CN1285732C - Human vascular endothelial growth factor and its polyclonal antibody preparation and method for constructing eukaryotic expression vector - Google Patents

Human vascular endothelial growth factor and its polyclonal antibody preparation and method for constructing eukaryotic expression vector Download PDF

Info

Publication number
CN1285732C
CN1285732C CN 02115773 CN02115773A CN1285732C CN 1285732 C CN1285732 C CN 1285732C CN 02115773 CN02115773 CN 02115773 CN 02115773 A CN02115773 A CN 02115773A CN 1285732 C CN1285732 C CN 1285732C
Authority
CN
China
Prior art keywords
growth factor
vascular endothelial
endothelial growth
antibody
penbritin
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CN 02115773
Other languages
Chinese (zh)
Other versions
CN1422958A (en
Inventor
汪道文
李宏伟
陆再英
屈正
程思源
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Tongji Medical College of Huazhong University of Science and Technology
Original Assignee
Tongji Medical College of Huazhong University of Science and Technology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Tongji Medical College of Huazhong University of Science and Technology filed Critical Tongji Medical College of Huazhong University of Science and Technology
Priority to CN 02115773 priority Critical patent/CN1285732C/en
Publication of CN1422958A publication Critical patent/CN1422958A/en
Application granted granted Critical
Publication of CN1285732C publication Critical patent/CN1285732C/en
Anticipated expiration legal-status Critical
Expired - Fee Related legal-status Critical Current

Links

Images

Landscapes

  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The present invention relates to a human vascular endothelial growth factor, the preparation of a polyclonal antibody thereof and a construction method of a eukaryotic expression vector thereof, which belongs to the field of biological materials. The human vascular endothelial growth factor has the technical scheme that vascular endothelial growth factor genes are cloned into prokaryotic expression plasmids and are expressed and purified in escherichia coli in a large amount, and the antibody with good specificity and high concentration is obtained by rabbit immunity; thereby, the antibody for resisting the human vascular endothelial growth factor is prepared in a large scale, and the antibody has the advantages of low price and high quality; meanwhile, the human vascular endothelial growth factor gene is reversely cloned in a nuclear expression vector pcDND3.1 thereof by adopting a molecule cloning technique, and a gene preparation which can be used for disease angiogenesis resistance therapy is formed.

