CN1283232A - Use of novel disintegrin metalloprotease, mutants, fragments and the like - Google Patents

Use of novel disintegrin metalloprotease, mutants, fragments and the like Download PDF

Info

Publication number
CN1283232A
CN1283232A CN98802774A CN98802774A CN1283232A CN 1283232 A CN1283232 A CN 1283232A CN 98802774 A CN98802774 A CN 98802774A CN 98802774 A CN98802774 A CN 98802774A CN 1283232 A CN1283232 A CN 1283232A
Authority
CN
China
Prior art keywords
gly
ser
lys
cys
pro
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN98802774A
Other languages
Chinese (zh)
Inventor
M·H·廷德尔
T·M·哈克基
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Case Western Reserve University
Procter and Gamble Co
Original Assignee
Case Western Reserve University
Procter and Gamble Co
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from PCT/US1997/003217 external-priority patent/WO1997031931A1/en
Application filed by Case Western Reserve University, Procter and Gamble Co filed Critical Case Western Reserve University
Publication of CN1283232A publication Critical patent/CN1283232A/en
Pending legal-status Critical Current

Links

Classifications

    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

This invention provides a method for identifying compounds capable of binding to the disintegrin protein, and determining the amount and affinity of a compound capable of binding to the disintegrin protein in a sample. This invention also provides a host cell comprising a recombinant expression vector to the disintegrin protein and a recombinant expression vector encoding to the disintegrin protein and the human disintegrin metalloprotease protein, fragment or mutant thereof, useful for these purposes. This invention also provides an in vivo or in vitro method for screening for osteoarthritis and other metalloprotease based diseases, capable of manufacture and use in a kit form.

