Plainview, N.Y.; Ausubel, the modern molecular biosciences method of F.M. (1989), John Wiley ﹠amp; Sons, N.Y.; Hobbs, people such as S., McGraw Hill science and technology yearbook (1992), McGraw Hill, N.Y.191-196; Engelhard, people such as E.K., institute of NAS newspaper, 91:3224-3227; Logan, people such as J., institute of NAS newspaper, 81:3655-3659).

In suitable culture condition and substratum, cultivate through host transformed bacterial strain or cell, it is grown into after the appropriate cell density, induce selected promotor with appropriate means (for example temperature transition or pharmaceutical chemicals are induced), and cell is cultivated for some time again.At different host strains or cell select and the corresponding culture condition of character of expressed target protein matter and substratum within those skilled in the art's ken.

Under suitable promotor control, can in cells of mamma animals, yeast, bacterium or other cell, express maturation protein.Utilization also can produce this protein (Sambrook, J. (1989), " molecular cloning, laboratory manual ", the 18th chapter the 4th joint, Cold Spring Harbor Press with the cell free translation system by DNA construct derived RNA of the present invention; Plainview, N.Y.).

Usually with centrifugation method harvested cell or nutrient solution.The situation in the born of the same parents is stayed in quality guarantee for target protein, general available any physics easily, chemical process or enzyme process, comprise freeze-thaw cycle, ultrasonic wave, Mechanical Crushing, or use cell lytic agent or specific enzyme smudge cells, crude extract is kept to be further purified.For be secreted into the outer situation of born of the same parents for target protein matter, can directly reclaim culture supernatant.These methods all are well-known to those having ordinary skill in the art.

Polypeptide can reclaim from the reconstitution cell culture and purifying comes out, and the method for recovery and purifying has ammonium sulfate or ethanol sedimentation, acid extraction, negatively charged ion or cation-exchange chromatography, volume-exclusion chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxyapatite chromatography and phytohemagglutinin chromatography.Form ripe proteic complete conformation and also need proteinic refolding step.Usually high performance liquid chromatography (HPLC) or capillary electrophoresis can be applicable to last purification step.

Polynucleotide among the present invention and polypeptide can be used as research reagent and material, to find human treatment of diseases and diagnostic method.This polynucleotide and its encoded polypeptides also can be used for the research of external related science, DNA is synthetic and the preparation of dna vector, also are used to design the method for treatment and diagnosing human disease.

The fragment of total length CBACT gene can be as the hybridization probe in cDNA library, thereby isolates full-length gene and sequence similarity is highly arranged or other gene of similar biologic activity with it.Such probe generally has 20 bases at least.But these probes preferably have 30 bases at least and generally are no more than 50 bases, although they can have more base.This probe also can be used to identify corresponding to the cDNA clone of total length transcript or have complete genome, comprise the genomic clone of adjusting and promoter region, exon and intron.The screening a kind of method be, utilize known dna sequence dna to synthesize an oligonucleotide probe, isolate the coding region of gene with it.Can be used for screening human cDNA library, genomic library, mRNA library with polynucleotide sequence complementary of the present invention through the oligonucleotide of mark, with determine in the library which member can with probe hybridization.

Can utilize partial nucleotide sequence and utilize the nucleotide sequence of means known in the art stretched-out coding CBACP, to detect its upstream sequence as promotor and controlling element.For example, can utilize universal primer to pass through restriction site PCR (RESTRICTION-SITE PCR) to give the unknown nucleotide sequence adjacent (Sarkar, G. (1993) PCR method is used (PCR MethodApplic.) 2:318-322) for change with the known seat.Utilize different primers by reverse transcription PCR amplification or extension sequence (Triglia, people such as T., (1988), nucleic acids research (Nucleic AcidsRes.) 16:8186) based on known region.Other available PCR method comprise catches PCR (capture PCR), carries out pcr amplification ((1991) PCR method is used 1:111-119 for Lagerstrom, people such as M) as the dna fragmentation with contiguous people and yeast artificial chromosome dna.In addition, those skilled in the art also can utilize nested primer (nested primer) and PromoterFinder by PCR ^TMThe library carry out the genomic dna walking (Clontech, Palo Alto, Calif.).

The invention still further relates to and utilize the CBACP gene product to detect and suddenly change relevant disease or of the polynucleotide sequence of CBACP the diagnostic method of the susceptibility of disease.These diseases are relevant with the mRNA and the encoded protein matter abnormal expression of CBACP gene of the present invention, for example recovery or enhancing neural function, treatment ephrosis, anaemia, heart trouble, cancer etc.The antagonist of polypeptide of the present invention or antisense polynucleotides may be used for the treatment of ventricular hypertrophy disease, cancer etc.

Can on the level of DNA, detect the individuality of CBACP transgenation with various technology.Diagnostic nucleic acid can obtain from patient's cell, for example blood, urine, saliva, examination of living tissue and necrotomy material.Genomic dna can be directly used in detection, also can be before check and analysis carries out enzyme process amplification people such as (, natural 324:163-166,1986) Saiki with PCR.RNA or cDNA also can be used for same purpose.For example, can be used to identify and analyze the sudden change of CBACP gene with the nucleic acid complementary PCR primer of coding CBACP gene.For example, from comparing the variation of generation with normal genotype, the size of amplified production can detect disappearance and/or insert sudden change.But, perhaps use radio-labeling CBACP antisense dna sequence to hybridize with the DNA and the sudden change of radiolabeled CBACP RNA hybridization check point of amplification.Digest or can distinguish the duplex of complete paired sequence and mispairing from the different or change of melting temperature(Tm) with RNA enzyme A.

By detecting the variation of dna fragmentation electrophoretic mobility in the gel that contains or do not contain denaturing agent, can carry out genetics test based on dna sequence dna difference.The disappearance of little sequence and insertion can be found out from high-resolution gel electrophoresis.For example, the dna fragmentation of different sizes can distinguish in denaturing polyacrylamide gel electrophoresis (PAGE).The dna sequence dna that contains point mutation can not distinguished and come in conforming to the polyacrylamide gel of denaturing agent after the sex change respectively with normal dna sequence dna because of different (the mobility speed differences) of conformation.

Nuclease protection experiment can disclose the sequence variation of specific position, such as RNA enzyme and S1 enzyme protection method or chemical break method (people such as Cotton, institute of NAS reports 85:4397-4401,1985).

Part or all of polynucleotide of the present invention can be used as probe stationary on microarray (Microarray) or DNA chip (being called gene chip again), is used for analyzing the differential expression analysis and the gene diagnosis of tissue gene.

In a word, specific DNA sequence can detect with following method: the Southern engram technology of hybridization, RNA enzyme protection, chemistry fracture, direct dna sequencing or use restriction enzyme (for example, the polymorphism RFLP of limited fragment length) and genomic dna.

Except more traditional gel electrophoresis and dna sequencing method, the also available original position analyzing and testing of suddenling change is come out.

The present invention also relates to be used for detect the diagnostic method of the mRNA abnormal expression of various tissue CBACP genes.Methods such as the available reverse transcription PCR of the variation of mRNA level (RT-PCR), Northern trace, dot blot or RNA in situ hybridization detect.These methods are known for a person skilled in the art.