Description

The Polyclonal Antibody Preparation method of human vascular endothelial growth factor
Technical field
The present invention relates to technical field of biological material.Specifically a kind of human vascular endothelial growth factor hVEGF165cDNA with the clone is cloned into pET28a (+), at vivoexpression hVEGF165c, immune animal after separation and purification prepares the method for multi-clone rabbit human vessel endothelium growth factor resisting antibody.
Technical field
In recent years, vascular endothelial growth factor VEGF progressively illustrates in Its Mechanisms aspect physiology, the pathology, VEGF to the body normal function keep and meaning in disease development comes into one's own day by day, especially human diseases vascularization treatment and anti-VEGF treat the needs of clinical studyes such as tumour, the social demand of hVEGF and its antibody obviously increases, but in the body the such private antigen of VEGF is obtained difficulty, there is the defective that is difficult to overcome in traditional preparation method for antibody on the preparation VEGF antibody.For example: the polyclonal antibody of the anti-VEGF of traditional preparation process, all adopt biochemical isolating method from human serum, to separate, some immunostimulants merging such as a spot of antigen of purifying and freund's adjuvant make and are used for preparing corresponding polyclonal antibody, and the drawback of this method is: the first, and the purifying difficulty is big.Because the ratio that VEGF accounts in human serum is quite little, the VEGF that be purified into q.s prepares antibody, needs a large amount of blood of purifying.The second, the precision of purifying is limited.Because a large amount of cytokines similar to the physico-chemical property of VEGF are arranged in the serum, they be made a distinction fully, and use VEGF to reach very high purity, need a lot of roads program.The 3rd, the expense costliness.Expect abundant pure human vascular endothelial growth factor, need advanced instrument, great deal of raw materials and manpower.Like this, the last antibody that obtains is just quite expensive.
Summary of the invention
The objective of the invention is the human vascular endothelial growth factor gene clone to prokaryotic expression plasmid, and in intestinal bacteria great expression and purifying, through immunizing rabbit, good to obtain specificity, the antibody that concentration is high, thus can prepare cheap, high-quality human vessel endothelium growth factor resisting antibody in a large number.
Realize that concrete technological method of the present invention is: the polyclonal antibody that is to produce human vessel endothelium growth factor resisting, be included in the human vessel endothelium growth factor resisting polyclonal antibody of the corresponding animal-origin of preparation in rabbit, sheep, the mouse animal body, which comprises at least, huve cell cultivation, amplification, enzyme are cut, the screening of the conversion of the preparation of the mensuration of human vascular endothelial growth factor gene order, competent cell and recombinant plasmid, recombinant clone and evaluation that enzyme is cut, carry out 7 steps of a large amount of amplifications of plasmid.
The preparation concrete steps of antibody of the present invention:
Step 1), huve cell are cultivated: use 0.25% tryptic digestion human umbilical vein according to a conventional method, obtain vascular endothelial cell, 10% tire ox is clear with containing, the somatomedin and the 100 μ g heparin M199 culture medium culturing in 5 μ g endotheliums source, harvested cell after 5 days extracts RNA with Trizol reagent.
Step 2), RT-PCR (amplification): use the test kit and the total RNA of 5 μ g of Promega company, carry out RT-PCR.
Step 3), enzyme are cut: the PCR product is connected to pBluescriptSK+ (being called for short PBS) after BamHI and EcoRI enzyme are cut.
The mensuration of step 4), VEGF165cDNA sequence: will be VEGF165cDNA in the cloning vector (pBluescriptSK+) check order, sequencing result shows that its sequence and gene pool are in full accord.