Description

The purposes of new Proteins, disintegrins, its mutant, fragment etc.
Invention field
The present invention relates to a kind of new protein, its fragment and mutant, and it is detecting and test treatment osteoarthritis and other just are being regulated to purposes aspect the medicine of disease of feature with metalloprotease.
Background of invention
Relevant on the degraded of many enzymes initiation structural protein and the structure with metalloprotease.Comprising human skin fibroblast collagenase, human fibroblasts's gelatinase, people's phlegm collagenase and gelatinase and people's stromelysin.Referring to S.E.Whitham etc., " by clone and sequencing analysis comparison people's stromelysin and collagenase ", Biochem is (1986) J.240:913.In addition referring to, G.I.Goldberg etc., " human fibroblasts's collagenase ", J.Biol.Chem.261:660 (1986).The enzyme that is mutually related on these structures is called " metalloprotease ", and one of their common trait is the dependency to metal (for example zinc).
These enzymes have the generation of accent and activity to play an important role in the normal development of weave construction.But when excessive, these enzymes can cause the pathologic of related tissue to destroy.Referring to, J.Saus etc., " the complete primary structure of people's matrix metalloproteinase-3 ", J.Biol.Chem.263:6742 (1988).Wherein many is zinc-containing metal proteolytic enzyme, for example angiotensin converting enzyme and enkephalinase.Collagenase, solute element and relevant enzyme have vital role aspect the symptom of mediation numerous disease, and these diseases comprise rheumatoid arthritis (Mullins, D.E etc., Biochim Biophys Acta (1983) 695:117-214); Osteoarthritis (Henderson, B. etc., Drugs ofthe Future (1990) 15:495-508); Cancer metastasis (ibid, Broadhurst, M.J. etc., european patent application 276436 (1987 open), Reich, R. etc., 48 Cancer Res 3307-3312 (1988)); With various ulcer diseases.Alkali burn or pseudomonas aeruginosa, Acanthamoeba, herpes simplex and vaccinia virus infection can cause ulcer in cornea.
In fact, the metalloprotein enzymatic determination that carries out in cancerous tissue shows that the rising of metalloprotein enzyme level is relevant with transfer ability.Referring to, M.J.Duffy etc., " 8 types that in the human breast cancer, carry out and the test of 9 type matrix metalloproteinases ", Br.J.Cancer 71:1025 (1995) with ELISA.
With undesirable metal proteinase activity is that the disease of feature also comprises periodontopathy, epidermolysis bullosa and scleritis.Consider that metalloprotease has related to multiple disease, people have begun to attempt to prepare this zymoid inhibition.A large amount of these type of inhibitions are disclosed in the existing document.That the present invention attempts to provide is new, fortunately this type of proteolytic enzyme is had specific inhibition, and they have stronger activity aspect the disease for the treatment of proteinoid enzyme mediation thus or regulating.
The metalloprotein enzyme inhibitor can be used to treat the disease that is caused by the structural protein degraded at least in part.Prepared multiple inhibition, but people need still the screening method of metalloprotein enzyme inhibitor to design the medicine of the described disease of treatment.
Because matrix metalloproteinase is relevant with numerous disease, so people attempt to identify the inhibitor of this kind of enzyme always.For example, known TaoI-2 and 1,10-phenanthroline are the inhibitor of metalloprotease.Referring to, J.Arribas etc., " extracellular domain of various cell surface proteins is by a system's excretory to the inhibitors of metalloproteinase sensitivity ", J.Biol.Chem.271:11376 (1996).
Metalloprotease is the protein that a big class has multiple difference in functionality.Protein degradation (disintegrin) is the zinc metalloprotein enzyme, is rich in snake venom.The Mammals protein degradation is the gang's albumen that comprises about 18 known subgroups.They play the conduct of cell adsorptive hindrance agent, and known very active in breeding (for example, in the fertilization of sperm to ovum, comprising both fusions and the maturation of sperm).
The molecular biology of these and other metalloprotease and biological chemistry are known.As a result, Genbank, i.e. gene order storehouse provides the sequence of a few strip metal proteolytic enzyme, wherein some fragment of protein degradation of allegedly encoding.For example, the GenBank registration number Z48444 on February 25th, 1994 discloses the rat gene of 2407 Nucleotide that it is said rat Proteins, disintegrins gene; The GenBank registration number Z48579 in March 2 nineteen ninety-five discloses 1842 Nucleotide that it is said people's Proteins, disintegrins Gene Partial sequence; The GenBank registration number Z21961 on October 25th, 1994 discloses 2397 Nucleotide of partial sequence that it is said ox zinc metalloprotein enzyme gene.
Because the kind of metalloprotease is so many, so people need ⅰ always) specificity detects the method and the ⅱ of special metal proteolytic enzyme) identify the method for candidate inhibitor.
Metalloprotease is associated with specified disease, and utilizes these metalloproteases to detect and the method finally curing, control these diseases or design healing will be very useful as instrument.Goal of the invention
One of the object of the invention provide a kind of evaluation can with the method for protein degradation bonded compound.
Another purpose of the present invention provides the host cell of the recombinant expression vector that comprises protein degradation and the recombinant expression vector of coding protein degradation.
Another purpose of the present invention provides the screening method by the disease of metalloprotease mediation such as a kind of test example such as cancer, joint disease (comprising ankylosing spondylitis, rheumatoid arthritis, urarthritis (gout), inflammatory arthritis, Lyme disease and osteoarthritis) etc.
Another purpose of the present invention provides a kind of described proteic antibody, and it can be used in screening, the described albumen of separation or conduct at described proteic targeting moiety.
Summary of the invention
The invention provides a kind of evaluation can be in conjunction with the compound of protein degradation, and can be in conjunction with the amount of the compound of protein degradation and the method for affinity in can working sample.
The present invention also provides and has been used for described purpose, comprises the host cell of recombinant expression vector of protein degradation and the recombinant expression vector of coding protein degradation and people's Proteins, disintegrins albumen, its fragment or mutant.
The present invention also provide be used to detect osteoarthritis and other for example cancer etc. based in the body of the disease of metalloprotease with external method, this method can manufacture test kit and use in the mode of test kit.Describe in detail
" gene " refers to the section of DNA sequence, and it comprises generation maturation protein or necessary regulation and control of its precursor and encoding sequence.Albumen can be by the total length of encoding sequence coding, also can be by part coding arbitrarily wherein, as long as have required enzymic activity.
" oligonucleotide " is defined as the molecule that comprises two or more deoxyribonucleotides or ribonucleotide, comprise usually more than three, and generally be more than ten, can reach 100 or more (but with 20 to 30 for good).The definite size of oligonucleotide depends on many factors, and these factors depend on function and the purposes that oligonucleotide is final again.The oligonucleotide generation that can in all sorts of ways is comprising the integrated use of chemosynthesis, dna replication dna, restriction endonuclease digestion reverse transcription product or above method.
Because the mononucleotide reaction generates the mode of oligonucleotide: 5 ' phosphoric acid of a mononucleotide pentasaccharides ring combines with 3 ' oxygen of adjacent nucleotide with same direction by phosphodiester bond, so, if 5 ' phosphoric acid of one section oligonucleotide end does not combine with 3 ' oxygen on another mononucleotide pentasaccharides ring, then claim this end to be " 5 ' end ", if 3 ' terminal oxygen does not combine with 5 ' phosphoric acid on next mononucleotide pentasaccharides ring, then claim this end to be " 3 ' end ".In this article, one section nucleotide sequence even it is positioned at the inside of one section big Nucleotide, also has 5 ' and 3 ' end.
When two sections differences and non-overlapping oligonucleotide combine with different zones on the same linear complementary nucleotide sequence, and the 3 ' terminal 5 ' end that points to another section of one section oligonucleotide, claim that then the former is " upstream " oligonucleotide, the latter is " downstream " oligonucleotide.
" primer " refers to such oligonucleotide, and when condition of living in caused the extension of primer, it can be as the synthetic starting point.Oligonucleolide primers can be naturally occurring, and for example purifying is from the restrictive diges-tion product, or synthetic.
Selection of primers needs and template the preceding paragraph particular sequence " substantially " complementation.Primer must have enough complementarity and template strand is hybridized so that prolong primer.Primer sequence needn't reflect the sequence of template fully.For example, all the other sequences that can connect one section incomplementarity nucleotide fragments primer at 5 ' end of primer are then complementary substantially with template strand.Incomplementarity base or longer sequence can be dispersed in primer inside, form the templa-primer mixture so that the extension products of synthetic primer as long as the complementarity of primer sequence and template sequence is enough to hybridize.
" hybridization " method comprises makes one section complementary sequence combine with target nucleic acid (its sequence is to be measured).Two Nucleotide polymers that contain complementary sequence can find each other and mutually combine by the base pairing reaction that this is a kind of well-known phenomenon.Marmur﹠amp; Lane, Proc.Natl.Acad.Sci.USA 46:453 (1960) and Doty etc., Proc.Natl.Acad.Sci.USA 46:464 (1960) finds " hybridization " process the earliest, thereafter updating of this method is made it to become the important tool of modern biology.But, have many problems to hinder hybridization be widely used in diagnosis to the people.Have in these difficult problems: 1) hybridization efficiency is low; 2) concentration of particular target sequence is low in the genomic dna mixture; With 3) just part complementary probe and target hybridization.
As for efficient, test observation factually, in hybridization, only formed the part during probe-target mixture may be counted.During with short oligonucleotide probe (being shorter than 100 bases), especially true.This has three major causes: a) can't hybridize owing to the interaction of secondary structure and tertiary structure; B) the DNA chain that contains target sequence heavily again with complementary strand hybridization (combination); And c) when employing needed target nucleic acid and solid phase surface fixed hybrid method, some target molecule can't be hybridized.
Even the sequence of probe and target sequence (being the primary structure of target) are complementary fully, also must make target sequence to contact by the rearrangement of higher structure with probe.The rearrangement of described higher structure may relate to the secondary structure or the tertiary structure of molecule.Secondary structure connects decision by intramolecularly.With DNA or RNA is example, same continuous base intrachain hybridization that Here it is (opposite with the hybridization between different two chains).According to degree and position that intramolecularly connects, probe may be replaced from target sequence, thereby can't hybridize.
Long target chain may renaturation or heavily combination, and this makes that the solution hybridization of double-stranded DNA of oligonucleotide probe and sex change is complicated more.Equally, this process can be replaced down the probe of having hybridized.This will cause the low hybrid rate (low " effective area ") with respect to the initial concentration of probe and target.
Low as for target sequence concentration, in genomic dna, the dna fragmentation that contains target sequence is less usually.This has caused very big technical difficulty: in low level like this, make and adopt many ordinary methods of oligonucleotide to lack the necessary sensitivity that detects hybridization.
One of method of attempting to solve the target sequence concentration problems is the amplification detection signal.In most cases, this need add one or more marks to oligonucleotide probe.If the nonradioactive labeling copies even the high-affinity reagent also is found the single-gene that is unsuitable for oligonucleotide probe detects in the genomic dna.Referring to, Wallace etc., Biochimie 67:755 (1985).If the radioactivity oligonucleotide probe has only high specific activity (specific activities) just to be found and can produce gratifying result.Referring to, Studencki﹠amp; Wallace, DNA 3:1 (1984) and Studencki etc., Human Genetics 37:42 (1985).
The United States Patent (USP) 4,683,195 and 4,683 of the K.B.Mullis of this paper reference etc., 202 provide not by clone or purifying, improve the hit method of sequence fragment concentration of any DNA mixture.The method of this amplified target sequence (can make target molecule with coupling of the present invention) comprising: introduce two sections excessive greatly Oligonucleolide primers in comprising the DNA mixture of required target sequence, carry out thermal cycling accurately then according to the order of sequence in the presence of archaeal dna polymerase.Two sections primers respectively with double-stranded target sequence in corresponding chain complementation.In order to cause amplification, with the mixture sex change, separately complementary strand annealed combination in two primers and the target molecule then.After the annealed combination, primer prolongs through polysaccharase and forms a pair of new complementary strand.These steps that prolong sex change, primer annealing and primer can repeat repeatedly (that is, sex change, annealing and prolongation constitute one and take turns " circulation ", and many wheels " circulation " can be arranged) with the required target sequence fragment of the amplification of obtaining high density.The segmental length of required target sequence of amplification depends on primer relative position to each other, so this length is an adjustable parameter.Because this process is multiple, so be called " polymerase chain reaction " (hereinafter claiming " PCR ") by the inventor.Because the target sequence fragment after the required amplification has become the main sequence (with regard to concentration) in the mixture, they are said to be through " pcr amplification ".
Utilize PCR, can amplify the level of the single copy of particular target sequence in the genomic dna, make that it can be by several different methods (for example, the probe hybridization of crossing with mark; Introduce biotinylated primer earlier and carry out avidin-enzyme coupling detection then; In amplified fragments, introduce 32The triphosphate deoxy-nucleotide of p mark is dCTP or dATP for example) record.Except that genomic dna, any oligonucleotide sequence can both increase with one group of suitable primer molecule.Particularly, the amplified fragments itself that produces through PCR is again effective template of pcr amplification reaction thereafter.
Known, pcr amplification can reach the platform concentration of particular target sequence, about 10 -8M.The type reaction volume is 100 μ l, is equivalent to the yield 6 * 10 of duplex molecule product 11
As for complementarity, what hybridization reflected is that complete complementation or part complementation are crucial for some diagnostic uses.For example, if only need measure DNA or the RNA (for example from virus, bacterium, fungi, Mycoplasma, protozoon) whether pathogenic agent is arranged, important just hybridizing method is guaranteed when correlated series exists hybridization to take place; The condition of selecting can be to make part complementary probe and complete complementary probe all hybridize.But it is complementary and complementary fully that other diagnosis may require hybridizing method to distinguish part.This is significant for measuring gene pleiomorphism.For example, the part of human hemoglobin is made of 4 polypeptide chains.Wherein two chains are complete 141 amino acid chains (α chain) together, and other two chains are complete 146 amino acid chains (β chain) together.Known, the gene of coding β chain has polymorphism.Normal allele is coded in the 6th and is the β chain of L-glutamic acid.The β chain of mutation allele coding is a Xie Ansuan at the 6th.Amino acid whose difference has deep physiological effect, is exactly known clinically cellulous anemia.Known, the gene basis of amino acid change is the single base difference between normal allele dna sequence dna and mutation allele dna sequence dna.
Unless combine with other technology (for example Restriction Enzyme analysis), allowing the method for part complementary sequence and fully-complementary sequence generation par hybridization is unaccommodated for this class purposes generally; Probe can all be hybridized with target sequence normal and variation simultaneously.No matter the method that is adopted, hybridization all require to have certain complementarity between sequence to be measured (target sequence) and the dna fragmentation (probe) that is used for testing.(certainly, also combination may take place, but this combination is nonspecific, should note avoiding without any complementarity.)
The complementary sequence of one section nucleotide sequence is meant such oligonucleotide, aligns with nucleotide sequence when it, makes the 5 ' terminal over against 3 ' when terminal of another sequence of one of calling sequence, and oligonucleotide becomes " antiparallel combination " with nucleotide sequence.Nucleic acid of the present invention may comprise the base that some non-natural exists, for example inosine and 7-deazaguanine, complementation fully; Stable two strands may comprise mispairing or unmatched base.According to following variable, the those of skill in the art of nucleic acid technical field can judge double-stranded stability by rule of thumb, and for example the based composition of the length of oligonucleotide, oligonucleotide and sequence, ionic strength and base mismatch are to probability.
The stability of nucleic acid double chain is with melting temperature or " T m" measure.Concrete nucleic acid double chain T under given conditions mBe that dissociated temperature takes place average half base pair.Calculate nucleic acid T mFormula be well-known in the art.As shown in reference, estimate T mValue can be calculated by following formula:
T m(% methane amide)-500/L wherein in-81.5 ℃+16.6logM+0.41 (%GC)-0.61, M is the volumetric molar concentration of monovalent cation, %GC is the per-cent of guanine and cytidylic acid(CMP) among the DNA, the % methane amide is the per-cent of formed methane amide in the hybridization solution, L=with the base pair be unit the hybridization chain length (referring to, molecule clone technology instructs, S.L.Berger﹠amp; A.R.Kimmel edits, Methods in Enzymology, the 152nd volume, 401 (1987)).Other reference comprises more perfect method of calculation, and they are calculating T mIn time, all taken structure and sequence signature into account.
The oligonucleotide that " probe " digit synbol is crossed because one section sequence complementation wherein at least one section sequence and another nucleic acid, thereby forms duplex structure with one section sequence in another nucleic acid.
" mark " refers to that any can providing can survey (preferably can be quantitative) signal, and can with the atom or the molecule of nucleic acid or protein bound.The signal surveyed that mark provides comprises fluorescence, radioactivity, color, proportion, X-ray diffraction or absorption, magnetic, enzymic activity etc.Such mark can be added on the oligonucleotide of the present invention.
" nucleic acid primer " and " nucleic acid-templated " is used interchangeably at this, all refers to comprise the nucleic acid molecule of strand or double-stranded DNA or RNA.
When claiming nucleic acid primer for " being strand basically ", the expression substrate molecule mainly exists with the single-chain nucleic acid form, rather than two chains promptly being combined by interchain base pairing effect of double-strandednucleic acid.
" sequence variations " refers to two nucleotide sequence differences between nucleic acid-templated.For example, may there be sequence difference in wild-type structure gene and mutant because of the disappearance or the insertion of single base substitution and/or one or more Nucleotide.Two kinds of forms of this of structure gene are said to be on sequence and differ from one another.The mutant that also may have second kind of structure gene.This second kind of mutant form is said to be on sequence form all different with the wild type gene and first mutant thereof.Must be pointed out that, though the present invention does not require that the comparison of carrying out between one or more forms of certain gene is to determine the change of sequence, but utilize oligomerization of the present invention/solid phase supported matrix and utilize U.S. Patent application 08/231, the described specific hybridization conditions of 440 (this paper receives and is reference), so relatively can carry out.
" with gene order coupling or complementary Oligonucleolide primers " refers to promote the template dependency synthetic Oligonucleolide primers of strand or double-strandednucleic acid.Can be used for PCR, reverse transcription-pcr (RT-PCR) etc. with gene order coupling or complementary Oligonucleolide primers.
" total gene order " is by the gene order that relatively gene order draws more than two sections or two sections, and it is described in the given gene fragment Nucleotide of the most normal appearance; Consensus sequence is a canonical sequence.
In this article, " albumen " and " proteolytic enzyme " all refers to metalloprotease." metalloprotease " refers to natural metal dependence protein enzyme, the fragment that has kept its function, mutant or homologue.The present invention comprises metalloprotease from different plant species (or " protein degradation), and with the metalloprotease of recombination method, in vitro method or the preparation of standard peptide synthesis method.Be preferably this albumen behaviour protein degradation or its mutant.In order to define proteic mutant, on preferred " natural " albumen as this paper with reference to the Gen Bank#Z48579 that quotes partly description, can be referring to sequence hereinafter.The homology protein degradation comprises intact proteins or its fragment that has 90% homology as known in the art at least.It has been recognized that, variation between some kind may take place, comprising changing the insertion or the disappearance that also may not change function.For example, has the rat protein of 95% homology according to peptide sequence and certain albumen and bovine protein that preceding 300 base pairs have the 97-98% homology all is considered to homologue.Referring to, on February 15th, 1994, Gen Bank#Z48444 disclosed 2407 bases of a rat gene, and this gene is considered to rat Proteins, disintegrins gene; The Gen Bank#Z21961 on October 25th, 1994 discloses 2387 bases of a Gene Partial sequence, and this gene is considered to the zinc metalloprotein enzyme of ox.Be preferably, this metalloprotease is people's protein degradation hereinafter described.
" antibody " is meant protein degradation or its segmental antibody.They can be monoclonal, or polyclonal, and can have multiple source.The present invention also considers to utilize the fragment of the described antibody that any method of protein or peptide field makes.
" detection of disease " promptly detects a kind of disease or morbid state.Morbid state is physiology or the cell or the biological chemistry sign of disease.Be preferably, described detection is to utilize known technologies such as ELISA that the liquid of body tissue or animal or cell culture is carried out.The present invention also considers to carry out at whole body " location (mapping) " of disease, for example general gives the above-mentioned antibody through mark, though what detection method can, described detection method comprises fluorescence, X ray (comprising cat scan), NMR (comprising MRI) etc. preferably.
" screening of compound " refers to that this method and screening are about seeking compound, measuring it with the affinity of proteolytic enzyme or according to The selection result design and selection compound.In another embodiment, the present invention considers according to known in the art, utilizes three-dimensional structure design medicine, and it is better to be called " reasoning medicinal design ".Be preferably, proteolytic enzyme is " pure substantially form ", and promptly protein is gone up substantially and do not contained other impurity, makes it can be used to experiment or feature description.Use described screening method to help the technician to seek combination and preferably new the synthesizing or natural chemical structure of arrestin enzyme.These " inhibitions " may work in regulating protease activities, and may therefore be used to regulate a succession of biology continuously active that they participate in.This method provides the compound of new pharmaceutically useful.
" protein degradation " refers to a kind of protein degradation or keeps the fragment of its function, mutant homologue.It comprises aggrecan enzyme (aggracanase) and other proteolytic enzyme that participates in or regulate tissue remodeling.It relates to the protein degradation from different plant species, and by the protein degradation of recombination method, in vitro method or the preparation of standard peptide synthesis method.Described albumen is people's protein degradation or its mutant preferably.In order to define described proteic mutant, preferably " natural " albumen be GenBank Z48579 number partly describe, described content at this as a reference and for hereinafter sequence is related.SEQ ID NO:1 has described the fragment and the transcription product thereof of described dna sequence dna, and SEQ ID NO:2 describes the protein by this genes encoding.The homology protein degradation comprises as known in the art, having intact proteins or its fragment of at least 90% homology.For example, according to the aminoacid sequence that draws by DNA that comprises SEQ ID NO:1 or cDNA sequence, have the rat protein of 95% homology with SEQ ID NO:2, and the bovine protein (drawing with identical method) with 97% to 98% homology all is considered to homologous protein.So the homology cDNA that is obtained by other biological cloning can produce homologous protein.
Only according to aminoacid sequence, similarly protein also can be considered to homologous.Restriction in the amino acid sequencing practice may make the people think that by for example more proteic preceding 50 amino acid certain albumen and another albumen are homologous.Thus, 90% homology just allows in preceding 50 amino acid chains of homologous protein 5 amino acid whose differences are arranged.
Those of skill in the art can be understood that the degeneracy of genetic code can be used for changing dna sequence dna provides the equity transcription product, and produce same protein thus.Sometimes, but preparation coding the same protein advantage that is different from the dna sequence dna of n DNA comprise:
---made things convenient for order-checking is with synthetic;
---improve protein expression;
---some heterologous host has preference to some codon than other codon.
More than the consideration in the practice is well-known, and advantageous embodiment concerning user of the present invention is provided thus.So, can recognize clearly that n DNA is not unique embodiment that the present invention considers.
In addition, concerning those of skill in the art, it is evident that, can in screening, medicinal design etc., use proteic fragment, and for using purpose of the present invention, may not require complete albumen.So, can clearly recognize, comprise the peptide fragment that it is useful for the announcement of protein and uses thereof.
Those of skill in the art will pay attention to the problem in the enforcements such as proteic expression, purifying yield, stability, solubleness when selecting whether to use fragment and using what fragment.As a result, use the ordinary method of this area, because disclosure of the present invention, the technician uses protein fragments can implement the present invention equally.
So the present invention has considered to use the imperfect nucleotide sequence and the proteinic imperfect aminoacid sequence of gene especially.Can in screening, medicinal design etc., use proteinic fragment, may not must with regard to the object of the invention use whole albumen.Protein itself can be used for measuring small molecules and combination of proteins affinity.There is the drug screening of using the enzyme target to carry out this area, and it can utilize automatization, high yield technology to carry out.
Albumen or proteolytic enzyme itself can be used to measure small molecules and described proteic binding affinity.There is the drug screening of using the enzyme target to carry out this area, and it can utilize automatization, high yield technology to carry out.
May be used to predict osteoarthritis and other relates to the treatment of diseases effect of joint cartilage and other tissue deterioration to the active restraining effect of protein degradation, described degeneration comprises substrate degradation, for example tissue remodeling etc.Gene therapy
No matter how to say in theory, metalloprotease be considered in the osteoarthritis course of disease in tissue be subjected to up-regulated.We are surprised to find, in osteoarthritis, people's protein degradation in human chondrocytes be subjected to up-regulated.Suppressing signal transduction mechanism can effectively interrupt osteoarthritis and other and relate to a succession of chain reaction in the disease of cartilage degradation.The technician can be understood that, is to cause one of arthritic reason if just regulating, and disturbing the activity of this gene so will be effective in the treatment osteoarthritis.
This can reach by the arbitrary method in many methods, comprising gene (being antisense) therapy.The purifying of proteolytic enzyme
Comprise reorganization protein degradation or the segmental of this albumen total length and be used to purifying protein degradation or protein degradation fragment from Mammals, yeast, insect or eukaryotic substratum, cell extract or inclusion body.Can before the continuous chromatography resin purification or at last after separating, add the solution that comprises the sex change protein degradation again.As requested, in the presence of one or more composition scale removers, denaturing agent or organic solvent (for example octyl glucoside, urea or dimethyl sulfone), preparation substratum, cell extract or dissolved protein degradation.Separately or unite and use ion-exchange and hydrophobic interaction chromatography that reorganization protein degradation and cell species impurity are separated.With sample on these materials on chromatography column, by regulating pH, change ionic strength, adding denaturing agent and/or wash-out protein degradation with an organic solvent.The solution that will contain protein degradation then usually carries out the locus specificity purifying of protein degradation by an antibody affinity chromatography column or part affinity chromatography column.The immunoaffinity chromatography column contains the specific antibody of protein degradation, and they are fixed on the solid phase carrier, for example Sepharose4B (Pharmacia) or other analogous material.Be preferably, remove non-binding albumen, utilize low pH glycine buffer or high ionic strength to come the wash-out protein degradation by washing post.Part affinity chromatography column may have the specificity to the protein degradation avtive spot, or removes from this site to the specificity of the part of avtive spot annex or with it.Wash post, come the wash-out protein degradation by in elution buffer, adding the competition molecule.Be preferably, all exist the protease inhibitor cocktail that comprises one or more proteinase inhibitor in the whole process of purifying, this class inhibitor is benzenyl amidine, leupeptin, phosphoramidon, phenyl methyl sulfonic acid fluoride and 1 for example, the 10-phenanthroline.Can add for example various scale removers of octylsulfo glucoside and Triton X-100, or for example the chemical reagent of glycerine improves the solubleness and the stability of protein degradation.As required, come purifying protein by the gel-filtration on the chromatography carrier at last.The inhibition of protein degradation
Proteolytic enzyme of the present invention can be used to seek the inhibition of this proteolytic enzyme.Therefore, it can be used as screening implement or be used for the reasoning medicinal design.No matter how to say that in theory proteolytic enzyme can be regulated cell and reinvent, and in fact may strengthen cell extracellular matrix (matrix) and reinvent, and promote the degraded of tissue thus.Therefore, suppressing protein degradation, a kind of treatment is provided is the treatment of diseases approach of feature with the said process.
In screening, medical compounds can be used for inhibiting qualitative and quantitative.As a result, the small molecule active composition of the activeconstituents of selecting effectively to treat described disease-especially-provide information is provided described screening method.
In treatment, can be used to suppress reinventing of extracellular matrix to the active restraining effect of Proteins, disintegrins by small molecules, synthetic metalloprotein enzyme inhibitor (for example be used to suppress matrix metalloproteinase those).Proteic antibody
By metalloprotein enzyme inhibitor and antibody or its fragment coupling can be sought metalloprotease.The link coupled method is well known in the art.Thus, this antibody-like can be used for the treatment of and monitor the amount of inhibitor.
Antibody of the present invention can also with the solid phase carrier coupling.Such conjugate can be used as compatible host response reagent and be used for purifying required metalloprotease, especially protein degradation.
In addition, can be with antibody of the present invention and the direct coupling of mark.When antibody combines with metalloprotease, can utilize mark to detect the metalloprotease that whether has higher level in vivo or in the vitro cell culture.
For example, can use the target-seeking part that can play specific reaction with the mark of the target tissue of expecting.With the method for compound of the present invention and target-seeking ligand coupling is known, and with hereinafter described similar with coupling method carrier.The preparation of conjugate is described referring to preamble with use.The preparation of antibody and purposes
Antibody can be made by several different methods, for example, can give suitable experimenter (for example Mammals) with the albumen infusion, comprises mouse, rabbit etc.Scheme comprises according to certain procedure preferably, and the repetition infusion is contained in the immunogen in the adjuvant, strengthens production of antibodies in the serum thus.Utilize immune analysis method can record tiring of immune serum easily, described method has now become the standard method of this area.
Can directly use thus obtained antiserum(antisera), perhaps can prepare monoclonal antibody, promptly, keep producing the vigor of antibody cell, identify suitable antibody producing person with the standard immunoassay analytical technology then by collecting the spleen of peripheral blood lymphocyte or immunized animal.
Polyclone or mono-clonal preparation can be used for monitoring treatment or the prevention scheme of having used The compounds of this invention.The different moment in the course of treatment, utilize the appropriate samples of standard immunoassay analytical technology test case of having used antibody preparation of the present invention as obtaining by blood, serum, urine or saliva, whether test wherein exists described albumen.
Described antibody can also utilize the standard coupling technology and be the mark couplings such as scintiscanning mark of example with technetium 99 or I-131.The position of one or more metalloproteases of excessive existence in the compound of crossing for experimenter's applying marking, detection bodies.Therefore, the proteic antibody through mark can be used as the described screening implement that adds strongly expressed, the existence of indication disease.
So the ability of antibody selective binding metalloprotease is used to make the original position distribution plan of enzyme.This technology can also be used in the Histological method, and the antibody that mark is crossed can be used in the competitive immunization analytical method.
Antibody preferably utilizes currently known methods and other compound or material coupling mutually.For example, have the material of carboxyl functional group, its carboxyl residue can be reduced into aldehyde, and by with the reaction and the carrier coupling of side chain amino, can then reduce the imido key that forms.The carboxyl residue can also utilize for example condensing agent such as dicyclohexyl carbodiimide or other carbodiimide dewatering agent and the amino reaction of side chain.Also can use linker compounds to cause linked reaction; Homology difunctionality and allos bifunctional linker compound can be to Pierce Chemical Company, Rockford, and I11 buys.