The invention still further relates to and be used for detecting the diagnostic method that various tissue CBACP gene protein levels change, compare the proteic minimizing detectable disease of CBACP or to exist (as ephrosis, anaemia, heart trouble, the cancer etc.) of disease susceptibility with the normal control tissue sample.The method of measuring CBACP gene protein level in host's sample is well known to those skilled in the art, comprises radioimmunoassay, competitive binding assay method, western engram analysis, enzyme-linked immunosorbent assay and sandwich assay.Enzyme-linked immunosorbent assay (ELISA) (people such as Coligan, modern immunological method (Current Protocols in Immunology) volume 1, No.2, the 6th chapter, 1991) will be prepared the antigenic specific antibody at CBACP in advance, preferably monoclonal antibody.In addition, also to prepare the report antibody of anti-monoclonal antibody.Be connected with a detectable reagent on the report antibody, such as marks such as radio isotope, fluorescence or horseradish peroxidases.For example, from the host obtain sample and on a solid phase carrier incubation, polystyrene reactant plate for example, its albumen in can adsorption sample.Use a kind of nonspecific proteins such as bovine serum albumin (BSA) incubation then, any free protein binding site on the wrapper plate.Second step added monoclonal antibody incubation in plate, at this moment, monoclonal antibody with combine attached to the CBACP gene protein on the polystyrene reactant plate.All are not in conjunction with last monoclonal anti body and function damping fluid flush away.The report antibody that links to each other with horseradish peroxidase adds in the entering plate at this moment, the result report antibody just be combined in CBACP antigen on monoclonal antibody combine.Do not washed off in conjunction with last report antibody yet.The substrate that adds peroxidase then, the depth of formed color and typical curve are made comparisons in the regular hour, just can measure the content of CBACP gene protein in the patient samples of certain volume.

Competition assay also can be used for this detection.The antigenic specific antibody of CBACP is linked on the solid phase carrier, allow the CBACP of mark then and the sample that obtains from the host together by the quantity of solid phase carrier and certification mark thing, for example use the liquid phase scintillometer.The quantity of CBACP in the quantity of marker and the sample is relevant.Sandwich assay is similar to enzyme-linked immunosorbent assay, comprises dual-antigen sandwich method and double antibody sandwich method.In the double-antibody sandwich assay method, CBACP is by solid carrier, with the antibodies that is adsorbed on the solid phase carrier.Second kind of antibody is attached on the CBACP again.The third antibody be labeled and second kind of antibody had specificity, when it just is attached on second kind of antibody during by solid phase carrier, detect its quantity then.

Based on the similarity of CBACP of the present invention and known calcium binding protein family, CBACP or its polynucleotide of encoding may be used for recovering or strengthen neural function, treatment ephrosis, anaemia, heart trouble, cancer etc.The antagonist of polypeptide of the present invention or antisense polynucleotides may be used for the treatment of ventricular hypertrophy disease, cancer etc.

People's such as Stossel United States Patent (USP) 5,260,224 (mandate on November 9th, 1993) discloses a kind of method of treatment and Actin muscle relative disease.The damage of animal tissues causes Actin muscle to be discharged into born of the same parents' outer (comprising blood), a large amount of Actin muscles that from dying cell, discharge increased the extracellular fluid body viscosity, catch cell and/or produce other unknown toxic side effect.Experiment shows, inject the free outward Actin muscle of born of the same parents to animal tissues especially to kidney and the toxic effect of blood circulation (Harper, people such as K.D., clinical study (Clin.Res.) 36:625A (1988); Haddad, people such as J.G., institute of NAS reports 87:1381-1385 (1990)).Acute renal depletion is a kind of muscle injury syndrome, and the infusion Actin muscle causes the instantaneous rising of BUN and creatinine levels in the rat, concurrent kidney depletion.In addition, because the outer Actin muscle molecule of each thread born of the same parents has a kind of ADP of bonded with it molecule, the existence of the outer Actin muscle of born of the same parents can cause or increase the disadvantageous platelet aggregation of experimenter (Lind, people such as S.E., Am.Rev.Respir.Dis138:429-434 (1988) in the blood; People such as Scarborough, biological chemistry biophysical studies communication 100:1314-1319 (1981)).Therefore, the present invention also comprises polypeptide of the present invention or its biological active fragment and stand-in thereof, agonist directly is infused in patient's the blood, by eliminate in conjunction with Actin muscle or in and the activity of the Actin muscle of the outer excessive existence of born of the same parents, alleviate or treatment owing to be discharged into the disease that the Actin muscle in the blood causes.

Therefore, comprise that the humans and animals experimenter treats the CBACP of effective dose, its biologically active derivatives or agonist, can treat, alleviate and/or prevent to be selected from following disease:

Neuropathy includes but not limited to neural wound; Muscular dystrophy (Du Xingshi and becker type muscular dystrophy) etc.; Ephrosis such as renal insufficiency; Hemolytic anemia such as hereditary spherocytosis, acquired hemolytic anemia etc.

Comprise that the humans and animals experimenter treats the CBACP antagonist or the inhibitor of effective dose, can treat, alleviates and/or prevent to be selected from following disease: ventricular hypertrophy disease, cancer etc.

The fragment of CBACP polypeptide and biologically active thereof, analogue and derivative can use in composition with pharmaceutical acceptable carrier, comprise polypeptide and the pharmaceutically acceptable carrier or the vehicle of dose therapeutically effective in such composition.Such carrier is including but not limited to salt solution, buffer saline, dextrose, water, glycerine, ethanol and combination thereof.Preparation should be fit to administering mode.

Pharmaceutical composition of the present invention also comprises the vaccine that utilizes polypeptide preparation of the present invention, it comprises that polypeptide of the present invention or its have the fragment of biologic activity or immunologic competence, wherein randomly also contains Freund's complete adjuvant, Freund's incomplete adjuvant and other pharmaceutically acceptable carrier.

The present invention also provides a kind of drug packages or test kit, comprises one or more containers that the composition of one or more pharmaceutical compositions of the present invention is housed.In addition, the fragment of these polypeptide and biologically active thereof, analogue and derivative also can be used in combination with other treatment compound.

These pharmaceutical compositions can be with the administration of a kind of mode easily, such as in epidermis, intravenously, intraperitoneal, intramuscular, the tumour, in subcutaneous, the nose or the intradermal approach.These pharmaceutical compositions use with the effective dose that treats and/or prevents concrete indication.

CBACP polynucleotide of the present invention can be used for gene therapy, through expression in vivo CBACP or utilize antisense technology and reach therapeutic purpose.

Gene therapy method for example comprises polynucleotide (DNA or the RNA) through engineering approaches of patient's cell being used coding CBACP polypeptide under the situation of exsomatizing, again the cell of through engineering approaches is supplied with patient to be treated.Such method is that everybody is familiar with in this area.For example, can carry out cell engineeringization with the retroviral particle of the RNA that comprises code book invention CBACP polypeptide.

Equally, with method known in the art in vivo the through engineering approaches cell with the expression in vivo polypeptide.As known in the art, the production cell that is used to produce the retroviral particle of the RNA that contains code book invention polypeptide can inject in the patient body, makes the cells in vivo through engineering approaches and expresses this polypeptide in vivo.From instruction of the present invention, these and other polypeptide administering mode is very clearly for those skilled in the art.For example except retrovirus, else be used for the expression vector of through engineering approaches cell in addition, adenovirus for example is it and through engineering approaches cell in vivo after a suitable transport agent combines.

The retrovirus that can derive above-mentioned retroviral plasmid vector includes but not limited to Moloney murine leukemia virus, spleen necrosis virus, Rous sarcoma virus, Harvey sarcoma virus, avian leukosis virus, gibbon ape leukemia virus, human immunodeficiency virus, adenovirus, myeloproliferative sarcoma virus and mammal tumor virus.

Can comprise one or more promotors in the above-mentioned carrier.Spendable suitable promotor includes but not limited to retroviral LTR, SV40 promotor, human cytomegalic inclusion disease virus (CMV) promotor (Miller: biotechnology (Biotechniques), volume 7, No.9, the 980-990 page or leaf, 1989) or other promotor (for example, the eukaryotic cell promotor includes, but are not limited to histone, po III, beta-actin promotor).Other available viral promotors includes but not limited to adenovirus promoter, thymidine kinase (TK) promotor and B19 parvovirus promotor.From the instruction here, being chosen within those skilled in the art's ken of suitable promotor.