1 atgaactttctgctgtcttgggtgcattggagccttgccttgctgctctacctccaccat
61 gccaagtggtcccaggctgcacccatggcagaaggaggagggcagaatcatcacgaagtg
121?gtgaagttcatggatgtctatcagcgcagctactgccatccaatcgagaccctggtggac
181?atcttccaggagtaccctgatgagatcgagtacatcttcaagccatcctgtgtgccctg
241?atgcgatgcgggggctgctgcaatgacgagggcctggagtgtgtgcccactgaggagtcc
301?aacatcaccatgcagcttatgcggatcaaacctcaccaaggccagcacataggagagatg
361?agcttcctacagcacaacaaatgtgaatgcagaccaaagaaagatagagcaagacaagaa
421?aatccctgtgggccttgctcagagcggaagaaagcatttgtttgtacaatatccgcagacg
481?tgtaaatgttcctgcaaaaacacagactcgcgttgcaaaggcgaggcagcttgagttaaac
541?gaacgtacttgcagatgtgacaagccgaggcggtga
The preparation of step 5), competent cell and the conversion of recombinant plasmid: dip in a little bacterium liquid with the aseptic inoculation rod from the DH5 α bacterial strain of-75 ℃ of preservations and draw LB agar disks (no penbritin), the single clone of picking is inoculated in the 5ml LB substratum after 37 ℃ of overnight incubation, and microbial culture 37 ℃, 200 rev/mins concussions in shaking table were cultivated 20 hours.Get this bacterium liquid of 0.5ml and be inoculated in that be cultured to OD (containing penbritin) 300 rev/mins in the 5ml LB substratum 6000.4 afterwards in 4 ℃ of whizzers 4000 rev/mins centrifugal 10 minutes.Abandon supernatant, with the resuspended precipitation of 0.1M calcium chloride (aseptic) of 5ml precooling, ice bath is recentrifuge after 30 minutes, precipitates resuspendedly with 2ml calcium chloride, places 16 hours for 4 ℃, and packing is standby, and remaining 25% glycerine that adds is stored in-80 ℃.Getting 5ul DNA connects in the product adding 200ul competent cell, rotation is uniformly dispersed DNA for several times gently, in the ice bath 30 minutes, heat-shocked is 90 seconds in 42 ℃ of water-baths, add the LB substratum 600ul that do not contain penbritin once more after ice bath 2-3 minute in 37 ℃ 200 rev/mins recoveries after 45 minutes, with 200ul bacterium liquid shop dish (LB agar culture plate contains penbritin 70ug/ml), 37 ℃ of overnight incubation.
The screening and the enzyme of step 6), recombinant clone are cut evaluation: 5 clones of picking are inoculated in 5ml and contain in the LB substratum of penbritin 70ug/ml from above-mentioned culture plate, concuss was cultivated 16 hours for 300 rev/mins, extract plasmid DNA in a small amount with the miniprep method, restriction enzyme and digestion, whether electrophoresis identification of dna purpose segment correctly is implemented in the reading frame of expression vector.(see figure 4)
Step 7), choosing are identified that correct clone's bacterium liquid is inoculated in and (are contained penbritin 70ug/ml) in a large amount of LB substratum and carry out a large amount of amplifications of plasmid, go the intracellular toxin plasmid to extract test kit in a large number and extract purifying.
The antibody of preparation of the present invention is included in the human vessel endothelium growth factor resisting polyclonal antibody for preparing corresponding animal-origin in the animal bodies such as rabbit, sheep, mouse, and these polyclonal antibodies all can specificly combine with human vascular endothelial growth factor in vivo and in vitro.The biological activity of blocking-up human vascular endothelial growth factor.
The present invention adopt molecular cloning with human vascular endothelial factor reverse cloning in forming a kind of gene formulations that is used for the disease angiogenesis inhibitor among the plasmid expression vector pcDND3.1 more efficiently, this preparation can efficiently express goal gene in multiple histoorgans such as skeletal muscle, cardiac muscle, vascular endothelial cell, thereby promotes the formation of new vessel in these histoorgans.
The present invention now has been preserved in Chinese typical culture protection center in the Wuhan University of Lopa Nationality an ancient woman's ornament mountain, Wuhan City, preservation date: on March 26th, 2002, deposit number: M202012, classification name: PCDNA3.1-VEGF165 escherichia coli DH5a.