Can be used for protein isolate when above antibody and suitable chromatography material coupling.The separation method that utilizes affinity chromatograph is well known in the art, also is known to the technician.Disease marker
As mentioned above, the present invention can monitor the expression of metalloprotease gene in comprising the sample of illing tissue.The present invention is not subjected to the restriction of the characteristic in nucleic acid (DNA or RNA) source; The present invention has considered multiple source, comprising but be not limited to Mammals property source (for example cancerous tissue, lymphocyte etc.).
No matter how theory to say, genetic expression-especially may have limitation tissue distribution and expression-be subjected to the just regulation and control of potential osteoarthritis mediators.For example, the add strongly expressed of described gene (and relating to its albumen thus) in articular chondrocytes provides the mark of monitoring the osteoarthritis course of disease development that comprises incunabulum, asymptomatic stage and progressive stage.So the antibody that produces because of described albumen will play the described effect that adds the testing tool of strongly expressed, indicate the existence of disease thus.
In addition, when being used to detect disease, can with antibody with contain the material coupling of chromophore or fluorophore, perhaps can with the enzyme coupling that generates chromophore or fluorophore under specific circumstances.Described coupling method and coupling material are well known in the art.When using in this way, utilizing immunoassay to detect albumen for the skilled person is understandable being easy to do.For example, body fluid (serum, urine, synovia) be can detect in this way, the distribution of metalloprotease or the rising of described proteolytic enzyme level are used to demarcate and detect.
When the present invention uses in this way, be the diagnosis and/or the clinical marker of disease of the metalloid protease mediation of a kind of useful for example osteoarthritis or other articular cartilage degeneration disease.In a single day disease is detected, and just can be treated before symptom or the weak beginning of anergy.
And such antibody can also be sought target illing tissue, to be used for previously described detection or treatment by nucleic acid deutero-instrument
Intracellular nucleic acid comprises thymus nucleic acid (DNA) and Yeast Nucleic Acid (RNA).DNA is comprising the genetic blueprint of cell.RAN is as the proteinic production of intermediate participation based on dna sequence dna.Intracellular RNA has three kinds of form: structure RNA (being ribosome-RNA(rRNA), " rRNA "), participates in the transfer RNA (" tRNA ") and the messenger RNA(mRNA) (" mRNA ") of translation.Because mRNA is the genetic information of coding in the DNA and the tertium quid between the respective egg white matter, at any time, intracellular mRNA component chief representative physiological status of cells.In order to study and utilize the molecular biology of cell, can purified mRNA, comprise that purified mRNA is crucial from the total nucleic acid of sample.
The preparation of RNA become because there being the degradation of rna rnase complicated (for example, T.Maniatis etc., molecular cloning, PP.188-190, Cold Spring Harbor Laboratory (1982)).And, but the preparation cloning RNA becomes difficult because exist with RNA bonded ribosomal protein.(referring to, R.J.Slater: Protocols in Molecular Biology, J.M.Walter﹠amp; W.Gaastra edits, Macmillan, NY, pp.113-120 (1983)).
Usually, the step of purification of nucleic acid comprises from cell: 1) lysis; 2) nuclease of as killed cells; With 3) with required nucleic acid and cell debris and other separate nucleic acid.Lysis can be undertaken by several different methods, comprises enzyme, scale remover or chaotropic agent processing.The as killed cells nuclease can carry out with proteolytic enzyme and/or with strong salt.At last, separate required nucleic acid usually by carrying out with phenol or phenol-chloroform extraction nucleic acid; This method is assigned to sample in liquid phase (containing nucleic acid) and the organic phase (containing other cell composition that comprises protein).Method commonly used requires to use phenol (P.Chomczynski﹠amp with salt; N.Sacchi, Anal.Biochem.162:156 (1987)) or by the centrifugal protein (R.J.Slater, the same) that removes.
In case after from cell, isolating nucleic acid, just can help purified mRNA from DNA and other RNA molecule with the structure of mRNA molecule.Because the mRNA of higher organism generally is (" poly-A tail " or " the poly-A section ") of polyadenylation at its 3 ' end, the combining of complementary sequence (being oligomerization dT) on being based on poly-A tail and being connected Mierocrystalline cellulose and so on carrier from one of method of cellular segregation RNA.Usually, separate with other component in the sample, perhaps in magnetic methods, then separate by accepting the action of a magnetic field by centrifugal mRNA/ oligomerization dT with hybridization.The mRNA/ oligomerization dT of hybridization with after other component in the sample separates, is generally separated mRNA immediately from oligomerization dT.But, concerning some purposes, mRNA can be still be connected solid phase carrier on oligomerization dT combining.
Developed many solid phase carriers that connect oligomerization dT, and can buy.For most of oligomerization dT system, Mierocrystalline cellulose remains the most frequently used carrier, but has developed and can buy oligomerization dT and latex microballon and the covalently bound system of paramagnetic particle.Can in biotin-avidin system, use paramagnetic particle, in this system, biotinylated oligomerization dT in solution with the mRNA annealed combination.Catch crossbred with the paramagnetic particle that has been coated with Streptavidin then, utilize magnetic field to separate.Except that aforesaid method, also have many improving one's methods, for example in spin-column chromatography, utilize affinity from Eukaryotic total RNA, to be purified into the RNA of polyadenylation.The hybridization of poly-A mRNA all takes place in these methods, but efficient and sensitivity have nothing in common with each other.
In one of embodiment, mRNA handles through reversed transcriptive enzyme and generates cDNA.Use primer hereinafter, this cDNA can be used among primer extension reaction and the PCR.So, the present invention includes nucleic acid molecule by using primer hereinafter to measure with primer extension reaction.Primer extension reaction (PCR) can (claim " high rigorous condition " again) under such condition carries out, and promptly has only complementary nucleic acid to hybridize (opposite with the hybridization of part complementary nucleic acid).Such condition is included in or anneals near double-stranded melting temperature.Primer at specific Proteins, disintegrins gene
The invention provides one section new full-length proteins coding region sequence in the new Proteins, disintegrins gene, this sequence can be used for identifying the Proteins, disintegrins expression of gene.In one of embodiment, use primer at this tract part to detect this gene order and whether exist.This class primer can also be used to identifying the cDNA clone of the full gene of representative, allows the nucleotide sequence of coding Proteins, disintegrins or its fragment (or mutant) recombinant expressed in host cell.
Primer is SEQ ID NO:9 (5 '-AGCCTGTGTC-3 ') and SEQ ID NO:10 (5 '-AGCCTGTGTCTGAACCACT-3 ') preferably.But, can design other primer easily according to the sequence that SEQ ID NO:5 and SEQ ID NO:1 provide.Come the method for comparison biological sample by mRNA differential display mRNA
The feature that can be tested and appraised reaction product is confirmed the success of amplified reaction.The detection extension products that the present invention is not limited to tell or the method for PCR product.In one of embodiment, analyze the PCR product, by ethidium bromide staining and the irradiation luminous dna fragmentation of observing amplification of UV by the high resolving power agarose gel electrophoresis that uses 2% sepharose (BRL).In one of embodiment, the present invention utilizes electrophoresis to confirm the formation of product and the result difference between comparative sample.
So, present invention resides in the new Proteins, disintegrins gene order (for example cDNA or RT-mRNA) of evaluation in the nucleic acid mixture.PCR by nucleic acid mixture walks gel electrophoresis with product then, thus " separation " go out to comprise the nucleic acid of the defined sequence of primer.Can bring " purifying " product (perhaps by other suitable methods such as for example electroelutions) by cut this from gel then.The sequence table general introduction
In order to help the reader understanding, the mutual relationship in the sequence table is as described below:
SEQ ID NO:1 is the section of DNA fragment, is the part of SEQ ID NO:3.First base of SEQ ID NO:1 (cytosine(Cyt) or C) is the 940th base of SEQ ID NO:3.Two dna sequence dnas partly are identical at its crossover.
SEQ ID NO:2 and SEQ ID NO:4 are respectively SEQ ID NO:1 and the expressed aminoacid sequence of SEQ ID NO:3 nucleotide sequence.First amino acid Gln of SEQ ID NO:2 is the 309th amino acid among the SEQ ID NO:4.Two sequences are homologous until proteinic C-terminal.
SEQ ID NO:7 is that mRNA differential display mRNA is tested the sense strand among the DNA that produces.First base is corresponding to the 2310th bit base among the 1371st bit base among the SEQ ID NO:1 and the SEQ ID NO:3 among the SEQ ID NO:7.These sequences are homologous in 452 bases, until the base 1822 of SEQ ID NO:1 and the base 2761 of SEQ IDNO:3.The difference of SEQ ID NO:1 and the most last two bases of SEQ ID NO:3 may be because of common repetitive error among sequencing error or the PCR, perhaps may be the part of certain cloning vector.After homology part, so 284 bases more than the SEQ ID NO:7 are considerably beyond the end of SEQ ID NO:1 and SEQ IDNO:3.
In addition, the base 477 among the SEQ ID NO:7 to base 716 is SEQ ID NO:6.SEQ IDNO:6 is the sense strand of SEQ ID NO:5, and SEQ ID NO:5 is the antisense strand of finding by the mRNA differential display mRNA clone.So, the orientation that SEQ ID NO:6 has showed DNA, with in mRNA, occurred the same.These two sections sequences are found 3 ' end near this gene.
Though terminal different with SEQ ID NO:1 and SEQ ID NO:3 of base 452 to 3 ' among the SEQ ID NO:7, SEQ ID NO:7 is still effectively.Must be pointed out that the peptide sequence that gives expression to is not subjected to the influence of above-mentioned difference.Seem, it is because used different polyadenylation signals with SEQ ID NO:3 that these bases are not present in SEQ ID NO:1.
SEQ ID NO:8 is one section new full length DNA sequence.SEQ ID NO:9 is the new albumen that SEQ ID NO:8 expresses.The difference of SEQ ID NO:9 and SEQ ID NO:4 is, amino acid/11 62 (Ser)-213 (Tyr) is substituted by an amino acid Asn of the 162nd among the SEQ ID NO:9 among the SEQ ID NO:4.This change makes DNA lack 153 bases altogether from base 501 to 654, has destroyed the integrity of reading frame, still compares with SEQ ID NO:4 only to have changed a residue and lacked 51 amino acid.
SEQ ID NO:10 and SEQ ID NO:11 are the used antisense primers of PCR, are the minus strands of the 3 ' end of SEQ ID NO:7, and according to the sequence of mentioning herein, those of skill in the art can discern other sequence of primer.
Embodiment
Following non-limiting example has illustrated the present invention's embodiment preferably, brief description purposes of the present invention.These embodiment can be used as the guiding to those skilled in the art, but are not limitation of the invention fully.By means of disclosure and the embodiment of this paper, those skilled in the art can make and use the present invention.
What these embodiment used is the standard initiator.Many in these materials is known and can buy.For example, intestinal bacteria CJ236 and JM101 are known bacterial strains, and pUB110 is known plasmid, and the Kunkel mutagenesis also is the known technology of this area.In addition, some clone and cDNA can buy, for example, can be to Clontech Inc.Palo Alto, California buys U937.
Multiple varient can make with several different methods by multiple expression system with in multiple host, and these methods belong in molecular biology, biological chemistry or other biotechnology various equivalent modifications known range.Embodiment 1
Never irriate is trained in the class thing with the normal people's articular chondrocytes that stimulated by il-1 and is isolated RNA.The RNA reverse transcription is become cDNA.Utilize a series of random primers that cDNA is carried out modified mRNA differential display mRNA.
With stimulating and the PCR sample of non-stimulation chondrocyte generation carries out electrophoresis in the adjacent swimming lane on polyacrylamide gel.From gel, cut the band of differential expression, clone and check order.RNA enzyme protection and nuclear run-on experiment confirm that gene is by differential expression.Embodiment 2
Utilize currently known methods, obtain the groups of people cDNA of new encoding said proteins by person joint (femur termination) the chondrocyte's primary culture clone who stimulates with il-1.
Found identical sequence therein, obtained full-length clone by the screening human cDNA library and come the completion gene.Embodiment 3
Utilize currently known methods that the cloned DNA among the embodiment 2 is added among the pUB110.
Above-mentioned plasmid is used to transformed into escherichia coli, and is used for site-directed mutagenesis and carries out the Kunkel mutagenesis with the template that produces new mutant Gln1 is changed into Ala.Embodiment 4
With IODOBEADS (Pierce, Rockford, IL; Chloramine-T is fixed on the atresia polystyrene microbeads) preparation [ 125I] protein degradation antibody.The antibody of cryodrying (2 microgram) is absorbed in the acetate of 50 microlitres, 10 millimolar concentrations, and be added on ice 450 microlitre phosphate buffered salines (PBS) (Sigma, St.Louis, MO) in.In test tube, add 5 microlitres 500 microcuries 125I (Amersham, Arlington Heights, IL) (2200 Curie/mmole) and an IODOBEAD.Incubation reaction on ice 10 minutes, or ground shaken stirring.Separate to come termination reaction by reacting system with IODOBEAD then.Unreacted in order to remove 125I, mixture by last sample on the PD-10 gel-filtration column.Embodiment 5
(King ofPrussia Pa) mixes with protein degradation for Bachem, Guelph Mills, and test and appraisal fluorescence changes in the time of 2 minutes, with this in contrast with fluorescigenic Proteins, disintegrins peptide substrate.In another time test and appraisal, in the presence of compound, fluorescence generation peptide is mixed with protein degradation then, tested and assessed in different time points in from 2 to 12 hours.Utilize standard method test and appraisal data, so that the relative combination of test compound to be provided.Embodiment 6
0.5 milliliter of the synovia of extraction patient left side knee utilizes the rising of ELISA test protein degradation level.The result shows that the protein degradation level is higher than normally.The prescription that the patient obtains is the protein degradation inhibition of oral preventive dose in for some time, or carries out the injection of same medicine before leaving the clinic at left knee.Embodiment 7
By the active restraining effect of Proteins, disintegrins is detected the restraining effect that extracellular matrix is reinvented.Utilize small molecules to synthesize the metalloprotein enzyme inhibitor, for example be used to suppress those of matrix metalloproteinase, the integrity and the proteoglycan of monitoring tissue.
The nose of an ox joint cartilage sample cultivation that a IL-1 stimulates is in the solution that contains 1 micromole's small molecules protein degradation inhibition.With this experiment with in contrast be grown in the unrestraint thing solution identical culture relatively.
Test to culture after 7 days shows that tissue degradation is less in the downtrod culture, and the proteoglycan in the culture serum is also less.This result is consistent with aggrecan ether activity inhibited.Can suppress tissue degradation and reduce the release of proteoglycan the inhibition of aggrecan enzyme.Embodiment 8
Suppress enzymolysis and process the release that causes with cytolemma bonded Proteins, disintegrins structural domain, this has just suppressed the signal transmission of film in conjunction with protein degradation molecule " second messenger ".Described second messenger's signal transmission can cause the change of cell phenotype, the change of genetic expression, the change of mitogen activation etc.
Handle the known cell that contains protein degradation with serine protease.Measure the albumen that from cell, discharges with standard method.Specifically, utilize literature method monitoring MMP activities.The amount of the metalloprotease that discharges is associated with the amount of the used serine protease of processing cell.
After Proteins, disintegrins is cut and discharges, utilize the monoclonal antibody specific of Tyrosine O-phosphate to record of the rising of src tyrosine kinase activity with respect to control group by Western marking analysis to intracellular protein.Contrast is the cell that serine protease of no use was handled.
Src tyrosine kinase activity with (or its cell culture) in the technical measurement cell on the document.Also with the release of metalloprotease structural domain on the technical monitoring protein degradation on the document.Asking of src tyrosine kinase activity exists proportional relation in the release of metalloprotease structural domain and born of the same parents.It is consistent that this result has stimulated the cell signal of protein degradation mediation to send with the chain effect of src Tyrosylprotein kinase.Embodiment 9
Measure the combination of integrating element with the peptide that comprises sequence RGD.Inhibition to intercellular adsorbed molecules or extracellular matrix component has caused the inhibition that the cell phenotype relevant with this class interaction changed, and described change comprises the change of cell shape.
This result be consistent to interactional competition of protein degradation or blocking-up.The RGD peptide suppresses cell change in the chondrocyte.Strengthening with synthetic increase of matrix and matrix metal proteinase activity is the not appearance of osteoarthritis phenotype of feature.Can utilize other cell change of being convenient to record to check this result, comprising expression of gene, mitogen activation change etc.Embodiment 10