The polynucleotide sequence of code book invention polypeptide should be under the control of suitable promotor.Suitable promotor includes but not limited to that the promotor of adenovirus is such as adenovirus major late promoter; Or allogeneic promoter, such as cytomegalovirus (CMV) promotor; Respiratory syncytial virus (RSV) promotor; Inducible promoter is such as MMT promotor, metallothionein promoter; The heat-shocked promotor; Albumin promoter; ApoA I promotor; People's globin promotor; Viral thymidine kinase promoter is such as the herpes simplex thymidine kinase promoter; Retroviral LTR (the retroviral LTR that comprises modification described above); The beta-actin promotor; And human growth hormone promotor.It also can be self promotor of the gene of this polypeptide of control coding.

Form production clone with retroviral plasmid vector transduction package cell line.The packing cell that is used for transfection comprises, but be not restricted to, PE501, PA317, ψ-2, ψ-AM, PA12, T19-14X, VT-19-17-H2, ψ CRE, ψ CRIP, GP+E-86, GP+envAM12 and DNA clone, as Miller (human gene therapy (Human GeneTherapy) is described, volume 1, the 5-14 page or leaf, 1990), be incorporated herein by reference in full herein.The currently known methods of available this area carrier transduction package cell line.These methods include but not limited to, electroporation, use liposome and calcium phosphate precipitation.A kind of selectable method be the reverse transcription plasmid vector is wrapped up in the liposome or with the lipid coupling, inject the host then.

Production clone produces the infective retroviral particle of tool, comprises the nucleotide sequence of these polypeptide of encoding in this virion.This retroviral vector particle can be used for external or the interior transfecting eukaryotic cells of body.Transfected eukaryotic cell will be expressed the nucleic acid encoding sequence.The eukaryotic cell that can be used for transfection includes but not limited to embryonic stem cell, embryo cells, hemopoietic stem cell, liver cell, inoblast, sarcoplast, keratinocyte, endotheliocyte and bronchial epithelial cell.

On the other hand, utilize expression in vivo that antisense technology can change polypeptide of the present invention also with treatment relevant with expression of polypeptides disease.Can utilize the antisense molecule (DNA, RNA, or peptide nucleic acid(PNA) (PNA)) of CBACP gene coding region, control or regulatory region.Recently, reported in the document and utilized the application (Gee of triple helical DNA in treatment, J.E. wait the people, (1994) in Huber, B.E. and B.I.Carr, molecule and immunological method (Molecular and ImmunologicApproaches), Futura Publishing Co., Mt.Kisco, N.Y., 163-177 page or leaf).Complementary sequence or antisense molecule also can combine to stop the translation of mRNA with ribosomal by preventing transcript.

" peptide nucleic acid(PNA) " is meant a kind of antisense molecule or anti-gene thing, and it comprises the oligonucleotide that is connected with the peptide backbone of the amino-acid residue that ends up with Methionin, and the length of oligonucleotide is at least 5 Nucleotide.Terminal Methionin is given the solvability to composition.Peptide nucleic acid(PNA) is preferentially in conjunction with complementary single stranded DNA or RNA, stops the extension of transcribing, also can prolong its half life in cell (Nielsen, people such as P.E., (1993) antitumor drug research (Anticancer DrugRes.), 8:53-63).

Polypeptide and fragment thereof, derivative or analogue or the cell of expressing them can be used as immunogen to produce its antibody.These antibody can be polyclone or monoclonal antibody.The present invention has also comprised chimeric, strand and product humanized antibody and Fab fragment or Fab expression library.The whole bag of tricks known in the art can be used for such antibody and segmental generation.

The antibody at polypeptide of the present invention that is produced can obtain by directly polypeptide of the present invention being injected to animal or it being imported animal (preferably not being the people).Resulting antibody can combine with polypeptide is own.Also can obtain antibody in this way, even with a fragment sequence of code book invention polypeptide in conjunction with whole natural polypeptides.Then, antibody can be used to polypeptide is separated from the tissue of expressing it.

The preparation monoclonal antibody can be cultivated the technology that produces antibody with continuous cell line.For example, with hybridoma technology (Kohle ﹠amp; Milstein: natural 256:495-497,1975), Trioma technology, human B cell hybridoma technology (people such as Kozbor, immunology today (ImmunologyToday) 4:72,1983) and the EBV-hybridoma technology produce people's monoclonal antibody (people such as Cole, monoclonal antibody and cancer therapy (Monoclonal Antibodies and CancerTherapy), Alan R.Liss, Inc., 77-96,1985).

Single-chain antibody generating technique (United States Patent (USP) 4,946,778) is applicable to the single-chain antibody that produces immunogenic polypeptide product of the present invention.Transgenic animal also can be used to express the humanized antibody of immunogenic polypeptide product of the present invention.

The invention still further relates to the method for agonist, antagonist and the inhibitor of a kind of CBACP of screening, comprise the molecule that can suppress or stimulate the CBACP function that uses polypeptide of the present invention or its fragment screening peptide library or drug candidates library to be used to seek therapeutic value.The screening of the agonist of polypeptide of the present invention, antagonist and inhibitor can utilize the known method of those of ordinary skills to carry out.The present invention also provides screening of medicaments to identify the method that improves (agonist) or check the active medicine of (antagonist) CBACP.The activity of many physiological processs such as agonist raising CBACP participation gene regulating, DNA synthesize, the release of brain neurotransmitter, cell cycle regulating, Muscle contraction, protein secreting, mitotic division, and the antagonist prevention disease that unusual relevant disorder causes with treatment and above-mentioned physiological process.For example, the film preparation of mammalian cell or expression CBACP can be cultivated by the CBACP with mark in the presence of medicine.Measure the medicine raising then or check this interactional ability.The proteic antagonist of CBACP can and be eliminated its function with people CBACP protein binding, or suppresses the proteic generation of people CBACP, or combines with the avtive spot of polypeptide and to make polypeptide can not bring into play biological function.In SCREENED COMPOUND during as antagonist, people CBACP albumen that can this kind is new adds during bioanalysis measures, and testing compound influences the new people CBACP albumen of this kind and the interaction between its acceptor determines whether compound is antagonist by measuring.With the same quadrat method of above-mentioned SCREENED COMPOUND, can filter out the molecule of antagonist action.The CBACP that these obtain by the inventive method or its segmental agonist, antagonist and inhibitor can be mixed with pharmaceutical composition as mentioned above and be used for above-mentioned treatment of diseases.

The present invention will further describe in the following embodiments.But the present invention is not limited to these embodiment.All parts and amount, except as otherwise noted all by weight.

" digestion " of DNA refers to restriction enzyme DNA be carried out the catalytic cutting, and restriction enzyme only acts on the specific site of dna sequence dna.Here used various restriction enzymes can obtain from commerce, and their reaction conditions, cofactor and other requirement are according to the application known to the those skilled in the art.In order to analyze needs, in the buffered soln of about 20 μ l, add the enzyme of 1 μ g plasmid or dna fragmentation and about 2 units usually.For the DNA isolation fragment is used for plasmid construction, usually in a bigger volume with the DNA of enzymic digestion 5 to the 50 μ g of 20 to 250 units.Manufacturer can indicate the suitable damping fluid of special restriction enzyme and the amount of substrate.Usually the used incubation time approximately be 37 ℃ one hour, but can change to some extent according to the indication of producer.Directly on polyacrylamide gel, carry out electrophoresis after the restrictive diges-tion, isolate the fragment of wanting.

Separate available 8% polyacrylamide gel (people such as Goedde, nucleic acids research 8:4057,1980) according to the clip size that is cut into.

" connection " refers to form the process of phosphodiester bond between two double stranded nucleic acid fragments.Unless method for distinguishing is provided, connection can be carried out under known damping fluid and condition, and the dna fragmentation that is used to connect of the about equimolar amount of promptly every 0.5mg adds the T4 dna ligase of 10 units (" ligase enzyme ").