Superiority of the present invention is: with pET28a (+) is the constructed external VEGF in basis 165Expression system can be expressed target protein efficiently in BL21, further carry out purifying, shearing with sophisticated method, can obtain a large amount of hVEGF easily 165, satisfy the needs of related experiment.In addition, good through the anti-people VEGF of the prepared rabbit of this protein immunization rabbit serum titer height, specificity, can substitute the commodity antibody of Santa Cruz etc. fully.
Description of drawings
The sequencing result diagrammatic sketch of Fig. 1, goal gene hVEGF165.
Fig. 2, eukaryon expression plasmid pcDND3.1-VEGF165 make up diagrammatic sketch.
Fig. 3, recombinant clone screening and enzyme are cut the evaluation diagrammatic sketch.
Coomassie brilliant blue staining diagrammatic sketch as a result behind Fig. 4, the bacterium split product electrophoresis.
The WesternBlot of Fig. 5, commodity VEGF antibody and target protein analyzes diagrammatic sketch.
Fig. 6, to be antibody with the antiserum(antisera) analyze diagrammatic sketch to the WesternBlot of bacterial product.
The vegf expression diagrammatic sketch of animal tissues part and blood vessel endothelium behind Fig. 7, the injection eukaryon expression plasmid.
The expression diagrammatic sketch of Fig. 8, human stomach organization medium vessels endothelial cell growth factor (ECGF).
The VEGF immunofluorescence diagrammatic sketch of Fig. 9, experimental group and contrast.
Embodiment
The embodiment of the invention:
The expression of embodiment 1 target protein
1, the preparation method of BL21 (DE3) competent cell (method is with the preparation of above-mentioned DH5 α competent cell).
2, with identifying correct pET28a-VEGF 165Get 200uL bacterium liquid after the recovery of recombinant plasmid transformed BL21 (DE3) competent cell and be applied to the LB agar culture plate that contains kantlex 30ug/ml, 37 ℃ of overnight incubation.The well-grown single clone of picking is inoculated in 5ml and contains in the LB substratum of kantlex 30ug/ml, is cultured to OD600 and reaches 0.6-0.8, takes out 1ml bacterium liquid, adds IPTG to final concentration 1mmol/L then in residue bacterium liquid, continues inducing culture 4 hours.Simultaneously do negative control with BL21 (DE3)-pET28a.
3, adopt two kinds of methods to detect proteic expression.At first, to induce, without centrifugal 1 minute of inductive and each 1ml room temperature 12000g of BL21 (DE3)-pET28a bacterium liquid, supernatant discarded, precipitate resuspended with 1 * sds gel sample loading buffer of 100ul respectively, 100 ℃ were boiled 3 minutes, centrifugal 1 minute then with 12000g, in the 15%SDS polyacrylamide gel, respectively add the 20ul suspension, gel is through coomassie brilliant blue staining destainer I, II decolouring back detection expressing fusion protein situation behind the electrophoresis.Secondly, use the same method and carry out induction expression of protein, carry out Western Blot with the anti-VEGF polyclonal antibody of commodity and detect.(seeing Fig. 5, Fig. 6)
Embodiment 2 Polyclonal Antibody Preparation
1, after confirmation has target protein to express, induces amplification BL21 (DE3)-pET28a/VEGF in a large number with method same among the example 2-3 165Bacterial strain, bacterium liquid is centrifugal, after the ultrasonication, reclaim expressed target protein band behind the 15%SDS polyacrylamide gel electrophoresis.After collecting the protein of q.s, immunizing rabbit also carries out booster immunization with partly measuring antigen at initial immunity after January.
2, detection of antibodies: a week prepares serum from the ear edge vein exploitating blood of rabbit behind the booster immunization.With the antiserum(antisera) is that antibody detects the VEGF in bacterium target protein band and the animal tissues, determines antibody titers and specificity.