According to the method for embodiment 7, remove to handle tissue culture with small molecules metalloprotein enzyme inhibitor.Measure the release of TNF-α from the cytolemma with literature method.Inhibition among the embodiment 7 also reduces the release of TNF-α from the cytolemma.
Think that thus active inhibition will cause to the inflammation chain reaction of protein degradation dependency with to the inhibition of secretase activity to Proteins, disintegrins.It is believed that monitoring cytokine or the IL-1 release from the cytolemma etc. will draw identical result.Embodiment 11 utilization variances are showed the screening disease
Irriate and be subjected to isolation of RNA in normal people's articular chondrocytes culture that IL-1 stimulates never.The RNA reverse transcription is become cDNA.With preamble primer (PCR) these cDNA that increase.The neighbouring lane of PCR product on polyacrylamide gel of irriate and not chondrocyte's generation of irriate carries out electrophoresis.Cut the band (that is, only at the irriate cell inner expression, and at the band that cell inner expression is not obvious or expression level can't record of irriate not) of differential expression from gel, the clone, and carry out the part order-checking.SEQ ID NO:5 has shown partial sequence, and the homology with rat metalloprotease (seeing above) about 60% is revealed in this sequence table.The homology with people's metalloprotease (see GenBank#Z48579, see Fig. 2) about 85% is revealed in this sequence table.Embodiment 12 detects the cancer metastasis possibility
Detect the expression of metalloprotease gene in the cancerous tissue.From sample, extract nucleic acid, carry out PCR with the preamble primer.High-caliber transcription product represents that metastatic potential is arranged.Embodiment 13 screenings are as the medicine of expression inhibitor
Candidate inhibitor at the in-vitro screening metalloproteinase gene expression.With il-1 stimulated healthy articular chondrocytes culture, make it contact with candidate inhibitor external.Isolate RNA, reverse transcription becomes cDNA.With these cDNA of preamble primer amplification (PCR).Contact the chondrocyte of inhibitor and the neighbouring lane of PCR sample on polyacrylamide gel of uncontrolled chondrocyte generation and carried out electrophoresis.Inhibitor is identified in minimizing according to the PCR product.Embodiment 14 screenings are as the medicine of inhibitors of metalloproteinase
The candidate inhibitor of in-vitro screening metalloprotease self.With il-1 stimulated healthy articular chondrocytes culture, having and do not having in the presence of the candidate inhibitor, get culture supernatants and on suitable metalloprotein enzyme substrates (for example stromatin), analyze.With known inhibitor (for example, available from Sigma Co., 1 of St.Louis, 10-phenanthroline) in contrast.Inhibitor is identified in reduction according to substrate (for example, fluorescigenic Proteins, disintegrins substrate) Degradation Level.Embodiment 15
Utilize standard technique screening U-937, a monocytoid cell cDNA is the library, isolates the clone of a 1400bp.Initial sequence is the clone of a brachymemma, has lacked the part of 5 ' end.Generate 5 ' end by known 5 ' R.A.C.E. (the terminal rapid amplifying of 5 cDNA, referring to PCR method, methods and applications are crossed the threshold, editors such as Innis, 1990 Academic Press), produce a clone who comprises the 1600bp of all the other 5 ' sequences.These two sections sequences provide the SEQ ID NO:8 that produces peptide sequence jointly.Embodiment 16
Primer SEQ ID NO:9 (5 '-AGCCTGTGTC-3 ') and SEQ ID NO:10 (5 '-AGCCTGTGTCTGAACCACT-3 ') are used to mRNA differential display mRNA mRNA (ddrd-PCR).In PCR, use 2-5ng sscDNA.Reaction system is earlier in 0.2 μ l thin-walled precooling on ice in vitro.Every pipe contains 50mMTrisHCl (pH8.5), 50mM KCl, 1.5mM MgCl 2, the various dNTP of 1mM, 2-5ng sscDNA, the various preamble primers of 10pmoles, 05. μ l α-P 33(10 μ Ci/ μ l, Amersham), and to add the water constant volume be 20 μ l to dCTP.(Perkin-Elmer, Norwalk CT) carry out 35 to mixture and take turns sex change (94 ℃ 30 seconds), annealing (36 ℃ 30 seconds) and extension (72 ℃ 1 minute) to use Perkin-Elmer 2400 system's thermal cyclers.
Utilize above method, the chondrocytes expressed of handling through IL-1 with the mRNA of this gene-correlation, the contrast chondrocyte of be untreated (no IL-1) does not then have expression can survey the mRNA of level.Embodiment 17 high-energy can be modified into the test macro of high yield screening
In dynamically enzyme suppresses to test, measure the protease activity of protein degradation with fluorogenic substrate.What use is clone's degrading proteinase and fluorescently-labeled small molecular protein substrate.Measure the room temperature fluorescence of thing molecule after cutting of going to the bottom, thus quantitative enzymic activity.This test is very simple, and easily is automated.
Utilize standard technique, this test can adapt to 96 holes or 384 hole test panels.
This paper is with reference to whole reference of mentioning in the literary composition.
Though below described specific embodiments of the present invention, it should be apparent to those skilled in the art that within the spirit and scope of the present invention and can carry out many changes and modification.Claims hereinafter are intended to contain the modification in all these scope of the invention.
Sequence table (1) general information
(ⅰ) applicant: Tindal, Michael H
Haqqi．Tariq?M
(ⅱ) denomination of invention: the purposes of new Proteins, disintegrins, its mutant, fragment etc.
(ⅲ) sequence quantity: 11
(ⅳ) address:
(A) addressee: The Protect﹠amp; Gamble Company
(B) street: 8700 Mason-Montgomery Road
(C) city: Mason
(D) state: OH
(E) country: the U.S.
(F) postcode: 45040-9462
(ⅴ) computer-reader form:
(A) media types: floppy disk
(B) computer: IBM PC compatible
(C) operating system: PC-DOS/MS-DOS
(D) software: PatentIn Release#1.0, #1.30 version
(ⅵ) current application information:
(A) application number:
(B) applying date:
(C) classification:
(ⅷ) lawyer/proxy's information:
(A) name: Hake, Richard A
(B) accession designation number:
(C) reference/folder numbering:
(ⅸ) telecommunication information:
(A) phone: 513/622-0087
(B) fax: 513/622-0270
(2) information of SEQ ID NO:1:
(ⅰ) sequence signature:
(A) length: 1824 base pairs
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(ⅱ) molecule type: DNA (genome)
(ⅸ) feature:
(A) title/code: CDS
(B) position: 2..1477
(ⅹ ⅰ) SEQ, ID, the sequence description of NO:1:, CAG, ACC, ACA, GAC, TTC, TCC, GGA, ATC, CGT, AAC, ATC, AGT, TTC, ATG, GTG, 46, Gln, Thr, Thr, Asp, Phe, Ser, Gly, Ile, Arg, Asn, Ile, Ser, Phe, Met, Val, 1, 5, 10, 15, AAA, CGC, ATA, AGA, ATC, AAT, ACA, ACT, GCT, GAT, GAG, AAG, GAC, CCT, ACA, AAT, 94, Lys, Arg, Ile, Arg, Ile, Asn, Thr, Thr, Ala, Asp, Glu, Lys, Asp, Pro, Thr, Asn, 20, 25, 30, CCT, TTC, CGT, TTC, CCA, AAT, ATT, AGT, GTG, GAG, AAG, TTT, CTG, GAA, TTG, AAT, 142, Pro, Phe, Arg, Phe, Pro, Asn, Ile, Ser, Val, Glu, Lys, Phe, Leu, Glu, Leu, Asn, 35, 40, 45, TCT, GAG, CAG, AAT, CAT, GAT, GAC, TAC, TGT, TTC, GCC, TAT, GTC, TTC, ACA, GAC, 190, Ser, Glu, Gln, Asn, His, Asp, Asp, Tyr, Cys, Leu, Ala, Tyr, Val, Phe, Thr, Asp, 50, 55, 60, CGA, GAT, TTT, GAT, GAT, GGC, GTA, CTT, GGT, CTG, GCT, TGG, GTT, GGA, GCA, CCT, 238, Arg, Asp, Phe, Asp, Asp, Gly, Val, Leu, Gly, Leu, Ala, Trp, Val, Gly, Ala, Pro, 65, 70, 75, TCA, GGA, AGC, TCT, GGA, GGA, ATA, TGT, GAA, AAA, AGT, AAA, CTC, TAT, TCA, GAT, 286, Ser, Gly, Ser, Ser, Gly, Gly, Ile, Cys, Glu, Lys, Ser, Lys, Leu, Tyr, Ser, Asp, 80, 85, 90, 95, GGT, AAG, AAG, AAG, TCC, TTA, AAC, ACT, GGA, ATT, ATT, ACT, GTT, CAG, AAC, TAT, 334, Gly, Lys, Lys, Lys, Ser, Leu, Ash, Thr, Gly, Ile, Ile, Thr, Val, Gln, Asn, Tyr, 100, 105, 110, GGG, TCT, CAT, GTA, CCT, CCC, AAA, GTC, TCT, CAC, ATT, ACT, TTT, GCT, CAC, GAA, 382, Gly, Ser, His, Val, Pro, Pro, Lys, Val, Ser, His, Ile, Thr, Phe, Ala, His, Glu, 115, 120, 125, GTT, GGA, CAT, AAC, TTT, GGA, TCC, CCA, CAT, GAT, TCT, GGA, ACA, GAG, TGC, ACA, 430, Val, Gly, His, Asn, Phe, Gly, Ser, Pro, His, Asp, Ser, Gly, Thr, Glu, Cys, Thr, 130, 135, 140, CCA, GGA, GAA, TCT, AAG, AAT, TTG, GGT, CAA, AAA, GAA, AAT, GGC, AAT, TAC, ATC, 478, Pro, Gly, Glu, Ser, Lys, Asn, Leu, Gly, Gln, Lys, Glu, Asn, Gly, Asn, Tyr, Ile, 145, 150, 155, ATG, TAT, GCA, AGA, GCA, ACA, TCT, GGG, GAC, AAA, CTT, AAC, AAC, AAT, AAA, TTC, 526, Met, Tyr, Ala, Arg, Ala, Thr, Ser, Gly, Asp, Lys, Leu, Asn, Asn, Asn, Lys, Phe, 160, 165, 170, 175, TCA, CTC, TGT, AGT, ATT, AGA, AAT, ATA, AGC, CAA, GTT, CTT, GAG, AAG, AAG, AGA, 574, Ser, Leu, Cys, Ser, Ile, Arg, Asn, Ile, Ser, Gln, Val, Leu, Glu, Lys, Lys, Arg, 180, 185, 190, AAC, AAC, TGT, TTT, GTT, GAA, TCT, GGC, CAA, CCT, ATT, TGT, GGA, AAT, GGA, ATG, 622, Asn, Asn, Cys, Phe, Val, Glu, Ser, Gly, Gln, Pro, Ile, Cys, Gly, Asn, Gly, Met, 195, 200, 205, GTA, GAA, CAA, GGT, GAA, GAA, TGT, GAT, TGT, GGC, TAT, AGT, GAC, CAG, TGT, AAA, 670, Val, Glu, Gln, Gly, Glu, Glu, Cys, Asp, Cys, Gly, Tyr, Ser, Asp, Gln, Cys, Lys, 210, 215, 220, GAT, GAA, TGC, TGC, TTC, GAT, GCA, AAT, CAA, CCA, GAG, GGA, AGA, AAA, TGC, AAA, 718, Asp, Glu, Cys, Cys, Phe, Asp, Ala, Asn, Gln, Pro, Glu, Gly, Arg, Lys, Cys, Lys, 225, 230, 235, CTG, AAA, CCT, GGG, AAA, CAG, TGC, AGT, CCA, AGT, CAA, GGT, CCT, TGT, TGT, ACA, 766, Leu, Lys, Pro, Gly, Lys, Gln, Cys, Ser, Pro, Ser, Gln, Gly, Pro, Cys, Cys, Thr, 240, 245, 250, 255, GCA, CAG, TGT, GCA, TTC, AAG, TCA, AAG, TCT, GAG, AAG, TGT, CGG, GAT, GAT, TCA, 814, Ala, Gln, Cys, Ala, Phe, Lys, Ser, Lys, Ser, Glu, Lys, Cys, Arg, Asp, Asp, Ser, 260, 265, 270, GAC, TGT, GCA, AGG, GAA, GGA, ATA, TGT, AAT, GGC, TTC, ACA, GCT, CTC, TGC, CCA, 862, Asp, Cys, Ala, Arg, Glu, Gly, Ile, Cys, Asn, Gly, Phe, Thr, Ala, Leu, Cys, Pro, 275, 280, 285, GCA, TCT, GAC, CCT, AAA, CCA, AAC, TTC, ACA, GAC, TGT, AAT, AGG, CAT, ACA, CAA, 910, Ala, Ser, Asp, Pro, Lys, Pro, Asn, Phe, Thr, Asp, Cys, Asn, Arg, His, Thr, Gln, 290, 295, 300, GTG, TGC, ATT, AAT, GGG, CAA, TGT, GCA, GGT, TCT, ATC, TGT, GAG, AAA, TAT, GGC, 958, Val, Cys, Ile, Asn, Gly, Gln, Cys, Ala, Gly, Ser, Ile, Cys, Glu, Lys, Tyr, Gly, 305, 310, 315, TTA, GAG, GAG, TGT, ACG, TGT, GCC, AGT, TCT, GAT, CGC, AAA, GAT, GAT, AAA, GAA, 1006, Leu, Glu, Glu, Cys, Thr, Cys, Ala, Ser, Ser, Asp, Gly, Lys, Asp, Asp, Lys, Glu, 320, 325, 330, 335, TTA, TGC, CAT, GTA, TGC, TGT, ATG, AAG, AAA, ATC, CAC, CCA, TCA, ACT, TGT, GCC, 1054, Leu, Cys, His, Val, Cys, Cys, Met, Lys, Lys, Met, Asp, Pro, Ser, Thr, Cys, Ala, 340, 345, 350, AGT, ACA, GGG, TCT, GTG, CAG, TGG, AGT, AGG, CAC, TTC, AGT, GGT, CGA, ACC, ATC, 1102, Ser, Thr, Gly, Ser, Val, Gln, Trp, Ser, Arg, His, Phe, Ser, Gly, Arg, Thr, Ile, 355, 360, 365, ACC, CTG, CAA, CCT, GGA, TCC, CCT, TGC, AAC, GAT, TTT, AGA, GGT, TAC, TGT, GAT, 1150, Thr, Leu, Gln, Pro, Gly, Ser, Pro, Cys, Asn, Asp, Phe, Arg, Gly, Tyr, Cys, Asp, 370, 375, 380, GTT, TTC, ATG, CGG, TGC, AGA, TTA, GTA, GAT, GCT, GAT, GGT, CCT, CTA, GCT, AGG, 1198, Val, Phe, Met, Arg, Cys, Arg, Leu, Val, Asp, Ala, Asp, Gly, Pro, Leu, Ala, Arg, 385, 390, 395, CTT, AAA, AAA, GCA, ATT, TTT, AGT, CCA, GAG, CTC, TAT, GAA, AAC, ATT, GCT, GAA, 1246, Leu, Lys, Lys, Ala, Ile, Phe, Ser, Pro, Glu, Leu, Tyr, Glu, ASn, Ile, Ala, Glu, 400, 405, 410, 415, TGG, ATT, GTG, GCT, CAT, TGG, TGG, GCA, GTA, TTA, CTT, ATG, GGA, ATT, GCT, CTG, 1294, Trp, Ile, Val, Ala, His, Trp, Trp, Ala, Val, Leu, Leu, Met, Gly, Ile, Ala, Leu, 420, 425, 430, ATC, ATG, CTA, ATG, GCT, GGA, TTT, ATT, AAG, ATA, TGC, AGT, GTT, CAT, ACT, CCA, 1342, Ile, Met, Leu, Met, Ala, Gly, Phe, Ile, Lys, Ile, Cys, Ser, Val, His, Thr, Pro, 435, 440, 445, AGT, AGT, AAT, CCA, AAG, TTG, CCT, CCT, CCT, AAA, CCA, CTT, CCA, GGC, ACT, TTA, 1390, Ser, Ser, Asn, Pro, Lys, Leu, Pro, Pro, Pro, Lys, Pro, Leu, Pro, Gly, Thr, Leu, 450, 455, 460, AAG, AGG, AGG, AGA, CCT, CCA, CAG, CCC, ATT, CAG, CAA, CCC, CAG, CGT, CAG, CGG, 1438, Lys, Arg, Arg, Arg, Pro, Pro, Gln, Pro, Ile, Gln, Gln, Pro, Gln, Arg, Gln, Arg, 465, 470, 475, CCC, CGA, GAG, AGT, TAT, CAA, ATG, GGA, CAC, ATG, AGA, CGC, TAA, CTGCAGCTTT, 1487, Pro, Arg, Glu, Ser, Tyr, Gln, Met, Gly, His, Met, Arg, Arg, 480, 485, 490, TGCCTTGGTT, CTTCCTAGTG, CCTACAATGG, GAAAATTTCA, CTCCAAAGAG, AAACCTATTA, 1547, AGTCATCATC, TCCAAACTAA, ACCCTCACAA, GTAACAGTTG, AAGAAAAAAT, GGCAAGAGAT, 1607, CATATCCTCA, GACCAGGTGG, AATTACTTAA, ATTTTAAAGC, CTGAAAATTC, CAATTTGGGG, 1667, GTGGGAGGTG, GAAAAGGAAC, CCAATTTTCT, TATGAACAGA, TATTTTTAAC, TTAATGGCAC, 1727, AAAGTCTTAG, AATATTATTA, TGTGCCCCGT, GTTCCCTGTT, CTTCGTTGCT, GCATTTTCTT, 1787, CACTTGCAGG, CAAACTTGGC, TCTCAATAAA, CTTTTCG, 1824, (2) SEQ, ID, the information of NO:2:
(ⅰ) sequence signature:
(A) length: 492 amino acid
(B) type: amino acid
(D) topological framework: linearity
(ⅱ) molecule type: protein
(ⅹ ⅰ) SEQ, ID, the sequence description of NO:2: Gln, Thr, Thr, Asp, Phe, Ser, Gly, Ile, Arg, Asn, Ile, Ser, Phe, Met, Val, Lys, 1, 5, 10, 15Arg, Ile, Arg, Ile, Asn, Thr, Thr, Ala, Asp, Glu, Lys, Asp, Pro, Thr, Asn, Pro, 20, 25, 30Phe, Arg, phe, Pro, Asn, Ile, Ser, Val, Glu, Lys, Pne, Leu, Glu, Leu, Asn, Ser, 35, 40, 45Glu, Gln, Asn, His, Asp, Asp, Tyr, Cys, Leu, Ala, Tyr, Val, Phe, Thr, Asp, Arg, 50, 55, 60Asp, Phe, Asp, Asp, Gly, Val, Leu, Gly, Leu, Ala, Trp, Val, Gly, Ala, Pro, Ser, 65, 70, 75, 80Gly, Ser, Ser, Gly, Gly, Ile, Cys, Glu, Lys, Ser, Lys, Leu, Tyr, Ser, Asp, Gly, 85, 90, 95Lys, Lys, Lys, Ser, Leu, Asn, Thr, Gly, Ile, Ile, Thr, Val, Gln, Asn, Tyr, Gly, 100, 105, 110Ser, His, Val, Pro, Pro, Lys, Val, Ser, His, Ile, Thr, Phe, Ala, His, Glu, Val, 115, 120, 125Gly, His, Asn, Phe, Gly, Ser, Pro, His, Asp, Ser, Gly, Thr, Glu, Cys, Thr, Pro, 130, 135, 140Gly, Glu, Ser, Lys, Asn, Leu, Gly, Gln, Lys, Glu, Asn, Gly, Asn, Tyr, Ile, Met145, 150, 155, 160Tyr, Ala, Arg, Ala, Thr, Ser, Gly, Asp, Lys, Leu, Asn, Asn, Asn, Lys, Phe, Ser, 165, 170, 175Leu, Cys, Ser, Ile, Arg, Asn, Ile, Ser, Gln, Val, Leu, Glu, Lys, Lys, Arg, Asn, 180, 185, 190Asn, Cys, Phe, Val, Glu, Ser, Gly, Gln, Pro, Ile, Cys, Gly, Asn, Gly, Met, Val, 195, 200, 205Glu, Gln, Gly, Glu, Glu, Cys, Asp, Cys, Gly, Tyr, Ser, Asp, Gln, Cys, Lys, Asp, 210, 215, 220Glu, Cys, Cys, Phe, Asp, Ala, Asn, Gln, Pro, Glu, Gly, Arg, Lys, Cys, Lys, Leu225, 230, 235, 240Lys, Pro, Gly, Lys, Gln, Cys, Ser, Pro, Ser, Gln, Gly, Pro, Cys, Cys, Thr, Ala, 245, 250, 255Gln, Cys, Ala, Phe, Lys, Ser, Lys, Ser, Gln, Lys, Cys, Arg, Asp, Asp, Ser, Asp, 260, 265, 270Cys, Ala, Arg, Glu, Gly, Ile, Cys, Asn, Gly, Phe, Thr, Ala, Leu, Cys, Pro, Ala, 275, 280, 285Ser, Asp, Pro, Lys, Pro, Asn, Phe, Thr, Asp, Cys, Asn, Arg, His, Thr, Gln, Val, 290, 295, 300Cys, Ile, Asn, Gly, Gln, Cys, Ala, Gly, Ser, Ile, Cys, Glu, Lys, Tyr, Gly, Leu305, 310, 315, 320Glu, Glu, Cys, Thr, Cys, Ala, Ser, Ser, Asp, Gly, Lys, Asp, Asp, Lys, Glu, Leu, 325, 330, 335Cys, His, Val, Cys, Cys, Met, Lys, Lys, Met, Asp, Pro, Ser, Thr, Cys, Ala, Ser, 340, 345, 350Thr, Gly, Ser, Val, Gln, Trp, Ser, Arg, His, Phe, Ser, Gly, Arg, Thr, Ile, Thr, 355, 360, 365Leu, Gln, Pro, Gly, Ser, Pro, Cys, Asn, Asp, Phe, Arg, Gly, Tyr, Cys, Asp, Val, 370, 375, 380Phe, Met, Arg, Cys, Arg, Leu, Val, Asp, Ala, Asp, Gly, Pro, Leu, Ala, Arg, Leu385, 390, 395, 400Lys, Lys, Ala, Ile, Phe, Ser, Pro, Glu, Leu, Tyr, Glu, Asn, Ile, Ala, Glu, Trp, 405, 410, 415Ile, Val, Ala, His, Trp, Trp, Ala, Val, Leu, Leu, Met, Gly, Ile, Ala, Leu, Ile, 420, 425, 430Met, Leu, Met, Ala, Gly, Phe, Ile, Lys, Ile, Cys, Ser, Val, His, Thr, Pro, Ser, 435, 440, 445Ser, Asn, Pro, Lys, Leu, Pro, Pro, Pro, Lys, Pro, Leu, Pro, Gly, Thr, Leu, Lys, 450, 455, 460Arg, Arg, Arg, Pro, Pro, Gln, Pro, Ile, Gln, Gln, Pro, Gln, Arg, Gln, Arg, Pro465, 470, 475, 480Arg, Glu, Ser, Tyr, Gln, Met, Gly, His, Met, Arg, Arg, 485, 490, (2) SEQ, ID, the information of NO:3:
(ⅰ) sequence signature:
(A) length: 2763 base pairs
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(ⅱ) molecule type: DNA (genome)
(ⅸ) feature:
(A) title/code: CDS
(B) position: 17..2414
(ⅹ ⅰ) SEQ, ID, the sequence description of NO:3:, GGCGGCGGCA, CGGAAG, ATG, GTG, TTG, CTG, AGA, GTG, TTA, ATT, CTG, CTC, CTC, 49, Met, Val, Leu, Leu, Arg, Val, Leu, Ile, Leu, Leu, Leu, 495, 500, TCC, TGG, GCG, GCG, GGG, ATG, GGA, GGT, CAG, TAT, GGG, AAT, CCT, TTA, AAT, AAA, 97, Ser, Trp, Ala, Ala, Gly, Met, Gly, Gly, Gln, Tyr, Gly, Asn, Pro, Leu, Asn, Lys, 505, 510, 515, TAT, ATC, AGA, CAT, TAT, GAA, GGA, TTA, TCT, TAC, AAT, GTG, GAT, TCA, TTA, CAC, 145, Tyr, Ile, Arg, His, Tyr, Glu, Gly, Leu, Ser, Tyr, Asn, Val, Asp, Ser, Leu, His, 520, 525, 530, 535, CAA, AAA, CAC, CAG, CGT, GCC, AAA, AGA, GCA, GTT, TTA, CAT, GAA, GAC, CAA, TTT, 193, Gln, Lys, His, Gln, Arg, Ala, Lys, Arg, Ala, Val, Ser, His, Glu, Asp, Gln, Phe, 540, 545, 550, TTA, CGT, CTA, GAT, TTC, CAT, GCC, CAT, GGA, AGA, CAT, TTC, AAC, CTA, CGA, ATG, 241, Leu, Arg, Leu, Asp, Phe, His, Ala, His, Gly, Arg, His, Phe, Asn, Leu, Arg, Met, 555, 560, 565, AAG, AGG, GAC, ACT, TCC, CTT, TTC, AGT, GAT, GAA, TTT, AAA, GTA, GAA, ACA, TCA, 289, Lys, Arg, Asp, Thr, Ser, Leu, Phe, Ser, Asp, Glu, Phe, Lys, Val, Glu, Thr, Ser, 570, 575, 580, AAT, AAA, GTA, CTT, GAT, TAT, GAT, ACC, TCT, CAT, ATT, TAC, ACT, GGA, CAT, ATT, 337, Asn, Lys, Val, Leu, Asp, Tyr, Asp, Thr, Ser, His, Ile, Tyr, Thr, Gly, His, Ile, 585, 590, 595, TAT, GGT, GAA, GAA, GGA, AGT, TTT, AGC, CAT, GGG, TCT, GTT, ATT, GAT, GGA, AGA, 385, Tyr, Gly, Glu, Glu, Gly, Ser, Phe, Ser, His, Gly, Ser, Val, Ile, Asp, Gly, Arg, 600, 605, 610, 615, TTT, GAA, GGA, TTC, ATC, CAG, ACT, CGT, GGT, GGC, ACA, TTT, TAT, GTT, GAG, CCA, 433, Phe, Glu, G1y, Phe, Ile, Gln, Thr, Arg, Gly, Gly, Thr, Phe, Tyr, Val, Glu, Pro, 620, 625, 630, GCA, GAG, AGA, TAT, ATT, AAA, GAC, CGA, ACT, CTG, CCA, TTT, CAC, TCT, GTC, ATT, 481, Ala, Glu, Arg, Tyr, Ile, Lys, Asp, Arg, Thr, Leu, Pro, Phe, His, Ser, Val, Ile, 635, 640, 645, TAT, CAT, GAA, GAT, GAT, ATT, AGT, GAA, AGG, CTT, AAA, CTG, AGG, CTT, AGA, AAA, 529, Tyr, His, Glu, Asp, Asp, Ile, Ser, Glu, Arg, Leu, Lys, Leu, Arg, Leu, Arg, Lys, 650, 655, 660, CTT, ATG, TCA, CTT, GAG, TTG, TGG, ACC, TCC, TGT, TGT, TTA, CCC, TGT, GCT, CTT, 577, Leu, Met, Ser, Leu, Glu, Leu, Trp, Thr, Ser, Cys, Cys, Leu, Pro, Cys, Ala, Leu, 665, 670, 675, CTG, CTT, CAC, TCA, TGG, AAG, AAA, GCT, GTA, AAT, TTT, CAC, TGC, CTT, TAC, TTC, 625, Leu, Leu, His, Ser, Trp, Lys, Lys, Ala, Val, Asn, Ser, His, Cys, Leu, Tyr, Phe, 680, 685, 690, 695
Figure 9880277400331
Figure 9880277400341
Ser Gln Val Leu Glu Lys Lys Arg Asn Asn Cys Phe Val Glu Ser Gly     985                 990                 995 CAA CCT ATT TGT GGA AAT GGA ATG GTA GAA CAA GGT GAA GAA TGT GAT       1585 Gln Pro Ile Cys Gly Asn Gly Met Val Glu Gln Gly Glu Glu Cys Asp 1000                1005                1010               1015 TGT GGC TAT AGT GAC CAG TGT AAA GAT GAA TGC TGC TTC GAT GCA AAT       1633 Cys Gly Tyr Set Asp Gln Cys Lys Asp Glu Cys Cys Phe Asp Ala Asn                 1020                1025                1030 CAA CCA GAG GGA AGA AAA TGC AAA CTG AAA CCT GGG AAA CAG TGC AGT       1681 Gln Pro Glu Gly Arg Lys Cys Lys Leu Lys Pro Gly Lys Gln Cys Ser             1035                1040                1045 CCA AGT CAA GGT CCT TGT TGT ACA GCA CAG TGT GCA TTC AAG TCA AAG       1729 Pro Ser Gln Gly Pro Cys Cys Thr Ala Gln Cys Ala Phe Lys Ser Lys         1050                1055                1060 TCT GAG AAG TGT CGG GAT GAT TCA GAC TGT GCA AGG GAA GGA ATA TGT       1777 Ser Glu Lys Cys Arg Asp Asp Ser Asp Cys Ala Arg Glu Gly Ile Cys     1065                1070                1075 AAT GGC TTC ACA GCT CTC TGC CCA GCA TCT GAC CCT AAA CCA AAC TTC       1825 Asn Gly Phe Thr Ala Leu Cys Pro Ala Ser Asp Pro Lys Pro Asn Phe 1080                1085                1090               1095 ACA GAC TGT AAT AGG CAT ACA CAA GTG TGC ATT AAT GGG CAA TGT GCA       1873 Thr Asp Cys Asn Arg His Thr Gln Val Cys Ilc Asn Gly Gln Cys Ala                 1100                1105                1110 GGT TCT ATC TGT GAG AAA TAT GGC TTA GAG GAG TGT ACG TGT GCC AGT       1921 Gly Ser Ile Cys Glu Lys Tyr Gly Leu Glu Glu Cys Thr Cys Ala Ser             1115                1120                1125 TCT GAT GGC AAA GAT GAT AAA GAA TTA TGC CAT GTA TGC TGT ATG AAG       1969 Ser Asp Gly Lys Asp Asp Lys Glu Leu Cys His Val Cys Cys Met Lys