Except as otherwise noted, Graham ﹠amp is all used in conversion; Van der Eb: virusology (Virology) 52:456-457, the method described in 1973 is carried out.

The clone of embodiment 1:CBACP cDNA

Extract the total RNA of people's tire brain with guanidinium isothiocyanate/phenol/chloroform single stage method.From total RNA, separate poly (A) mRNA with Quik mRNA separating kit (Qiagene company product).2 μ gpoly (A) mRNA form cDNA (method is referring to molecular cloning experiment guide second edition) through reverse transcription PCR.CDNA fragment orientation is inserted on the multiple clone site of pUC118 carrier transformed into escherichia coli DH5 α construction cDNA library with Smart cDNA clone's test kit (available from Clontech).Obtain 3088 clones altogether.Measure all clones' 5 ' and 3 ' terminal sequence with two deoxidation cessation method.CDNA sequence and the existing public dna sequence data storehouse (Genebank) measured are compared, found that the cDNA sequence of one of them clone 0311B12 is new DNA.By synthetic a series of primers the contained insertion cDNA fragment of this clone is carried out two-way sequencing.The result shows, the contained full-length cDNA of 0311B12 clone is 6006bp (shown in Seq ID NO:1), from 1147bp to 4992bp the open reading frame of a 3846bp is arranged, encoding one contains 1281 amino acid whose protein (shown in Seq ID NO:2).We are with this protein called after CBACP.Embodiment 2: with RT-PCR method clone CBACP gene

With the total RNA of fetus brain cell is template, with Oligo-dT is that primer carries out the synthetic cDNA (method is referring to molecular cloning experiment guide second edition) of reverse transcription PCR reaction, behind the test kit purifying with Qiagene, carry out pcr amplification with following primer: primer 1:5 '-CCAAAAATTACAAATGGCAGAGACTTG-3 ' (SEQ IDNO.3) is positioned at the section start of SEQID NO1; Primer 2: 5 '-TATATTCAAGTGAATATGTTTTATTAA-3 ' (SEQ IDNO.4) is positioned at the 5980-6006bp of SEQ ID NO 1.The condition of amplified reaction: in the reaction volume of 50 μ l, contain 50mmol/L KCl, 10mmol/LTris-Cl, (pH8.5), 1.5mmol/L MgCl2,200 μ mol/L dNTP, 10pmol primer, the Taq archaeal dna polymerase of 1U (Clontech company product).Go up by 25 cycles of following conditioned response at PE9600 type DNA thermal cycler (Perkin-Elmer company): 94 ℃ 30 seconds; 55 ℃, 30 seconds; 72 ℃ 2 minutes.When RT-PCR, establish the blank negative contrast of template.Amplified production is connected to (Invitrogen company product) on the pCR carrier with the test kit purifying of QIAGENE company with TA clone test kit.DNA row analytical results shows that the dna sequence dna of PCR product and the 1-6006bp shown in the SEQ ID NO:1 are identical.Embodiment 3: the vivoexpression of recombinant C BACP, separation and purifying

Respectively at CBACP gene start codon place and the terminator codon place designed a pair of primer,

Primer 3:5 '-CATATGATGCAGGCTGCCGTTCAGTACCAGG-3 ' (SEQ ID NO:5)

Primer 4:5 '-GTCGACATTGCACTATCTCTTTGAGGAC-3 ' (SEQIDNO:6)

5 ' end of these two sections primers contains Nde I and Sa II restriction enzyme site respectively, be respectively the encoding sequence of target gene 5 end and 3 ' end thereafter, Nde I and Sa II restriction enzyme site are corresponding to expression vector plasmid pET-28b (+) (Novagen company product, Cat.No.69865.3) the selectivity restriction enzyme site on.With the pBS-0311b12 plasmid that contains the total length goal gene is template, carries out pcr amplification and obtains CBACP genes encoding region sequence.The PCR reaction conditions is: contain pBS-0311b12 plasmid 10pg, primer 3 and primer 4 among the cumulative volume 50 μ l and be respectively 10pmmol, Advantagepolymerase Mix (Clontech company product) 1 μ l.Loop parameter: 94 ℃ 20 seconds, 60 ℃ 30 seconds, 72 ℃ 2 minutes, totally 25 circulations.Respectively amplified production and plasmid pET-28 (+) are carried out double digestion with Nde I and Sa II, reclaim big fragment respectively, and connect with the T4 ligase enzyme.Connect product and transform, after the dull and stereotyped overnight incubation of the LB that contains kantlex (final concentration 30 μ g/ml), use the colony polymerase chain reaction (PCR) method screening positive clone, and check order with the big enterobacterial DH5 of Calcium Chloride Method α.Select the correct positive colony of sequence (pET-0311b12) with Calcium Chloride Method with recombinant plasmid transformed e. coli bl21 (DE3) plySs (Novagen company product).In the LB liquid nutrient medium that contains kantlex (final concentration 30 μ g/ml), host bacterium BL21 (pET-311b02) is cultured to logarithmic phase at 37 ℃, adds IPTG to final concentration 1mmol/L, continues to cultivate 5 hours.Centrifugal collection thalline, through the broken bacterium of ultrasonic wave, centrifugal collection supernatant with carrying out chromatography with 6 Histidines (6His-Tag) bonded affinity column His.Bind Quick Cartridge (Novagen company product), has obtained the target protein CBP141 of purifying.Through the SDS-PAGE electrophoresis, obtain a single band at the 141kDa place.This band is transferred on the pvdf membrane carries out the n terminal amino acid sequential analysis with the Edams hydrolysis method, 15 amino acid of N-end hold 15 amino-acid residues identical with the N-shown in the SEQ ID NO:2 as a result.Embodiment 4: anti-CBACP production of antibodies

Synthesize the specific polypeptide of following CBACP with Peptide synthesizer (PE company product):

NH ₂-Asp-Trp-Val-Asp-Ile-Ala-Gly-Gly-Lys-Leu-Ala-Ser-Met-Ser-Pro-COOH(SEQ?ID?NO：7)。

Form compoundly with hemocyanin and bovine serum albumin coupling this polypeptide respectively, method waits the people, immunochemistry (Immunochemistry), 1969 referring to Avrameas; 6:43.Add the complete Freund's adjuvant immunizing rabbit with the above-mentioned hemocyanin polypeptide complex of 4mg, add the incomplete Freund's adjuvant booster immunization once with the hemocyanin polypeptide complex again after 15 days.Employing is done the titre that ELISA measures antibody in the rabbit anteserum through the titer plate of 15 μ g/ml bovine serum albumin polypeptide complex bag quilts.From the rabbit anteserum of antibody positive, separate total IgG with albumin A-Sepharose.Polypeptide is incorporated on the Sepharose 4B post of cyanogen bromide-activated, from total IgG, separates anti-peptide antibody with affinity chromatography.Immuno-precipitation proof antibody purified can combine with CBACP specifically.Embodiment 5:cDNA clone's homology retrieval

Arrive Genbank with proteinic polynucleotide sequence provided by the invention and amino acid sequence coded thereof, databases such as swissport carry out the homology retrieval, the program that is used to retrieve is Blast (Basic local alignment search tool) (1993 institutes of NAS report 90:5873-5877), Blast can find out and target sequence homologous gene, the gene of the dna homolog maximum of finding with us wherein, its encoded protein number is AF150755 in the access of Genbank.Gene that these retrieve and protein sequence can access from Genbank.The sequence and the target sequence that access are done company's proportioning with Pileup in the GCG software package (multisequencing) and Gap (two sequences) program.New proteic function prediction can be analyzed with the Motif program, found that CBACP albumen contains the characteristic primitive of calcium binding protein family, i.e. EF-hand primitive.Homology result relatively as shown in Figure 1, this result shows CBP141 and the mouse microtubule-actin crosslinking factor homogeny 900/1287 (69%) that people provided by the invention is new, similarity 1066/1287 (82%).Spscan program and McGeoch Scan with GCGversion 10.0 software packages infer that this albumen is secretory protein, and its signal peptide site is positioned at 87-138.Embodiment 6:Northern blotting is analyzed the CBACP expression of gene:

Extract total RNA[analytical biochemistry (Anal.Biochem) 1987,162,156-159 with single stage method].This method comprises acid guanidinium isothiocyanate phenol-chloroform extracting.Promptly use 4M guanidinium isothiocyanate-25mM Trisodium Citrate, 0.2M sodium acetate (pH4.0) advances ground homogenate to tissue, adds the phenol of 1 times of volume and the chloroform-primary isoamyl alcohol (49:1) of 1/5 volume, and is centrifugal after mixing.The sucking-off aqueous phase layer adds Virahol (0.8 volume) and with the centrifugal RNA precipitation that obtains of mixture.With RNA precipitation 70% washing with alcohol that obtains, dry and soluble in water.