As a result 1, target protein has obtained to express efficiently.2, under extent of dilution was 1: 200 condition, VEGF antiserum(antisera) and commercial antibody (1: 700) were not having evident difference aspect the testing goal albumen.3, the VEGF in experimentation on animals can effective recognition animal tissues with the method for immunohistochemical methods proof antiserum(antisera).(seeing Fig. 7, Fig. 8, Fig. 9)
The intervention of embodiment 3 human vascular endothelial growth factor gene pairs rat femoral ischemia models
1, buy 13 of adult Westar rats (body weight 250-300 gram) from Tongji Medical Univ's Experimental Animal Center, silk thread ligation rat bilateral femoral arterial causes the lower limb ischemia model.Postoperative 10 days is injected in the vastus (7 14 hind legs of injection group, 6 12 hind legs of control group) of ischemic with pcDNA3.1/VEGF165 200ug.
2, plasmid injection 2 weeks of back, anaesthetize with 3% vetanarcol, open abdomen, separation aorta abdominalis, through the capable Arteriography of lower extremity arteries of abdominal aortic cannulation, take the photograph sheet, radiography finishes, and takes out the muscle at the following position of rat ligature, section in the part freezing microtome, (the rabbit AHS is available from U.S. Santa Cruz company) is the capable immunofluorescence analysis of first antibody with VEGF antibody, observes the VGEF expression of muscle cell and new vessel endothelium.
The immunofluorescence result of experimental group and control group is as follows:
Result: 1, successfully cloned people VEGF165cDNA and made up eukaryotic expression recombinant plasmid pcDNA3.1/VEGF165 by the Genbank sequence.2, experimental group has tangible lower limb muscles atrophy than control group, and does not have tangible side limb circulation formation.3, the high expression level that the experimental group muscle groups is woven with VEGF is compared in the immunofluorescence demonstration with control group.(see figure 10)
Embodiment 4 VEGF genes promote the experimental study of pig myocardium revascularization
1, clone and human VEGF165cDNA (560bp) the BamHI/EcoRI fragment cloning through checking order are to plasmid vector pcDNA3.1 (available from Stratagene company), constitute pcDNA3.1hVEGF, and in bacillus coli DH 5 alpha, increase, go intracellular toxin test kit (German Qiagen company) to extract and purifying with Qiagen, be dissolved in the deionized water and measure concentration after standby.
2, buy 11 of Chinese experimental miniature pigs, body weight 29.3 ± 4.3kg from China Agricultural University.To test and use the miniature pig balanced anesthesia, endotracheal intubation, respirator (SH-500B type) mechanical ventilation.The 2nd intercostal is opened chest through the left front outside, cuts pericardium, appears rami circumflexus arteriae coronariae sinistrae (LCX), free its proximal part, and (Research InstrumentSW USA), closes pericardium to the Ameroid shrunk ring of placement internal diameter 2.5mm, closes chest behind the placement intrathoracic drain.The postoperative cardioelectric monitor is treated to pull out trachea cannula and intrathoracic drain after autonomous respiration recovers fully.Postoperative 6 week determines that LCX is narrow during the row coronary angiography〉95% for selecting model for use.
3, will select for use model to be divided into treatment group (n=6) and control group (n=5) at random.Under the same anesthesia and the assisted respiartion, the 4th intercostal secondary is opened chest through the left front outside, peels off pericardium, appears heart.The treatment group is diluted to 2ml with pcDNA3.1hVEGF 500 μ g with physiological saline, in left chamber front side wall 10 injection site of 6-0prolene wire tag, every dot spacing is 1cm, with the 1ml syringe of taking the 25# syringe needle, respectively to each mark cardiac muscle middle level injection 0.2ml (50 μ g) pcDNA3.1hVEGF.Control group is injected the equivalent empty plasmid with same procedure.Close chest and post surgery treatment with aforementioned.Treatment the 6th week of back, chest is opened in the center under general anesthesia, free heart, inject the excess chlorination potassium solution and make cardiac arrest, (with the injection point is the center, and diameter is 0.6～1cm) to carry out myocardial vascular density and immunohistochemical method research vegf protein respectively and express (used antibody is from U.S. JacksonImmunResearchLab company and hospital of Tongji University cardiovascular research chamber) in injection areas picked at random 5～8 places full wall cardiac muscular tissue.