Figure 9880277400361
Figure 9880277400371
Figure 9880277400372
Figure 9880277400373
435, 440, 445, Glu, Cys, Thr, Pro, Gly, Glu, Ser, Lys, Asn, Leu, Gly, Gln, Lys, Glu, Asn, Gly, 450, 455, 460, Asn, Tyr, Ile, Met, Tyr, Ala, Arg, Ala, Thr, Ser, Gly, Asp, Lys, Leu, Asn, Asn, 465, 470, 475, 480, Ash, Lys, Phe, Ser, Leu, Cys, Ser, Ile, Arg, Asn, Ile, Ser, Gln, Val, Leu, Glu, 485, 490, 495, Lys, Lys, Arg, Asn, Asn, Cys, Phe, Val, Glu, Ser, Gly, Gln, Pro, Ile, Cys, Gly, 500, 505, 510, ASh, Gly, Met, Val, Glu, Gln, Gly, Glu, Glu, Cys, Asp, Cys, Gly, Tyr, Ser, Asp, 515, 520, 525, Gln, Cys, Lys, Asp, Glu, Cys, Cys, Phe, Asp, Ala, Asn, Gln, Pro, Glu, Gly, Arg, 530, 535, 540, Lys, Cys, Lys, Leu, Lys, Pro, Gly, Lys, Gln, Cys, Ser, Pro, Ser, Gln, Gly, Pro, 545, 550, 555, 560, Cys, Cys, Thr, Ala, Gln, Cys, Ala, Phc, Lys, Ser, Lys, Ser, Glu, Lys, Cys, Arg, 565, 570, 575, Asp, Asp, Ser, Asp, Cys, Ala, Arg, Glu, Gly, Ile, Cys, Asn, Gly, Phe, Thr, Ala, 580, 585, 590, Leu, Cys, Pro, Ala, Ser, Asp, Pro, Lys, Pro, Asn, Phe, Thr, Asp, Cys, Asn, Arg, 595, 600, 605, His, Thr, Gln, Val, Cys, Ile, Asn, Gly, Gln, Cys, Ala, Gly, Ser, Ile, Cys, Glu, 610, 615, 620, Lys, Tyr, Gly, Leu, Glu, Glu, Cys, Thr, Cys, Ala, Ser, Ser, Asp, Gly, Lys, Asp, 625, 630, 635, 640, Asp, Lys, Glu, Leu, Cys, His, Val, Cys, Cys, Met, Lys, Lys, Met, Asp, Pro, Ser, 645, 650, 655, Thr, Cys, Ala, Ser, Thr, Gly, Ser, Val, Gln, Trp, Ser, Arg, His, Phe, Ser, Gly, 660, 665, 670, Arg, Thr, Ile, Thr, Leu, Gln, Pro, Gly, Ser, Pro, Cys, Ash, Asp, Phe, Arg, Gly, 675, 680, 685, Tyr, Cys, Asp, Val, Phe, Met, Arg, Cys, Arg, Leu, Val, Asp, Ala, Asp, Gly, Pro, 690, 695, 700, Leu, Ala, Arg, Leu, Lys, Lys, Ala, Ile, Phe, Ser, Pro, Glu, Leu, Tyr, Glu, Asn, 705, 710, 715, 720, Ile, Ala, Glu, Trp, Ile, Val, Ala, His, Trp, Trp, Ala, Val, Leu, Leu, Met, Gly, 725, 730, 735, Ile, Ala, Leu, Ile, Met, Leu, Met, Ala, Gly, Phe, Ile, Lys, Ile, Cys, Ser, Val, 740, 745, 750, His, Thr, Pro, Ser, Ser, Asn, Pro, Lys, Leu, Pro, Pro, Pro, Lys, Pro, Leu, Pro, 755, 760, 765, Gly, Thr, Leu, Lys, Arg, Arg, Arg, Pro, Pro, Gln, Pro, Ile, Gln, Gln, Pro, Gln, 770, 775, 780, Arg, Gln, Arg, Pro, Arg, Glu, Ser, Tyr, Gln, Met, Gly, His, Met, Arg, Arg, 785, 790, 795, (2) SEQ, ID, the information of NO:5:
(ⅰ) sequence signature:
(A) length: 239 base pairs
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: not clear
(ⅱ) molecule type: DNA (genome)
(ⅳ) antisense: be
The sequence description of (ⅹ ⅰ) SEQ ID NO:5: (2) information of SEQ ID NO:6:
(ⅰ) sequence signature:
(A) length: 239 base pairs
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(ⅱ) molecule type: DNA (genome)
The sequence description of (ⅹ ⅰ) SEQ ID NO:6: (2) information of SEQ ID NO:7:
(ⅰ) sequence signature:
(A) length: 736 base pairs
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(ⅱ) molecule type: DNA (genome)
The sequence description of (ⅹ ⅰ) SEQ ID NO:7: The information of AATGTACATA CCTTGTTATA TGCAGACATG TATTTCTTAC GTACACTGTA CTTCTGTGTG 600CAATTGTAAA CAGAAATTGC AATATGGATG TTTCTTTGTA TTATAAAATT TTTCCGCTCT 660TAATTAAAAA TTACTGTTTA ATTGACATAC TCAGGATAAC AGAGAATGGT GGTATTCAGT 720GGTTCAGACA CAGGCT 736 (2) SEQ ID NO:8:
(ⅰ) sequence signature:
(A) length: 2625 base pairs
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(ⅱ) molecule type: DNA (genome)
(ⅹ ⅰ) feature:
(A) title/code: CDS
(B) position: 17..2263
(ⅹ ⅰ) SEQ, ID, the sequence description of NO:8: GGCGGCGGCA, CGGAAG, ATG, GTG, TTG, CTG, AGA, GTG, TTA, ATT, CTG, CTC, CTC, 49, Met, Val, Leu, Leu, Arg, Val, Leu, Ile, Leu, Leu, Leu, 800, 905, 810TCC, TGG, GCG, GCG, GGG, ATG, GGA, GGT, CAG, TAT, GGG, AAT, CCT, TTA, AAT, AAA, 97Ser, Trp, Ala, Ala, Gly, Met, Gly, Gly, Gln, Tyr, Gly, Asn, Pro, Leu, Asn, Lys, 815, 820, 825TAT, ATC, AGA, CAT, TAT, GAA, GGA, TTA, TCT, TAT, AAT, GTG, GAT, TCA, TTA, CAC, 145Tyr, Ile, Arg, His, Tyr, Glu, Gly, Leu, Ser, Tyr, Asn, Val, Asp, Ser, Leu, His, 830, 835, 840CAA, AAA, CAC, CAG, CGT, GCC, AAA, AGA, GCA, GTC, TCA, CAT, GAA, GAC, CAA, TTT, 193Gln, Lys, His, Gln, Arg, Ala, Lys, Arg, Ala, Val, Ser, His, Glu, Asp, Gln, Phe, 845, 850, 855TTA, CGT, CTA, GAT, TTC, CAT, GCC, CAT, GGA, AGA, CAT, TTC, AAC, CTA, CGA, ATG, 241Leu, Arg, Leu, Asp, Phe, His, Ala, His, Gly, Arg, His, Phe, Ash, Lau, Arg, Met, 860, 865, 870AAG, AGG, GAC, ACT, TCC, CTT, TTC, AGT, GAT, GAA, TTT, AAA, GTA, GAA, ACA, TCA, 289Lys, Arg, Asp, Thr, Ser, Leu, Phc, Ser, Asp, Glu, Phe, Lys, Val, Glu, Thr, Ser875, 880, 885, 890AAT, AAA, GTA, CTT, GAT, TAT, GAT, ACC, TCT, CAT, ATT, TAC, ACT, GGA, CAT, ATT, 337Asn, Lys, Val, Leu, Asp, Tyr, Asp, Thr, Ser, His, Ile, Tyr, Thr, Gly, His, Ile, 895, 900, 905TAT, GGT, GAA, GAA, GGA, AGT, TTT, AGC, CAT, GGG, TCT, GTT, ATT, GAT, GGA, AGA, 385Tyr, Gly, Glu, Glu, Gly, Ser, Phe, Ser, His, Gly, Set, Val, Ile, Asp, Gly, Arg, 910, 915, 920TTT, GAA, GGA, TTC, ATC, CAG, ACT, CGT, GGT, GGC, ACA, TTT, TAT, GTT, GAG, CCA, 433Phe, Glu, Gly, Phe, Ile, Gln, Thr, Arg, Gly, Gly, Thr, Phc, Tyr, Val, Glu, Pro, 925, 930, 935GCA, GAG, AGA, TAT, ATT, AAA, GAC, CGA, ACT, CTG, CCA, TTT, CAC, TCT, GTC, ATT, 481Ala, Glu, Arg, Tyr, Ile, Lys, Asp, Arg, Thr, Leu, Pro, Phe, His, Ser, Val, Ile, 940, 945, 950TAT, CAT, GAA, GAT, GAT, ATT, AAC, TAT, CCC, CAT, AAA, TAC, GGT, CCT, CAG, GGC, 529Tyr, His, Glu, Asp, Asp, Ile, Asn, Tyr, Pro, His, Lys, Tyr, Gly, Pro, Gln, Gly955, 960, 965, 970GGC, TST, GCA, GAT, CAT, TCA, GTA, TTT, GAA, AGA, ATG, AGG, AAA, TAC, CAG, ATG, 577Gly, Cys, Ala, Asp, His, Ser, Val, Phe, Glu, Arg, Met, Arg, Lys, Tyr, Gln, Met, 975, 980, 985
Figure 9880277400461
Figure 9880277400471
Figure 9880277400491
The information of CTGAAAATTC CAATTTGGGG GTGGGAGGTG GAAAAGGAAC CCAATTTTCT TATGAACAGA 2493TATTTTTAAC TTAATGGCAC AAAGTCTTAG AATATTATTA TGTGCCCCGT GTTCCCTGTT 2553CTTCGTTGCT GCATTTTCTT CACTTGCAGG CAAACTTGGC TCTCAATAAA CTTTTACCAC 2613AAAAAAAAAA AA 2625 (2) SEQ ID NO:9:
(ⅰ) sequence signature:
(A) length: 749 amino acid
(B) type: amino acid
(D) topological framework: linearity
(ⅱ) molecule type: protein
24 according to a nucleic acid molecule according to claim 13, selected from: GCTAACTGCTCTATAATGATCGATGAAATTATACATCACTTAAAGAGACC ACCTGCACCTTTGCTGGACCCGAACAACCTCAATGACGAAGACGTCTCTA TCCTGATGGACCGAAACCTTCGACTTCCAAACCTGGAGAGCTTCGTAAGG GCTGTCAAGAACTTAGAAAATGCATCAGGTATTGAGGCAATTCTTCGTAA TCTCCAACCATGTCTGCCCTCTGCCACGGCCGCACCCTCTCGACATCCAA TCATCATCAAGGCAGGTGACTGGCAAGAATTCCGGGAAAAACTGACGTTC TATCTGGTTACCCTTGAGCAAGCGCAGGAACAACAGTACGTAGAGGGCGG TGGAGGCTCCCCGGGTGAACCGTCTGGTCCAATCTCTACTATCAACCCGT CTCCTCCGTCTAAAGAATCTCATAAATCTCCAAACATGGCCGACGAGGAG CTCTGCGGGGGCCTCTGGCGGCTGGTCCTGGCACAGCGCTGGATGGAGCG GCTCAAGACTGTCGCTGGGTCCAAGATGCAAGGCTTGCTGGAGCGCGTGA ACACGGAGATACACTTTGTCACCAAATGTGCCTTTCAGCCCCCCCCCAGC TGTCTTCGCTTCGTCCAGACCAACATCTCCCGCCTCCTGCAGGAGACCTC CGAGCAGCTGGTGGCGCTGAAGCCCTGGATCACTCGCCAGAACTTCTCCC GGTGCCTGGAGCTGCAGTGTCAGCCCGACTCCTCAACCCTGTCAGGCGGT AACGGCAGTGGAGGTAATGGCACCCAGGACTGCTCCTTCCAACACAGCCC CATCTCCTCCGACTTCGCTGTCAAAATCCGTGAGCTGTCTGACTACCTGC TTCAAGATTACCCAGTCACCGTGGCCTCCAACCTGCAG SEQ ID NO: 121; GCTAACTGCTCTATAATGATCGATGAAATTATACATCACTTAAAGAGACC ACCTGCACCTTTGCTGGACCCGAACAACCTCAATGACGAAGACGTCTCTA TCCTGATGGACCGAAACCTTCGACTTCCAAACCTGGAGAGCTTCGTAAGG GCTGTCAAGAACTTAGAAAATGCATCAGGTATTGAGGCAATTCTTCGTAA TCTCCAACCATGTCTGCCCTCTGCCACGGCCGCACCCTCTCGACATCCAA TCATCATCAAGGCAGGTGACTGGCAAGAATTCCGGGAAAAACTGACGTTC TATCTGGTTACCCTTGAGCAAGCGCAGGAACAACAGTACGTAGAGGGCGG TGGAGGCTCCCCGGGTGAACCGTCTGGTCCAATCTCTACTATCAACCCGT CTCCTCCGTCTAAAGAATCTCATAAATCTCCAAACATGGCCGACGAGGAG CTCTGCGGGGGCCTCTGGCGGCTGGTCCTGGCACAGCGCTGGATGGAGCG GCTCAAGACTGTCGCTGGGTCCAAGATGCAAGGCTTGCTGGAGCGCGTGA ACACGGAGATACACTTTGTCACCAAATGTGCCTTTCAGCCCCCCCCCAGC TGTCTTCGCTTCGTCCAGACCAACATCTCCCGCCTCCTGCAGGAGACCTC CGAGCAGCTGGTGGCGCTGAAGCCCTGGATCACTCGCCAGAACTTCTCCC GGTGCCTGGAGCTGCAGTGTCAGCCCGACTCCTCAACCCTGTCTGGAGGT AACGGATCCGGTGGCAATGGGAGCGGCGGAAATGGAACCCAGGACTGCTC CTTCCAACACAGCCCCATCTCCTCCGACTTCGCTGTCAAAATCCGTGAGC TGTCTGACTACCTGCTTCAAGATTACCCAGTCACCGTGGCCTCCAACCTG CAG SEQ ID NO: 122; GCTAACTGCTCTATAATGATCGATGAAATTATACATCACTTAAAGAGACC ACCTGCACCTTTGCTGGACCCGAACAACCTCAATGACGAAGACGTCTCTA TCCTGATGGACCGAAACCTTCGACTTCCAAACCTGGAGAGCTTCGTAAGG GCTGTCAAGAACTTAGAAAATGCATCAGGTATTGAGGCAATTCTTCGTAA TCTCCAACCATGTCTGCCCTCTGCCACGGCCGCACCCTCTCGACATCCAA TCATCATCAAGGCAGGTGACTGGCAAGAATTCCGGGAAAAACTGACGTTC TATCTGGTTACCCTTGAGCAAGCGCAGGAACAACAGTACGTAGAGGGCGG TGGAGGCTCCCCGGGTGAACCGTCTGGTCCAATCTCTACTATCAACCCGT CTCCTCCGTCTAAAGAATCTCATAAATCTCCAAACATGGCCTCCAAGATG CAAGGCTTGCTGGAGCGCGTGAACACGGAGATACACTTTGTCACCAAATG TGCCTTTCAGCCCCCCCCCAGCTGTCTTCGCTTCGTCCAGACCAACATCT CCCGCCTCCTGCAGGAGACCTCCGAGCAGCTGGTGGCGCTGAAGCCCTGG ATCACTCGCCAGAACTTCTCCCGGTGCCTGGAGCTGCAGTGTCAGCCCGA CTCCTCAACCCTGTCTGGCGGCAACGGCACGCAGGACTGCTCCTTCCAAC ACAGCCCCATCTCCTCCGACTTCGCTGTCAAAATCCGTGAGCTGTCTGAC TACCTGCTTCAAGATTACCCAGTCACCGTGGCCTCCAACCTGCAGGACGA GGAGCTCTGCGGGGGCCTCTGGCGGCTGGTCCTGGCACAGCGCTGGATGG AGCGGCTCAAGACTGTCGCTGGG SEQ ID NO: 123; GCTAACTGCTCTATAATGATCGATGAAATTATACATCACTTAAAGAGACC ACCTGCACCTTTGCTGGACCCGAACAACCTCAATGACGAAGACGTCTCTA TCCTGATGGACCGAAACCTTCGACTTCCAAACCTGGAGAGCTTCGTAAGG GCTGTCAAGAACTTAGAAAATGCATCAGGTATTGAGGCAATTCTTCGTAA TCTCCAACCATGTCTGCCCTCTGCCACGGCCGCACCCTCTCGACATCCAA TCATCATCAAGGCAGGTGACTGGCAAGAATTCCGGGAAAAACTGACGTTC TATCTGGTTACCCTTGAGCAAGCGCAGGAACAACAGTACGTAGAGGGCGG TGGAGGCTCCCCGGGTGAACCGTCTGGTCCAATCTCTACTATCAACCCGT CTCCTCCGTCTAAAGAATCTCATAAATCTCCAAACATGGCCTCCAAGATG CAAGGCTTGCTGGAGCGCGTGAACACGGAGATACACTTTGTCACCAAATG TGCCTTTCAGCCCCCCCCCAGCTGTCTTCGCTTCGTCCAGACCAACATCT CCCGCCTCCTGCAGGAGACCTCCGAGCAGCTGGTGGCGCTGAAGCCCTGG ATCACTCGCCAGAACTTCTCCCGGTGCCTGGAGCTGCAGTGTCAGCCCGA CTCCTCAACCCTGTCTGGAGGTAACGGATCCGGAGGTAATGGCACCCAGG ACTGCTCCTTCCAACACAGCCCCATCTCCTCCGACTTCGCTGTCAAAATC CGTGAGCTGTCTGACTACCTGCTTCAAGATTACCCAGTCACCGTGGCCTC CAACCTGCAGGACGAGGAGCTCTGCGGGGGCCTCTGGCGGCTGGTCCTGG CACAGCGCTGGATGGAGCGGCTCAAGACTGTCGCTGGG SEQ ID NO: 124; GCTAACTGCTCTATAATGATCGATGAAATTATACATCACTTAAAGAGACC ACCTGCACCTTTGCTGGACCCGAACAACCTCAATGACGAAGACGTCTCTA TCCTGATGGACCGAAACCTTCGACTTCCAAACCTGGAGAGCTTCGTAAGG GCTGTCAAGAACTTAGAAAATGCATCAGGTATTGAGGCAATTCTTCGTAA TCTCCAACCATGTCTGCCCTCTGCCACGGCCGCACCCTCTCGACATCCAA TCATCATCAAGGCAGGTGACTGGCAAGAATTCCGGGAAAAACTGACGTTC TATCTGGTTACCCTTGAGCAAGCGCAGGAACAACAGTACGTAGAGGGCGG TGGAGGCTCCCCGGGTGAACCGTCTGGTCCAATCTCTACTATCAACCCGT CTCCTCCGTCTAAAGAATCTCATAAATCTCCAAACATGGCCTCCAAGATG CAAGGCTTGCTGGAGCGCGTGAACACGGAGATACACTTTGTCACCAAATG TGCCTTTCAGCCCCCCCCCAGCTGTCTTCGCTTCGTCCAGACCAACATCT CCCGCCTCCTGCAGGAGACCTCCGAGCAGCTGGTGGCGCTGAAGCCCTGG ATCACTCGCCAGAACTTCTCCCGGTGCCTGGAGCTGCAGTGTCAGCCCGA CTCCTCAACCCTGTCTGGAGGTAACGGATCCGGTGGCAATGGGAGCGGCG GAAATGGAACCCAGGACTGCTCCTTCCAACACAGCCCCATCTCCTCCGAC TTCGCTGTCAAAATCCGTGAGCTGTCTGACTACCTGCTTCAAGATTACCC AGTCACCGTGGCCTCCAACCTGCAGGACGAGGAGCTCTGCGGGGGCCTCT GGCGGCTGGTCCTGGCACAGCGCTGGATGGAGCGGCTCAAGACTGTCGCT GGG SEQ ID NO: 125; GCTAACTGCTCTATAATGATCGATGAAATTATACATCACTTAAAGAGACC ACCTGCACCTTTGCTGGACCCGAACAACCTCAATGACGAAGACGTCTCTA TCCTGATGGACCGAAACCTTCGACTTCCAAACCTGGAGAGCTTCGTAAGG GCTGTCAAGAACTTAGAAAATGCATCAGGTATTGAGGCAATTCTTCGTAA TCTCCAACCATGTCTGCCCTCTGCCACGGCCGCACCCTCTCGACATCCAA TCATCATCAAGGCAGGTGACTGGCAAGAATTCCGGGAAAAACTGACGTTC TATCTGGTTACCCTTGAGCAAGCGCAGGAACAACAGTACGTAGAGGGCGG TGGAGGCTCCCCGGGTGAACCGTCTGGTCCAATCTCTACTATCAACCCGT CTCCTCCGTCTAAAGAATCTCATAAATCTCCAAACATGGCCCCCCCCAGC TGTCTTCGCTTCGTCCAGACCAACATCTCCCGCCTCCTGCAGGAGACCTC CGAGCAGCTGGTGGCGCTGAAGCCCTGGATCACTCGCCAGAACTTCTCCC GGTGCCTGGAGCTGCAGTGTCAGGCCGACTCCTCAACCCTGTCTGGCGGC AACGGCACCCAGGACTGCTCCTTCCAACACAGCCCCATCTCCTCCGACTT CGCTGTCAAAATCCGTGAGCTGTCTGACTACCTGCTTGAAGATTACCCAG TCACCGTGGCCTCCAACCTGCAGGACGAGGAGCTCTGCGGGGGCCTCTGG CGGCTGGTCCTGGCACAGCGCTGGATGGAGCGGCTCAAGACTGTCGCTGG GTCCAAGATGCAAGGCTTGCTGGAGCGCGTGAACACGGAGATACACTTTG TCACCAAATGTGCCTTTCAGCCC SEQ ID NO: 126; GCTAACTGCTCTATAATGATCGATGAAATTATACATCACTTAAAGAGACC ACCTGCACCTTTGCTGGACCCGAACAACCTCAATGACGAAGACGTCTCTA TCCTGATGGACCGAAACCTTCGACTTCCAAACCTGGAGAGCTTCGTAAGG GCTGTCAAGAACTTAGAAAATGCATCAGGTATTGAGGCAATTCTTCGTAA TCTCCAACCATGTCTGCCCTCTGCCACGGCCGCACCCTCTCGACATCCAA TCATCATCAAGGCAGGTGACTGGCAAGAATTCCGGGAAAAACTGACGTTC TATCTGGTTACCCTTGAGCAAGCGCAGGAACAACAGTACGTAGAGGGCGG TGGAGGCTCCCCGGGTGAACCGTCTGGTCCAATCTCTACTATCAACCCGT CTCCTCCGTCTAAAGAATCTCATAAATCTCCAAACATGGCCCCCCCCAGC TGTCTTCGCTTCGTCCAGACCAACATCTCCCGCCTCCTGCAGGAGACCTC CGAGCAGCTGGTGGCGCTGAAGCCCTGGATCACTCGCCAGAACTTCTCCC GGTGCCTGGAGCTGCAGTGTCAGCCCGACTCCTCAACCCTGTCAGGCGGT AACGGCAGTGGAGGTAATGGCACCCAGGACTGCTCCTTCCAACACAGCCC CATCTCCTCCGACTTCGCTGTCAAAATCCGTGAGCTGTCTGACTACCTGC TTCAAGATTACCCAGTCACCGTGGCCTCCAACCTGCAGGACGAGGAGCTC TGCGGGGGCCTCTGGCGGCTGGTCCTGGCACAGCGCTGGATGGAGCGGCT CAAGACTGTCGCTGGGTCCAAGATGCAAGGCTTGCTGGAGCGCGTGAACA CGGAGATACACTTTGTCACCAAATGTGCCTTTCAGCCC SEQ ID NO: 127; GCTAACTGCTCTATAATGATCGATGAAATTATACATCACTTAAAGAGACC ACCTGCACCTTTGCTGGACCCGAACAACCTCAATGACGAAGACGTCTCTA TCCTGATGGACCGAAACCTTCGACTTCCAAACCTGGAGAGCTTCGTAAGG GCTGTCAAGAACTTAGAAAATGCATCAGGTATTGAGGCAATTCTTCGTAA TCTCCAACCATGTCTGCCCTCTGCCACGGCCGCACCCTCTCGACATCCAA TCATCATCAAGGCAGGTGACTGGCAAGAATTCCGGGAAAAACTGACGTTC TATCTGGTTACCCTTGAGCAAGCGCAGGAACAACAGTACGTAGAGGGCGG TGGAGGCTCCCCGGGTGAACCGTCTGGTCCAATCTCTACTATCAACCCGT CTCCTCCGTCTAAAGAATCTCATAAATCTCCAAACATGGCCCCCCCCAGC TGTCTTCGCTTCGTCCAGACCAACATCTCCCGCCTCCTGCAGGAGACCTC CGAGCAGCTGGTGGCGCTGAAGCCCTGGATCACTCGCCAGAACTTCTCCC GGTGCCTGGAGCTGCAGTGTCAGCCCGACTCCTCAACCCTGTCTGGAGGT AACGGCAGTGGTGGTAATGGGAGCGGCGGAAATGGAACCCAGGACTGCTC CTTCCAACACAGCCCCATCTCCTCCGACTTCGCTGTCAAAATCCGTGAGC TGTCTGACTACCTGCTTCAAGATTACCCAGTCACCGTGGCCTCCAACCTG CAGGACGAGGAGCTCTGCGGGGGCCTCTGGCGGCTGGTCCTGGCACAGCG CTGGATGGAGCGGCTCAAGACTGTCGCTGGGTCCAAGATGCAAGGCTTGC TGGAGCGCGTGAACACGGAGATACACTTTGTCACCAAATGTGCCTTTCAG CCC SEQ ID NO: 128; GCTGATGAAGAACTGTGTGGTGGTCTGTGGCGGCTGGTCCTGGCACAGCGCTGGATGGAGCGGCTCAAGACTGTCGCTGGGT CCAAGATGCAAGGCTTGCTGGAGCGCGTGAACACGGAGATACACTTTGTCACCAAATGTGCCTTTCAGCCCCCCCCCAGCTG TCTTCGCTTCGTCCAGACCAACATCTCCCGCCTCCTGCAGGAGACCTCCGAGCAGCTGGTGGCGCTGAAGCCCTGGATCACT CGCCAGAACTTCTCCCGGTGCCTGGAGCTGCAGTGTCAGCCCGACTCCTCAACCCTGGGCGGTGGGTCAGGAGGTGGGTCAG GAGGTGGATCCGGAGGTGGCTCAGGGGGAGGTAGTGGTACCCAGGACTGCTCCTTCCAACACAGCCCCATCTCCTCCGACTT CGCTGTCAAAATCCGTGAGCTGTCTGACTACCTGCTTCAAGATTACCCAGTCACCGTGGCCTCCAACCTGCAGTACGTAGAG GGCGGTGGAGGCTCCCCGGGTGGTGGTTCTGGCGGCGGCTCCAACATGGCTACACCATTGGGCCCTGCCAGCTCCCTGCCCC AGAGCTTCCTGCTCAAGTCTTTAGAGCAAGTGAGAAAGATCCAGGGCGATGGCGCAGCGCTCCAGGAGAAGCTGTGTGCCAC CTACAAGCTGTGCCACCCCGAGGAGCTGGTGCTGCTCGGACACTCTCTGGGCATCCCCTGGGCTCCCCTGAGCTCCTGCCCC AGCCAGGCCCTGCAGCTGGCAGGCTGCTTGAGCCAACTCCATAGCGGCCTTTTCCTCTACCAGGGGCTCCTGCAGGCCCTGG AAGGGATATCCCCCGAGTTGGGTCCCACCTTGGACACACTGCAGCTGGACGTCGCCGACTTTGCCACCACCATCTGGCAGCA GATGGAAGAACTGGGAATGGCCCCTGCCCTGCAGCCCACCCAGGGTGCCATGCCGGCCTTCGCCTCTGCTTTCCAGCGCCGG GCAGGAGGGGTCCTGGTTGCTAGCCATCTGCAGAGCTTCCTGGAGGTGTCGTACCGCGTTCTACGCCACCTTGCGCAGCCG SEQ ID NO: 282; GGCCACTCAGGACTGCTCTTTTCAACACAGCCCCATCTCCTCCGACTTCGCTGTCAAAATCCGTGAGCTGTCTGACTACCT GCTTCAAGATTACCCAGTCACCGTGGCCTCCAACCTGCAGGACGAGGAGCTCTGCGGGGGCCTCTGGCGGCTGGTCCTGGC ACAGCGCTGGATGGAGCGGCTCAAGACTGTCGCTGGGTCCAAGATGCAAGGCTTGCTGGAGCGCGTGAACACGGAGATACA CTTTGTCACCAAATGTGCCTTTCAGCCCCCCCCCAGCTGTCTTCGCTTCGTCCAGACCAACATCTCCCGCCTCCTGCAGGA GACCTCCGAGCAGCTGGTGGCGCTGAAGCCCTGGATCACTCGCCAGAACTTCTCCCGGTGCCTGGAGCTGCAGTGTCAGCC CGACTCCTCAACCCTGTACGTAGAGGGCGGTGGAGGCTCCCCGGGTGGTGGTTCTGGCGGCGGCTCCAACATGGCTACACC ATTGGGCCCTGCCAGCTCCCTGCCCCAGAGCTTCCTGCTCAAGTCTTTAGAGCAAGTGAGAAAGATCCAGGGCGATGGCGC AGCGCTCCAGGAGAAGCTGTGTGCCACCTACAAGCTGTGCCACCCCGAGGAGCTGGTGCTGCTCGGACACTCTCTGGGCAT CCCCTGGGCTCCCCTGAGCTCCTGCCCCAGCCAGGCCCTGCAGCTGGCAGGCTGCTTGAGCCAACTCCATAGCGGCCTTTT CCTCTACCAGGGGCTCCTGCAGGCCCTGGAAGGGATATCCCCCGAGTTGGGTCCCACCTTGGACACACTGCAGCTGGACGT CGCCGACTTTGCCACCACCATCTGGCAGCAGATGGAAGAACTGGGAATGGCCCCTGCCCTGCAGCCCACCCAGGGTGCCAT GCCGGCCTTCGCCTCTGCTTTCCAGCGCCGGGCAGGAGGGGTCCTGGTTGCTAGCCATCTGCAGAGCTTCCTGGAGGTGTC GTACCGCGTTCTACGCCACCTTGCGCAGCCG SEQ ID NO: 198; GCTACACCATTGGGCCCTGCCAGCTCCCTGCCCCAGAGCTTCCTGCTCAAGTCTTTAGAGCAAGTGAGAAAGATCCAGGGC GATGGCGCAGCGCTCCAGGAGAAGCTGTGTGCCACCTACAAGCTGTGCCACCCCGAGGAGCTGGTGCTGCTCGGACACTCT CTGGGCATCCCCTGGGCTCCCCTGAGCTCCTGCCCCAGCCAGGCCCTGCAGCTGGCAGGCTGCTTGAGCCAACTCCATAGC GGCCTTTTCCTCTACCAGGGGCTCCTGCAGGCCCTGGAAGGGATATCCCCCGAGTTGGGTCCCACCTTGGACACACTGCAG CTGGACGTCGCCGACTTTGCCACCACCATCTGGCAGCAGATGGAAGAACTGGGAATGGCCCCTGCCCTGCAGCCCACCCAG GGTGCCATGCCGGCCTTCGCCTCTGCTTTCCAGCGCCGGGCAGGAGGGGTCCTGGTTGCTAGCCATCTGCAGAGCTTCCTG GAGGTGTCGTACCGCGTTCTACGCCACCTTGCGCAGCCCTACGTAGAGGGCGGTGGAGGCTCCCCGGGTGAACCGTCTGGT CCAATCTCTACTATCAACCCGTCTCCTCCGTCTAAAGAATCTCATAAATCTCCAAACATGGCTGATGAAGAACTGTGTGGT GGTCTGTGGCGGCTGGTCCTGGCACAGCGCTGGATGGAGCGGCTCAAGACTGTCGCTGGGTCCAAGATGCAAGGCTTGCTG GAGCGCGTGAACACGGAGATACACTTTGTCACCAAATGTGCCTTTCAGCCCCCCCCCAGCTGTCTTCGCTTCGTCCAGACC AACATCTCCCGCCTCCTGCAGGAGACCTCCGAGCAGCTGGTGGCGCTGAAGCCCTGGATCACTCGCCAGAACTTCTCCCGG TGCCTGGAGCTGCAGTGTCAGCCCGACTCCTCAACCCTGGGCGGTGGGTCAGGAGGTGGGTCAGGAGGTGGATCCGGAGGT GGCTCAGGGGGAGGTAGTGGTACCCAGGACTGCTCCTTCCAACACAGCCCCATCTCCTCCGACTTCGCTGTCAAAATCCGT GAGCTGTCTGACTACCTGCTTCAAGATTACCCAGTCACCGTGGCCTCCAACCTGCAG SEQ ID NO: 244; GCTGATGAAGAACTGTGTGGTGGTCTGTGGCGGCTGGTCCTGGCACAGCGCTGGATGGAGCGGCTCAAGACTGTCGCTGGG TCCAAGATGCAAGGCTTGCTGGAGCGCGTGAACACGGAGATACACTTTGTCACCAAATGTGCCTTTCAGCCCCCCCCCAGC TGTCTTCGCTTCGTCCAGACCAACATCTCCCGCCTCCTGCAGGAGACCTCCGAGCAGCTGGTGGCGCTGAAGCCCTGGATC ACTCGCCAGAACTTCTCCCGGTGCCTGGAGCTGCAGTGTCAGCCCGACTCCTCAACCCTGGGCGGTGGGTCAGGAGGTGGG TCAGGAGGTGGATCCGGAGGTGGCTCAGGGGGAGGTAGTGGTACCCAGGACTGCTCCTTCCAACACAGCCCCATCTCCTCC GACTTCGCTGTCAAAATCCGTGAGCTGTCTGACTACCTGCTTCAAGATTACCCAGTCACCGTGGCCTCCAACCTGCAGTAC GTAGAGGGCGGTGGAGGCTCCCCGGGTGGTGGTTCTGGCGGCGGCTCCAACATGGCTACACCATTGGGCCCTGCCAGCTCC CTGCCCCAGAGCTTCCTGCTCAAGTCTTTAGAGCAAGTGAGAAAGATCCAGGGCGATGGCGCAGCGCTCCAGGAGAAGCTG TGTGCCACCTACAAGCTGTGCCACCCCGAGGAGCTGGTGCTGCTCGGACACTCTCTGGGCATCCCCTGGGCTCCCCTGAGC TCCTGCCCCAGCCAGGCCCTGCAGCTGGCAGGCTGCTTGAGCCAACTCCATAGCGGCCTTTTCCTCTACCAGGGGCTCCTG CAGGCCCTGGAAGGGATATCCCCCGAGTTGGGTCCCACCTTGGACACACTGCAGCTGGACGTCGCCGACTTTGCCACCACC ATCTGGCAGCAGATGGAAGAACTGGGAATGGCCCCTGCCCTGCAGCCCACCCAGGGTGCCATGCCGGCCTTCGCCTCTGCT TTCCAGCGCCGGGCAGGAGGGGTCCTGGTTGCTAGCCATCTGCAGAGCTTCCTGGAGGTGTCGTACCGCGTTCTACGCCAC CTTGCGCAGCCG SEQ ID NO: 282. ...
Figure 9880277400531
The information of 675 680 685Ile Met Leu Met Ala Gly Phe Ile Lys Ile Cys Ser Val His Thr Pro 690 695 700Ser Ser Asn Pro Lys Leu Pro Pro Pro Lys Pro Leu Pro Gly Thr Leu705 710 715 720Lys Arg Arg Arg Pro Pro Gln Pro Ile Gln Gln Pro Gln Arg Gln Arg 725 730 735Pro Arg Glu Ser Tyr Gln Met Gly His Met Arg Arg 740 745 (2) SEQ ID NO:10:
(ⅰ) sequence signature:
(A) length: 10 base pairs
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(ⅱ) molecule type: DNA (genome)
The sequence description of (ⅹ ⅰ) SEQ ID NO:10: the information of AGCCTGTGTC 10 (2) SEQ ID NO:11:
(ⅹ) sequence signature:
(A) length: 19 base pairs
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(ⅱ) molecule type: DNA (genome)
The sequence description of (ⅹ ⅰ) SEQ ID NO:11: AGCCTGTGTC TGAACCACT 19