With 20 μ g RNA, on 1.2% sepharose that contains 20mM 3-(N-morpholino) propanesulfonic acid (pH7.0)-5mM sodium acetate-1mM EDTA-2.2M formaldehyde, carry out electrophoresis.Be transferred on the nitrocellulose filter then.With α- ³²P dATP prepares by random priming ³²The dna probe of P-mark.Used dna probe is CBACP coding region sequence (87bp to 920bp) shown in the SEQ ID NO1 or its segmental part.Will ³²The probe of P-mark (about 2 * 10 ⁶Cpm/ml) spend the night in 42 ℃ of hybridization in hybridization solution with the nitrocellulose filter that has shifted RNA, this solution comprises 50% methane amide-25mM KH ₂PO ₄(pH7.4)-5 * SSC-5 * Denhardt ' s solution and 200 μ g/ml salmon sperm DNAs.After the hybridization, filter membrane was washed 30 minutes in 55 ℃ in 1 * SSC-0.1%SDS.Then, analyze with quantitative with Phosphor Imager.The result shows, the CBP141 gene is almost all expressed in a organized way in institute, mainly has skeletal muscle.Embodiment 7: ⁴⁵Ca ²⁺In conjunction with experiment

The CBACP of SDS-PAGE electrophoretic separation purifying, electrotransfer behind pvdf membrane (0.2 micron hole), ⁴⁵Ca ²⁺(1Ci/ml) hatched altogether 10 minutes with pvdf membrane, method referring to: Maruyama, K., Mikawa, T. and Ebashi, S. (1984) journal of biological chemistry (J.Biochem.) (Tokyo) 95,511-519.Press mold, radioautograph.Experiment is with the positive contrast of the myosin of rabbit skeletal muscle.The result shows that CBP141 has in conjunction with Ca ²⁺Ability.

Sequence table (1) general information:

(ⅰ) applicant:

(A) name: Shengyuan Gene Development Co., Ltd., Shanghai

(B) street: No. 668 610 Room, East Road, Beijing

(C) city: Shanghai

(E) country: China

(F) postcode: 200001

(ⅱ) denomination of invention: a kind of calcium binding/actin crosslinking protein and its polynucleotide sequence of encoding

(ⅲ) sequence number: the information of 2 (2) SEQ ID NO:1:

(ⅰ) sequence signature:

(A) length: 6006 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological classification: linearity

(ⅱ) molecule type: cDNA

(ⅸ) characteristic:

(A) title/keyword: CDS

(B) position: 1147-4992

(Ⅹ ⅰ) SEQ ID NO: 1 sequence description: 1 CCAAAAATTACAAATGGCAGAGACTTGAGCTATCCATAAGATAATTTTAAAAATCCTTCC 61 ACTGGACACT CCCCTTCATTACAAAAGTATGCAAACAATCTTGCTATAAATGGAAAACAG 121 GCGTGTGGCT CTCTCCCTGGGACATGAGGGCATAGCTAAAATTCCCTGGGTGGAATTAAT 181 GCCTGGACCA TTGCTCCTCCCTTTCAGGACAAAAGGGAAAGGATGAAGAGGAGCAGCAGG 241 GTAGGGACCC ACCTCAGGAGCAGGTGGGGCACCCTGGAGCTACCTCAGGGGCTGGGAACG 301 TGTTGGCATG TGACCAGCTGATGGAGGAGCGCAGTGTCAAGTGGGCCACGATGGCTGTAG 361 AGAAACCCAA GTGCTCTGCACCCGTAGGGAGTCCAGAAGGTAGAGGTCCACGGACAGGAC 421 AGGCCTGGCC TGCTTTGCTTCCTCCACCTAAGGCCTTGGGACCGATGGCGTCCGTCTGAG 481 AGGCTGCATG ATTATTTTAGGGTTGCAGGAAGGATGCTTCCCATCTGGACGTAAGTGCAC 541 AAACCATGTC TATCTGGATCTCAAAAGATGACTTCCCCTTTACACAACCCCCACTCCCTG 601 CCACTGCAGA TCCCAGCAGAGTGGTGGGAGATCTTGCAGTGGGAACCAGAATGCTGTTGC 661 CACACAGCAC ACAGGCTGAGGCACATTGGTGGAGGGTTCAGAGGAACGAGGAGAAGAGAG 721 GAAGAGGAAT CTGTGACCCGCCTTGTGACTGGTGGGCAGATTCAAGTCTCTACCGCTGCT 781 GCTGAGCAAC TGGGCATCTGCTTCTTGGAAGAACAAGAAAGGGGTGGGGTAAAGACTTGA 841 GGTCATCTTT TGAGATCCAGATAGACATGGTTTGTAACGGCTGCGAGAAGACGAAGCTTA 901 GGGGAAGATC CTGGAATTGATCCTTCAGTAGTAAAACAACAGCAAGAAGCAGCAGAGACC 961 ATAAGGGAAG AAATAGATGGACTACAGGAGGAGCTGGATATAGTTATTAACCTAGGTTCT 1021 GAACTCATTGCGGCATGTGGGGAGCCTGATAAACCCATTGTCAAGAAGAGTATAGATGAG 1081 TTAAATTCAGCATGGGATTCTCTAAATAAAGCTTGGAAAGACCGGATTGACAAACTTGAG 1141 GAGGCAATGCAGGCTGCCGTTCAGTACCAGGATGGACTGCAGGCGGTATTTGACTGGGTA 1201 GATATTGCAGGTGGTAAATTAGCTTCAATGTCTCCAATTGGAACAGATCTCGAAACTGTC 1261 AAGCAGCAGATTGAAGAGCTAAAGCAATTTAAGTCTGAGGCCTATCAACAGCAGATAGAA 1321 ATGGAAAGACTGAATCATCAAGCAGAGCTTTTGCTAAAGAAAGTAACAGAAGAGAGTGAC 1381 AAACACACTGTTCAAGACCCATTAATGGAACTGAAATTGATATGGGATAGCCTGGAGGAG 1441 AGAATCATCAACAGACAGCATAAACTGGAGGGTGCTCTATTAGCCTTGGGTCAGTTCCAA 1501 CATGCCCTGGATGAGCTCCTGGCATGGCTGACACACACCGAGGGCTTGCTAAGTGAGCAG 1561 AAACCTGTTGGAGGAGACCCTAAAGCCATTGAAATTGAACTTGCCAAGCATCATGTGCTC 1621 CAAAATGATGTATTAGCCCATCAGTCCACAGTGGAAGCCGTTAATAAAGCAGGAAATGAT 1681 CTAATTGAATCAAGTGCAGGAGAAGAAGCAAGCAACCTTCAGAACAAGCTAGAGGTTTTA 1741 AATCAACGCTGGCAAAATGTTTTGGAAAAAACAGAACAAAGGAAGCAGCAGCTGGATGGT 1801 GCCTTGCGCCAGGCCAAAGGGTTCCATGGCGAAATTGAGGATTTGCAGCAGTGGCTGACT 1861 GACACGGAGCGTCATCTGTTGGCATCTAAACCGCCGGGAGGTTTACCGGAAACAGCCAAG 1921 GAGCAGCTTAATGTCCATATGGAAGTCTGTGCTGCCTTTGAAGCTAAAGAAGAAACATAT 1981 AAGAGTCTGATGCAGAAAGGCCAGCAGATGCTTGCAAGATGCCCAAAATCTGCAGAGACA 2041 AATATTGACCAAGACATAAATAACTTGAAAGAAAAATGGGAATCGGTGGAAACCAAACTC 2101 AATGAAAGGAAAACTAAACTGGAAGAGGCTCTCAACTTGGCAATGGAGTTCCACAATTCT 2161 CTCCAAGACTTCATCAACTGGCTTACTCAGGCTGAACAGACCCTAAATGTAGCTTCTCGG 2221 CCAAGTCTCATCTTGGACACAGTCTTATTTCAAATTGACGAACACAAGGTTTTTGCCAAT 2281 GAAGTAAATTCTCATCGTGAGCAGATAATAGAGCTGGACAAAACTGGAACCCACCTAAAA 2341 TATTTTAGTCAGAAACAAGATGTTGTTCTAATCAAGAATCTACTTATCAGTGTACAAAGT 2401 CGATGGGAAAAAGTGGTTCAACGGTTGGTAGAGAGAGGAAGATCTTTGGATGATGCAAGG 2461 AAGAGAGCCAAGCAGTTCCATGAAGCTTGGAGTAAACTTATGGAGTGGCTAGAAGAGTCA 2521 GAAAAGTCTTTGGATTCTGAACTGGAAATCGCAAATGATCCAGACAAAATAAAAACACAA 2581 CTTGCACAACATAAGGAGTTTCAGAAATCACTCGGAGCCAAGCATTCTGTCTACGACACC 2641 ACCAACAGGACTGGACGTTCTCTGAAGGAGAAAACCTCCCTGGCTGATGACAACCTGAAA 2701 CTGGATGACATGCTGAGTGAACTCAGAGACAAATGGGATACCATATGTGGAAAATCTGTG 2761 GAAAGACAAAACAAATTGGAGGAAGCCCTGTTATTTTCTGGACAATTCACAGATGCCCTA 2821 CAGGCTCTCATTGATTGGTTATATAGAGTTGAACCCCAGCTGGCAGAATACCAGCCTGTT 2881 CATGGAGACATTGATTTGGTGATGAATCTGATCGATAATCACAAGGCCTTCCAAAAAGAG 2941 TTGGGGAAGAGGACCAGCAGTGTGCAGGTCCTGAAGCGCTCAGCCCGAGAACTCATAGAA 3001 GGCAGTCGGGATGACTCCTCCTGGGTCAAGGTCCAGATGCAGGAATTAAGCACACGCTGG 3061 GAGACCGTGTGTGCACTTTCTATATCAAAGCAAACACGGTTAGAAGCAGCCCTGCGTCAG 3121 GCAGAGGAATTCCACTCGGTGGTACATGCCCTCTTGGAGTGGCTGGCTGAGGCGGAGCAA 3181 ACCCTGCGTTTCCATGGTGTCCTCCCAGATGATGAGGATGCTCTCCGGACTCTCATTGAT 3241 CAGCATAAAGAATTCATGAAGAAACTGGAAGAAAAGAGAGCTGAACTAAATAAAGCCACC 3301 ACTATGGGCGACACCGTTTTGGCTATCTGCCACCCCGACTCCATCACTACCATTAAGCAC 3361 TGGATAACAATCATCCGGGCGAGGTTTGAGGAGGTGCTGGCCTGGGCAAAGCAACATCAG 3421 CAGAGATTAGCAAGTGCTCTGGCTGGGCTTATTGCCAAACAGGAATTGTTGGAAGCTTTG 3481 CTGGCTTGGTTGCAATGGGCTGAAACTACACTTACTGATAAGGATAAAGAAGTCATCCCC 3541 CAGGAGATCGAAGAGGTGAAAGCACTCATTGCAGAACACCAGACCTTCATGGAGGAAATG 3601 ACCAGAAAACAGCCTGATGTTGATAAAGTAACGAAGACCTATAAGAGGAGAGCTGCTGAT 3661 CCTTCCTCATTACAATCCCATATTCCAGTCTTGGATAAGGGACGAGCAGGAAGAAAACGC 3721 TTTCCAGCATCAAGCTTGTATCCCTCTGGGTCACAGACACAAATTGAAACCAAAAATCCT 3781 AGGGTAAACTTACTGGTGAGCAAATGGCAGCAAGTCTGGCTCCTGGCGTTGGAAAGAAGG 3841 AGGAAACTCAATGATGCCTTGGACAGACTAGAGGAGCTGAGGGAATTTGCTAACTTTGAT 3901 TTTGATATCTGGCGCAAAAAATACATGCGATGGATGAATCACAAGAAATCTCGAGTGATG 3961 GACTTCTTCAGGAGAATTGATAAAGACCAGGATGGGAAAATAACGCGGCAGGAATTTATT 4021 GATGGAATTCTTTCCTCAAAGTTTCCAACCAGTCGCTTGGAGATGAGCGCAGTTGCAGAC 4081 ATCTTTGACAGAGATGGCGATGGATATATTGACTACTATGAATTTGTAGCAGCCCTTCAC 4141 CCAAATAAAGATGCATATAAACCTATCACAGATGCCGACAAAATCGAAGATGAGGTGACA 4201 AGGCAGGTAGCTAAGTGTAAATGTGCAAAGCGATTTCAAGTTGAGCAGATTGGTGATAAT 4261 AAATACAGGTTCTTCCTGGGAAATCAGTTTGGAGACTCCCAGCAACTGCGACTGGTCCGG 4321 ATCCTGCGGAGTACTGTGATGGTTCGTGTTGGAGGTGGATGGATGGCACTTGATGAGTTC 4381 TTAGTGAAAAATGATCCTTGCAGGGCCAAAGGAAGGACAAACATGGAACTGCGTGAGAAG 4441 TTCATTTTAGCAGATGGTGCCAGCCAGGGTATGGCTGCTTTCCGACCCCGAGGCCGAAGA 4501 TCCCGGCCATCATCACGAGGCGCTTCACCCAACAGATCCAGTTCTGTGTCCAGTCAGGCT 4561 GCGCAGGCGGCCTCCCCACAGGTCCCTGCCACCACCACACCCAAGGGAACGCCAATACAA 4621 GGAAGCAAGCTTCGACTTCCAGGATATTTATCAGGGAAAGGCTTCCACTCTGGGGAGGAC 4681 AGTGGCTTGATAACAACTGCAGCTGCCAGAGTCCGAACACAGTTTGCTGATTCCAAGAAG 4741 ACTCCCAGCCGACCAGGAAGTCGAGCTGGAAGCAAAGCTGGCAGCAGGGCCAGCAGCCGC 4801 CGAGGCAGTGATGCATCAGACTTTGACATTTCAGAAATCCAGTCCGTGTGCTCAGATGTG 4861 GAAACTGTCCCCCAGACACACAGACCTACACCCCGAGCAGGTTCTCGGCCATCCACAGCG 4921 AAGCCTTCAAAAATCCCCACGCCCCAGAGGAAATCACCTGCCAGCAAATTGGACAAGTCC 4981 TCAAAGAGATAGTGCAATTGGTTCTACCAAGGCCCTTCCTTGAGCATTTATTATTTAAGT 5041 TTGAACGATGTAAAATATGGTGTAGAAATTCTTGTGAAATATTGCAAGAGGCGAGTTTAA 5101 AATTCTGCAGATGGCCTTATTTGTGTATTTGTCTTTTTATTTTATCTGTATAATTTTTTT 5161 TGTCAGATATTCTGGGGTTAAAGTCACATCATATGTGAGGAGGAAAAGTTTAACATGAAC 5221 TAACATTTCTGCACTGTAACGTGCCGGGCACACACTAAACTCAGTTACTGTACCTACAGG 5281 TAAGTCTACATCCTCTCTGACAGCCACAGCACTACATCAATCCCTGACGTTAGGGATACC 5341 TCATGACATTTTCCTGTTTTTATGGAAACTCTGAGAAGCTGAATGATACATGCAGGGGAT 5401 ATTTTTTTGAGATGATTTAAATGTAAACCAAAAGATGGAAGACAAAAAGACAAACACACC 5461 CACACGCAGTCTTTGCAGTATCTGACAGAGAACTCACAGGAAGTTACTTCAAGCACTTGC 5521 CAGTACTATGATATTCAAGTACCTTGCAGCATTTCTCTGCCATTGCTTTCAATGAGGCCA 5581 GAGGCATCCTGGATATTAGACCTATTATACTGTAAGAATATAAGTATAAAGTGCGTTCAT 5641 ATACATGTGAGGTTTTCTTTTGCTTGAGTGGACAGTAGCACCTGTATCATTGAACTCATT 5701 TTGTATCAGAGCAATTTTGCTTGCAGAAAGCTATGAAATAAAACACGTCCCTTAACTGCA 5761 TTGCTATGGAATTAATTTTTTTTCCCCAGGGAAAACTAGTGTATTTTTTTATGAGCAATA 5821 TCAATTTGGAGTGACCAAAAGATACTTAAAAATGGGTTTATTTTGATTTCTCATCTGAAA 5881 TAATCATGTTCTGGTATTATATCTATCTATATTTAATAAATATATACATTTTAATTTATT 5941 ATGTGTACTCACATACTATAGAAAGATATTAGTATGCATTTAATAAAACATATTCACTTG 6001 AATATA (2) SEQ ID NO: 2 of the message: ...