As a result 1, with the control group contrast, treatment group local myocardial blood vessel area, blood vessel girth and number of blood vessel all increase; 2, myocardium VEGF gene mRNA high expression level is organized in immunofluorescence demonstration treatment.
The constructed eukaryon expression plasmid pcDNA3.1-VEGF165 of conclusion can efficiently express hVEGF165 in pig ischemic myocardium model, promote the foundation of collateral circulation in the pig ischemic myocardium and improve the ischemic area myocardial function.
＜110〉HuaZhong Science University, TongJi medical school, TongJi Hospital
＜120〉human vascular endothelial growth factor and Polyclonal Antibody Preparation thereof and Construction of eukaryotic method
<140>02115773.1
<141>2002-04-28
<160>2
<210>1
<211>576
<212>DNA
＜213〉people (Homo sapiens)
<220>
<221>CDS
<222>(1)...(576)
<400>I
atg?aac?ttt?ctg?ctg?tct?tgg?gtg?cat?tgg?agc?ctt?gcc?ttg?ctg 45
Met?Asn?Phe?Leu?Leu?Ser?Trp?Val?His?Trp?Ser?Leu?Ala?Leu?Leu
1 5 10 15
ctc?tac?ctc?cac?cat?gcc?aag?tgg?tcc?cag?gct?gca?ccc?atg?gca 90
Leu?Tyr?Leu?His?His?Ala?Lys?Trp?Ser?Gln?Ala?Ala?Pro?Met?Ala
20 25 30
gaa?gga?gga?ggg?cag?aat?cat?cac?gaa?gtg?gtg?aag?ttc?atg?gat 135
Glu?Gly?Gly?Gly?Gln?Asn?His?His?Glu?Val?Val?Lys?Phe?Met?Asp
35 40 45
gtc?tat?cag?cgc?agc?tac?tgc?cat?cca?atc?gag?acc?ctg?gtg?gac 180
Val?Tyr?Gln?Arg?Ser?Tyr?Cys?His?Pro?Ile?Glu?Thr?Leu?Val?Asp
50 55 60
atc?ttc?cag?gag?tac?cct?gat?gag?atc?gag?tac?atc?ttc?aag?cca 225
Ile?Phe?Gln?Glu?Tyr?Pro?Asp?Glu?Ile?Glu?Tyr?Ile?Phe?Lys?Pro
65 70 75
tcc?tgt?gtg?ccc?ctg?atg?cga?tgc?ggg?ggc?tgc?tgc?aat?gac?gag 270
Ser?Cys?Val?Pro?Leu?Met?Arg?Cys?Gly?Gly?Cys?Cys?Asn?Asp?Glu
80 85 90
ggc?ctg?gag?tgt?gtg?ccc?act?gag?gag?tcc?aac?atc?acc?atg?cag 305
Gly?Leu?Glu?Cys?Val?Pro?Thr?Glu?Glu?Ser?Asn?Ile?The?Met?Gln
95 100 105
att?atg?cgg?atc?aaa?cet?cac?caa?ggc?cag?cac?ata?gga?gag?atg 360
Ile?Met?Arg?Ile?Lys?Pro?His?Gln?Gly?Gln?His?Ile?Gly?Glu?Met
110 115 120
agc?ttc?cta?cag?cac?aac?aaa?tgt?gaa?tgc?aga?cca?aag?aaa?gat 405
Ser?Phe?Leu?Gln?His?Asn?Lys?Cys?Glu?Cys?Arg?Pro?Lys?Lys?Asp
125 130 135
aga?gca?aga?caa?gaa?aat?ccc?tgt?ggg?cct?tgc?tca?gag?cgg?aga 450
Arg?Ala?Arg?Gln?Glu?Asn?Pro?Cys?Gly?Pro?Cys?Ser?Glu?Arg?Arg
140 145 150
aag?cat?ttg?ttt?gta?caa?gat?ccg?cag?acg?tgt?aaa?tgt?tcc?tgc 495
Lys?His?Leu?Phe?Val?Gln?Asp?Pro?Gln?Thr?Cys?Lys?Cys?Ser?Cys
155 160 165
aaa?aac?aca?gac?tcg?cgt?tgc?aag?gcg?agg?cag?ctt?gag?tta?aac 540
Lys?Asn?Thr?Asp?Ser?Arg?Cys?Lys?Ala?Arg?Gln?Leu?Glu?Lcu?Asn
170 175 180
gaa?cgt?act?tgc?aga?tgt?gac?aag?ccg?agg?egg?tga
Glu?Arg?Thr?Cys?Arg?Cys?Asp?Lys?Pro?Arg?Arg
185 190
<210>2
<211>192
<212>PRT
＜213〉people (Homo sapiens)
<400>2
Met?Asn?Phe?Leu?Leu?Ser?Trp?Val?His?Trp?Ser?Leu?Ala?Leu?Leu
1 5 10 15
Leu?Tyr?Leu?His?His?Ala?Lys?Trp?Ser?Gln?Ala?Ala?Pro?Met?Ala
20 25 30
Glu?Gly?Gly?Gly?Gln?Asn?His?His?Glu?Val?Val?Lys?Phe?Met?Asp
35 40 45
Val?Tyr?Gln?Arg?Ser?Tyr?Cys?His?Pro?Ile?Glu?Thr?Leu?Val?Asp
50 55 60
Ile?Phe?Gln?Glu?Tyr?Pro?Asp?Glu?lle?Glu?Tyr?Ile?Phe?Lys?Pro
65 70 75
Ser?Cys?Val?Pro?Leu?Met?Arg?Cys?Gly?Gly?Cys?Cys?Asn?Asp?Glu
80 85 90
Gly?Leu?Glu?Cys?Val?Pro?Thr?Glu?Glu?Ser?Asn?Ile?The?Met?Gln
95 100 105
Ile?Met?Arg?Ile?Lys?Pro?His?Gln?Gly?Gln?His?Ile?Gly?Glu?Met
110 115 120
Ser?Phe?Leu?Gln?His?Asn?Lys?Cys?Glu?Cys?Arg?Pro?Lys?Lys?Asp
125 130 135
Arg?Ala?Arg?Gln?Glu?Asn?Pro?Cys?Gly?Pro?Cys?Ser?Glu?Arg?Arg
140 145 150
Lys?His?Leu?Phe?Val?Gln?Asp?Pro?Gln?Thr?Cys?Lys?Cys?Ser?Cys
155 160 165
Lys?Asn?Thr?Asp?Ser?Arg?Cys?Lys?Ala?Arg?Gln?Leu?Glu?Leu?Asn
170 175 180
Glu?Arg?Thr?Cys?Arg?Cys?Asp?Lys?Pro?Arg?Arg
185 190