Claims (10)

1. section of DNA fragment, it is coded in the sacroiliitis evolution by people's protein degradation SEQID NO:9 or its fragment of differential expression, and it can be used to screen the design and the screening of protein degradation antagonist, medicine.
2. people's protein degradation or its fragment, they have the described dna encoding of claim 1, and are pure substantially form.
3. screening can be in conjunction with the method for the compound of people's protein degradation, and described people's protein degradation comprises the described protein degradation of claim 1.
4. screening can be in conjunction with the test kit of the compound of people's protein degradation, and described people's protein degradation comprises protein degradation according to claim 1.
5. detect the test kit of osteoarthritis, it comprises antibody or its fragment of the described people's protein degradation of claim 2.
6. expression vector or plasmid, it comprises the described DNA of claim 1.
7. isolated nucleic acid molecule as claimed in claim 1, it comprises the sequence of describing among the SEQ ID NO:8.
8. nucleic acid molecule according to claim 1, it can be determined through primer extension assay, and described primer is selected from SEQ ID NO:10 and SEQ ID NO:11.
9. method according to claim 3, it comprises:
(A) chondrocyte culture that portion is subjected to il-1 stimulate contacts with candidate's metalloproteinase gene expression inhibitor;
(B) isolation of RNA from described contact sample, described RNA comprises the mRNA corresponding with metalloprotease gene;
(C) relatively contact the level of the mRNA of metalloprotease gene described in sample and the noncontact sample;
(D) reduction of described mRNA level explanation is an inhibitor.
10. method according to claim 3, it comprises:
(A) in the presence of candidate inhibitor, in the presence of the contrast inhibitor, do not have any inhibitor and exist down, cultivate the normal people's articular chondrocytes that stimulates with il-1, isolate culture supernatants;
(B) add substrate in each duplicate samples, described substrate can be measured metal proteinase activity;
(C) measure the metal proteinase activity level of each duplicate samples.
CN98802774A 1997-02-28 1998-02-25 Use of novel disintegrin metalloprotease, mutants, fragments and the like Pending CN1283232A (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
WOPCT/US97/03217 1997-02-28
PCT/US1997/003217 WO1997031931A1 (en) 1996-03-01 1997-02-28 A novel disintegrin metalloprotease and methods of use