(ⅰ) sequence signature:

(A) length: 1281 amino acid

(B) type: amino acid

(D) topological framework: linearity

(ⅱ) molecule type: polypeptide

(Ⅹ ⅰ) SEQUENCE DESCRIPTION: SEQ ID NO: 2: 1 Met Gln Ala Ala Val Gln Tyr Gln Asp Gly Leu Gln Ala Val Phe 16 Asp Trp Val Asp Ile Ala Gly Gly Lys Leu Ala Ser Met Ser Pro 31 Ile Gly Thr Asp Leu Glu Thr Val Lys Gln Gln Ile Glu Glu Leu 46 Lys Gln Phe Lys Ser Glu Ala Tyr Gln Gln Gln Ile Glu Met Glu 61 Arg Leu Asn His Gln Ala Glu Leu Leu Leu Lys Lys Val Thr Glu 76 Glu Ser Asp Lys His Thr Val Gln Asp Pro Leu Met Glu Leu Lys 91 Leu Ile Trp Asp Ser Leu Glu Glu Arg Ile Ile Asn Arg Gln His 106 Lys Leu Glu Gly Ala Leu Leu Ala Leu Gly Gln Phe Gln His Ala 121 Leu Asp Glu Leu Leu Ala Trp Leu Thr His Thr Glu Gly Leu Leu 136 Ser Glu Gln Lys Pro Val Gly Gly Asp Pro Lys Ala Ile Glu Ile 151 Glu Leu Ala Lys His His Val Leu Gln Asn Asp Val Leu Ala His 166 Gln Ser Thr Val Glu Ala Val Asn Lys Ala Gly Asn Asp Leu Ile 181 Glu Ser Ser Ala Gly Glu Glu Ala Ser Asn Leu Gln Asn Lys Leu 196 Glu Val Leu Asn Gln Arg Trp Gln Asn Val Leu Glu Lys Thr Glu 211 Gln Arg Lys Gln Gln Leu Asp Gly Ala Leu Arg Gln Ala Lys Gly 226 Phe His Gly Glu Ile Glu Asp Leu Gln Gln Trp Leu Thr Asp Thr 241 Glu Arg His Leu Leu Ala Ser Lys Pro Pro Gly Gly Leu Pro Glu 256 Thr Ala Lys Glu Gln Leu Asn Val His Met Glu Val Cys Ala Ala 271 Phe Glu Ala Lys Glu Glu Thr Tyr Lys Ser Leu Met Gln Lys Gly 286 Gln Gln Met Leu Ala Arg Cys Pro Lys Ser Ala Glu Thr Asn Ile 301 Asp Gln Asp Ile Asn Asn Leu Lys Glu Lys Trp Glu Ser Val Glu 316 Thr Lys Leu Asn Glu Arg Lys Thr Lys Leu Glu Glu Ala Leu Asn 331 Leu Ala Met Glu Phe His Asn Ser Leu Gln Asp Phe Ile Asn Trp 346 Leu Thr Gln Ala Glu Gln Thr Leu Asn Val Ala Ser Arg Pro Ser 361 Leu Ile Leu Asp Thr Val Leu Phe Gln Ile Asp Glu His Lys Val 376 Phe Ala Asn Glu Val Asn Ser His Arg Glu Gln Ile Ile Glu Leu 391 Asp Lys Thr Gly Thr His Leu Lys Tyr Phe Ser Gln Lys Gln Asp 406 Val Val Leu Ile Lys Asn Leu Leu Ile Ser Val Gln Ser Arg Trp 421 Glu Lys Val Val Gln Arg Leu Val Glu Arg Gly Arg Ser Leu Asp 436 Asp Ala Arg Lys Arg Ala Lys Gln Phe His Glu Ala Trp Ser Lys 451 Leu Met Glu Trp Leu Glu Glu Ser Glu Lys Ser Leu Asp Ser Glu 466 Leu Glu Ile Ala Asn Asp Pro Asp Lys Ile Lys Thr Gln Leu Ala 481 Gln His Lys Glu Phe Gln Lys Ser Leu Gly Ala Lys His Ser Val 496 Tyr Asp Thr Thr Asn Arg Thr Gly Arg Ser Leu Lys Glu Lys Thr 511 Ser Leu Ala Asp Asp Asn Leu Lys Leu Asp Asp Met Leu Ser Glu 526 Leu Arg Asp Lys Trp Asp Thr Ile Cys Gly Lys Ser Val Glu Arg 541 Gln Asn Lys Leu Glu Glu Ala Leu Leu Phe Ser Gly Gln Phe Thr 556 Asp Ala Leu Gln Ala Leu Ile Asp Trp Leu Tyr Arg Val Glu Pro 571 Gln Leu Ala Glu Tyr Gln Pro Val His Gly Asp Ile Asp Leu Val 586 Met Asn Leu Ile Asp Asn His Lys Ala Phe Gln Lys Glu Leu Gly 601 Lys Arg Thr Ser Ser Val Gln Val Leu Lys Arg Ser Ala Arg Glu 616 Leu Ile Glu Gly Ser Arg Asp Asp Ser Ser Trp Val Lys Val Gln 631 Met Gln Glu Leu Ser Thr Arg Trp Glu Thr Val Cys Ala Leu Ser 646 Ile Ser Lys Gln Thr Arg Leu Glu Ala Ala Leu Arg Gln Ala Glu 661 Glu Phe His Ser Val Val His Ala Leu Leu Glu Trp Leu Ala Glu 676 Ala Glu Gln Thr Leu Arg Phe His Gly Val Leu Pro Asp Asp Glu 691 Asp Ala Leu Arg Thr Leu Ile Asp Gln His Lys Glu Phe Met Lys 706 Lys Leu Glu Glu Lys Arg Ala Glu Leu Asn Lys Ala Thr Thr Met 721 Gly Asp Thr Val Leu Ala Ile Cys His Pro Asp Ser Ile Thr Thr 736 Ile Lys His Trp Ile Thr Ile Ile Arg Ala Arg Phe Glu Glu Val 751 Leu Ala Trp Ala Lys Gln His Gln Gln Arg Leu Ala Ser Ala Leu 766 Ala Gly Leu Ile Ala Lys Gln Glu Leu Leu Glu Ala Leu Leu Ala 781 Trp Leu Gln Trp Ala Glu Thr Thr Leu Thr Asp Lys Asp Lys Glu 796 Val Ile Pro Gln Glu Ile Glu Glu Val Lys Ala Leu Ile Ala Glu 811 His Gln Thr Phe Met Glu Glu Met Thr Arg Lys Gln Pro Asp Val 826 Asp Lys Val Thr Lys Thr Tyr Lys Arg Arg Ala Ala Asp Pro Ser 841 Ser Leu Gln Ser His Ile Pro Val Leu Asp Lys Gly Arg Ala Gly 856 Arg Lys Arg Phe Pro Ala Ser Ser Leu Tyr Pro Ser Gly Ser Gln 871 Thr Gln Ile Glu Thr Lys Asn Pro Arg Val Asn Leu Leu Val Ser 886 Lys Trp Gln Gln Val Trp Leu Leu Ala Leu Glu Arg Arg Arg Lys 901 Leu Asn Asp Ala Leu Asp Arg Leu Glu Glu Leu Arg Glu Phe Ala 916 Asn Phe Asp Phe Asp Ile Trp Arg Lys Lys Tyr Met Arg Trp Met 931 Asn His Lys Lys Ser Arg Val Met Asp Phe Phe Arg Arg Ile Asp 946 Lys Asp Gln Asp Gly Lys Ile Thr Arg Gln Glu Phe Ile Asp Gly 961 I1e Leu Ser Ser Lys Phe Pro Thr Ser Arg Leu Glu Met Ser Ala 976 Val Ala Asp Ile Phe Asp Arg Asp Gly Asp Gly Tyr Ile Asp Tyr 991 Tyr Glu Phe Val Ala Ala Leu His Pro Asn Lys Asp Ala Tyr Lys 1006 Pro Ile Thr Asp Ala Asp Lys Ile Glu Asp Glu Val Thr Arg Gln 1021 Val Ala Lys Cys Lys Cys Ala Lys Arg Phe Gln Val Glu Gln Ile 1036 Gly Asp Asn Lys Tyr Arg Phe Phe Leu Gly Asn Gln Phe Gly Asp 1051 Ser Gln Gln Leu Arg Leu Val Arg Ile Leu Arg Ser Thr Val Met 1066 Val Arg Val Gly Gly Gly Trp Met Ala Leu Asp Glu Phe Leu Val 1081 Lys Asn Asp Pro Cys Arg Ala Lys Gly Arg Thr Asn Met Glu Leu 1096 Arg Glu Lys Phe Ile Leu Ala Asp Gly Ala Ser Gln Gly Met Ala 1111 Ala Phe Arg Pro Arg Gly Arg Arg Ser Arg Pro Ser Ser Arg Gly 1126 Ala Ser Pro Asn Arg Ser Thr Ser Val Ser Ser Gln Ala Ala Gln 1141 Ala Ala Ser Pro Gln Val Pro Ala Thr Thr Thr Pro Lys Gly Thr 1156 Pro Ile Gln Gly Ser Lys Leu Arg Leu Pro Gly Tyr Leu Ser Gly 1171 Lys Gly Phe His Ser Gly Glu Asp Ser Gly Leu Ile Thr Thr Ala 1186 Ala Ala Arg Val Arg Thr Gln Phe Ala Asp Ser Lys Lys Thr Pro 1201 Ser Arg Pro Gly Ser Arg Ala Gly Ser Lys Ala Gly Ser Arg Ala 1216 Ser Ser Arg Arg Gly Ser Asp Ala Ser Asp Phe Asp Ile Ser Glu 1231 Ile Gln Ser Val Cys Ser Asp Val Glu Thr Val Pro Gln Thr His 1246 Arg Pro Thr Pro Arg Ala Gly Ser Arg Pro Ser Thr Ala Lys Pro 1261 Ser Lys Ile Pro Thr Pro Gln Arg Lys Ser Pro Ala Ser Lys Leu 1276 Asp Lys Ser Ser Lys Arg ...