Claims (1)

1, the Polyclonal Antibody Preparation method of human vascular endothelial growth factor, be to produce the human vessel endothelium growth factor resisting polyclonal antibody, be included in the human vessel endothelium growth factor resisting polyclonal antibody of the corresponding animal-origin of preparation in rabbit, sheep, the mouse animal body, altogether step:
Step 1), huve cell are cultivated: use 0.25% tryptic digestion human umbilical vein according to a conventional method, obtain vascular endothelial cell, 10% tire ox is clear with containing, 5 μ g% endothelium sources and somatomedin and 100 μ g heparin M199 culture medium culturing, harvested cell after 5 days extracts RNA with Trizol reagent;
Step 2), RT-PCR amplification: use the test kit and the total RNA of 5 μ g of Promega company, carry out RT-PCR;
Step 3), enzyme are cut: the PCR product is connected to pBluescript after BamHI and EcoRI enzyme are cut, among the pbsSK+;
The mensuration of step 4), VEGF165 cDNA sequence: the VEGF165 cDNA that will be cloned among the cloning vector pBluescript checks order, and its sequence of sequencing result and gene pool are in full accord;
1 atgaactttctgctgtcttgggtgcattggagccttgccttgctgctctacctccaccat
61?gccaagtggtcccaggctgcacccatggcagaaggaggagggcagaatcatcacgaagtg
121gtgaagttcatggatgtctatcagcgcagctactgccatccaatcgagaccctggtggac
181atcttccaggagtaccctgatgagatcgagtacatcttcaagccatcctgtgtgccctg
241atgcgatgcgggggctgctgcaatgacgagggcctggagtgtgtgcccactgaggagtcc
301aacatcaccatgcagcttatgcggatcaaacctcaccaaggccagcacataggagagatg
361agcttcctacagcacaacaaatgtgaatgcagaccaaagaaagatagagcaagacaagaa
421aatccctgtgggccttgctcagagcggaagaaagcatttgtttgtacaatatccgcagacg
481tgtaaatgttcctgcaaaaacacagactcgcgttgcaaaggcgaggcagcttgagttaaac
541gaacgtacttgcagatgtgacaagccgaggcggtga
The preparation of step 5), competent cell and the conversion of recombinant plasmid: dip in a little bacterium liquid with the aseptic inoculation rod from the Dh5a bacterial strain of-75 ℃ of preservations and draw no penbritin LB agar disks, the single clone of picking is inoculated in the 5ml LB substratum after 37 ℃ of overnight incubation, and 37 ℃, 200 rev/mins concussions were cultivated 20 hours in the microbial culture shaking table.Getting this bacterium liquid of 0.5ml is inoculated in and contains in the penbritin 5ml LB substratum 300 rev/mins and be cultured to OD 6000.4 afterwards in 4 ℃ of whizzers 4000 rev/mins centrifugal 10 minutes.Abandon supernatant, with the resuspended precipitation of aseptic 0.1M calcium chloride of 5ml precooling, ice bath is recentrifuge after 30 minutes, precipitates resuspendedly with 2ml calcium chloride, places 16 hours for 4 ℃, and packing is standby, and remaining 25% glycerine that adds is stored in-80 ℃.Getting 5ul DNA connects in the product adding 200ul competent cell, rotation is uniformly dispersed DNA for several times gently, in the ice bath 30 minutes, heat-shocked is 90 seconds in 42 ℃ of water-baths, adds the LB substratum 600ul that does not contain penbritin once more after ice bath 2-3 minute and, coils with 200ul bacterium liquid shop after 45 minutes in 37 ℃ 200 rev/mins recoveries, with LB agar culture plate, contain penbritin 70ug/ml,, 37 ℃ of overnight incubation;
The screening and the enzyme of step 6), recombinant clone are cut evaluation: 5 clones of picking are inoculated in 5ml and contain in the LB substratum of penbritin 70ug/ml from above-mentioned culture plate, concuss was cultivated 16 hours for 300 rev/mins, extract plasmid DNA in a small amount with the miniprep method, restriction restriction endonuclease and digestion, whether electrophoresis identification of dna purpose segment correctly is implemented in the reading frame of expression vector;
Step 7), the correct clone's of choosing evaluation bacterium liquid is inoculated in and contains a large amount of amplifications of carrying out plasmid in a large amount of LB substratum of penbritin 70ug/ml, goes the intracellular toxin plasmid to extract test kit in a large number and extracts purifying.
CN 02115773 2002-04-28 2002-04-28 Human vascular endothelial growth factor and its polyclonal antibody preparation and method for constructing eukaryotic expression vector Expired - Fee Related CN1285732C (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN 02115773 CN1285732C (en) 2002-04-28 2002-04-28 Human vascular endothelial growth factor and its polyclonal antibody preparation and method for constructing eukaryotic expression vector