Publications (1)

Publication Number Publication Date
CN1283232A true CN1283232A (en) 2001-02-07

Family

ID=34192608

Family Applications (1)

Application Number Title Priority Date Filing Date
CN98802774A Pending CN1283232A (en) 1997-02-28 1998-02-25 Use of novel disintegrin metalloprotease, mutants, fragments and the like

Country Status (1)

Country Link
CN (1) CN1283232A (en)

Similar Documents

Publication Publication Date Title
CN1105725C (en) Modulators functions of FAS/APOL receptors
CN1283232A (en) Use of novel disintegrin metalloprotease, mutants, fragments and the like
CN1277634A (en) New tissue-specific calpaines, their production and their use
CN1129666C (en) Human tissue inhibitor of metalloproteinase -4
CN1269408A (en) New human cytozoic retional binding protein and its code sequence
CN1277998A (en) Human nitrile hydrolytic enzyme protein and coding series thereof
WO1998037092A2 (en) Use of a novel disintegrin metalloprotease
CN1495258A (en) Human tissue inhibitor of metalloprotease-4
CN1278002A (en) Human RNA binding protein and coding series thereof
CN1270220A (en) Human protein related to VB12 and its coding sequence
CN1269416A (en) New human AIDS virus turnaround protein isomer protein and its code sequence
CN1264741A (en) Human adenosine-diphosphate ribosyglucose hydrolase protein and its coding sequence
CN1271009A (en) New human diacyl glyceropyrophosphate phosphatase protein and its code sequence
CN1267732A (en) Human methyl transferase protein and its code sequence
CN1271008A (en) New human salt-resisting protein subunit protein and its code sequence
CN1268569A (en) New human triglyceride lipase precursor protein and its coding sequence
CN1269417A (en) New human immunoglobulin isomer and its code sequence
CN1265425A (en) New human triphosphatase protein and its code sequence
CN1301867A (en) Methionine reductase of human thio-oxidizined peptide chain and its code sequence
CN1268566A (en) New human teratocarnogenesis related protein and its coding sequence
CN1268565A (en) New human ribosylation factor protein and its coding sequence
CN1285405A (en) Human RIP 110 protein and code sequence thereof
CN1269415A (en) New human thioredoxin related protein and its code sequence
CN1271010A (en) New human aromatic esterase protein and its code sequence
CN1268568A (en) New human mitochondrial solute carrier protein and its coding sequence

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C02 Deemed withdrawal of patent application after publication (patent law 2001)
WD01 Invention patent application deemed withdrawn after publication