Claims (18)

1. isolated polypeptide, it comprises polypeptide or its examples of conservative variations or its active fragments or the derivative with SEQ ID No.2 aminoacid sequence.

2. polypeptide as claimed in claim 1, it is to have the polypeptide of SEQ ID No.2 aminoacid sequence or be no more than 5% derivative with its amino acid difference.

3. polypeptide as claimed in claim 1, it is the polypeptide with SEQ ID No.2 aminoacid sequence.

4. isolating polynucleotide, it comprises a kind of nucleotide sequence or its variant that is selected from down group:

(a) polynucleotide of polypeptide as claimed in claim 1 or 2 of encoding;

(b) with polynucleotide (a) complementary polynucleotide;

(c) with (a) or polynucleotide sequence (b) have the polynucleotide of at least 80% homogeny.

5. polynucleotide as claimed in claim 4 is characterized in that, this polynucleotide encoding has the polypeptide of aminoacid sequence shown in the SEQ ID No.2.

6. polynucleotide as claimed in claim 4 is characterized in that, the sequence of these polynucleotide is selected from down a kind of of group:

(a) has the sequence of 1147-4992 position among the SEQ ID No.1;

(b) has the sequence of 1-6006 position among the SEQ ID No.1.

7. recombinant vectors that contains claim 4, claim 5 or the described polynucleotide of claim 6.

8. host cell with claim 4, claim 5 or the described polynucleotide of claim 6 or the described carrier conversion of claim 7, transduction or transfection.

9. preparation method with the active polypeptide of CBACP, this method comprises:

(a) under the condition that is fit to the expressing human actin crosslinking protein, cultivate the described host cell of claim 7;

(b) from culture, isolate and have the active polypeptide of actin crosslinking protein.

10. energy and the described actin crosslinking protein specificity of claim 1 bonded antibody.

11. the method for screening simulation, promotion, antagonism or suppressing the active compound of actin crosslinking protein, it comprises polypeptide or its active fragments that utilizes claim 1.

12. the method for the disease that a vitro detection is relevant with the actin crosslinking protein unconventionality expression or the susceptibility of disease comprises the sudden change of the described polypeptide of claim 1 in the detection of biological sample or its coded polynucleotide sequence.

13. according to the method for claim 12, wherein said polynucleotide are DNA or mRNA.

14. the method for the disease that a vitro detection is relevant with the actin crosslinking protein unconventionality expression or the susceptibility of disease comprises the content or the biological activity of the described polypeptide of claim 1 in the detection of biological sample.

15. a pharmaceutical composition, it contains the combination of the described polypeptide of claim 1 or its stand-in, activator, antagonist or inhibitor or above each component, and it also comprises pharmaceutically acceptable carrier.

16. be used for the purposes of nucleic acid amplification reaction, hybridization or preparation gene chip as claim 4, claim 5 or the described polynucleotide of claim 6 or its fragment.

17. the polypeptide of claim 1 or the polynucleotide of claim 4 are used for recovering or strengthening the purposes of the medicine of neural function, treatment ephrosis, anaemia, heart trouble, cancer etc. in preparation.

18.CBACP the antagonist or the antisense polynucleotides of CBACP encoding sequence be used for the treatment of purposes in the medicine of ventricular hypertrophy disease, cancer etc. in preparation.