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN 02115773 CN1285732C (en) 2002-04-28 2002-04-28 Human vascular endothelial growth factor and its polyclonal antibody preparation and method for constructing eukaryotic expression vector

Publications (2)

Publication Number Publication Date
CN1422958A CN1422958A (en) 2003-06-11
CN1285732C true CN1285732C (en) 2006-11-22

Family

ID=4743859

Family Applications (1)

Application Number Title Priority Date Filing Date
CN 02115773 Expired - Fee Related CN1285732C (en) 2002-04-28 2002-04-28 Human vascular endothelial growth factor and its polyclonal antibody preparation and method for constructing eukaryotic expression vector

Country Status (1)

Country Link
CN (1) CN1285732C (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN100343281C (en) * 2005-05-20 2007-10-17 厦门大学 Axin antibody C8 preparation method

Also Published As

Publication number Publication date
CN1422958A (en) 2003-06-11

Similar Documents

Publication Publication Date Title
WO2023024552A1 (en) Recombinant type-i humanized collagen polypeptide, and preparation method therefor and use thereof
CN1314916A (en) Cancer antigens based on tumor suppressor gene WT1 product
CN100349921C (en) Fusion protein of tetanus toxin T cell expressing bit polypeptide and human bata lymph cell stimulating factor and preparing thereof
CN102816221B (en) Chicken E. tenella MA1 (EtMA1) gene, vector, recombinant strain, EtMA1 protein, EtMA1-Outside domain, and use of the EtMA1 protein and the EtMA1-Outside domain
RU2493873C1 (en) Injection preparation for higher sperm production in farm breeders and cocks, and method for using it
CN1897959A (en) Tissue protective cytokines for the treatment and prevention of sepsis and the formation of adhesions
CN1285732C (en) Human vascular endothelial growth factor and its polyclonal antibody preparation and method for constructing eukaryotic expression vector
CN117866858A (en) Recombinant lactobacillus plantarum expressing porcine rotavirus antigen and application thereof
CN1065875C (en) Fibrillating cell growth factor-2 analogue and its production method and use
CN111333710B (en) C20orf24 protein deletion mutant and application thereof
CN1803846A (en) Hybrid protein of p53 protein epitope(SQAMDDLMLS) and filobactivirus gene 8 protein and application thereof
RU2526571C1 (en) Injection drug for increasing human sperm production and method for use thereof
CN1921883A (en) Vaccine comprising an angiomotin or a polynucleotide encoding an angiomotin and its use for the treatment of angiogenic-related disorders
CN102838679B (en) The preparation and application of Her2 neu antigen positive tumor therapeutic vaccines
CN102816222B (en) Chicken E.tenella MA2 gene, vector, recombinant strain, protein, and application thereof
CN111733177A (en) Egg yolk antibody prepared from aeromonas hydrophila outer membrane protein antigen and preparation method thereof
CN106350578A (en) Application of NY-ESO-1 in diagnosis and treatment of microsatellite instability intestinal cancer
CN1787828A (en) Heterocarpin, a plant-derived protein with anti-cancer properties
CN1593390A (en) Usage of honokiol in the preparing process of anti tumor angiopoiesis medicine
CN1232532C (en) Fibroblast growth factor-2 analogue, producing process and application thereof
CN112159479B (en) Mycoplasma gallisepticum multi-antigen epitope fusion protein pMG-mEA and application thereof
CN1194089C (en) Large wasp sedative peptide precursor gene and its coded polypeptide and preparation method
CN105368857B (en) It is a kind of to prevent and treat the cystathionine beta-synthase gene of chicken coccidiasis, vaccine and preparation method thereof
CN109136357A (en) A kind of method and purposes that effective induction of vascular is degenerated
CN1260367C (en) Fortified fusion protein FV-LDP-AE possessing angiopoiesis inhibiting and antitumour actions

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
C19 Lapse of patent right due to non-payment of the annual fee
CF01 Termination of patent right due to non-payment of annual fee