CN1280623A - Method and compositions useful for activation of silent transgenes - Google Patents
Method and compositions useful for activation of silent transgenes Download PDFInfo
- Publication number
- CN1280623A CN1280623A CN 98811629 CN98811629A CN1280623A CN 1280623 A CN1280623 A CN 1280623A CN 98811629 CN98811629 CN 98811629 CN 98811629 A CN98811629 A CN 98811629A CN 1280623 A CN1280623 A CN 1280623A
- Authority
- CN
- China
- Prior art keywords
- plant
- dna
- gene
- heterozygosis
- transcription factor
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/93—Ligases (6)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8217—Gene switch
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6897—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids involving reporter genes operably linked to promoters
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Plant Pathology (AREA)
- Analytical Chemistry (AREA)
- Medicinal Chemistry (AREA)
- Immunology (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Compositions and method for inducing expression of a desired DNA sequence in a stable transformed plant expressing a hybrid transcription factor, comprising a fusion of the DNA-binding domain and a transcription activation domain, which is an effector of expression of the desired DNA sequences controlled by a synthetic promoter, said synthetic promoter preferably comprising concatemeric copies of the cis-acting site recognized by DNA-binding domain of the hybrid transcription factor, fused to a promoter.
Description
The present invention relates to material and using method thereof that the control of heredity sequence is expressed.More specifically, the present invention relates to induce the expression of the anti sense nucleotide sequence of special deactivation expression of target gene.
The basic problem of the prior art of deactivation genetic expression is to use constitutive promoter, start all the time the expression of the transgenosis of introducing (or gene fragment).Like this, accept the influence that the genetically modified transformant of introducing also is subjected to its expression immediately.Can suppress in the transgenosis of introducing under the situation of essential native gene expression, all transformants are killed after transforming very soon.Therefore, it is desirable derivable control being carried out in the expression that imports dna sequence dna.
Yet, in the complete stool plant, still fail to realize strictness that quiding gene is expressed and derivable control.This control can have multiple use, comprise application facet for example regulatory gene more be basic aspect, for example by knocking out new gene with control high yield to detect its function.
Many positive transcription regulaton factors are to constitute module (Ptashne, 1988 that activation domain that branch interacts constitutes by DNA in conjunction with the territory with the record changer of promotor place assembling; Swaffield etc., 1995).Warm said elements from different organic sphere has produced the various different heterozygosis factors that described target biology had specific DNA binding characteristic and transcriptional activation function.For example, in the transient expression experiment of tobacco protoplast, the transcription factor that derives from yeast GAL4 activating transcription factor demonstrates transcribe (Ma etc., 1988) that can activate by the reporter gene of the synthetic promoter control of the TATA element that contains a plurality of GAL4 DNA binding sites and vegetable cell identity promotor source.The function of heterozygosis activating transcription factor and incitant mutant is also studied by the aleurone layer that the high speed particle transmission is squeezed into corn seed with gene.When trans-activator gene and reporter gene all import by particulate, the GAL4 DNA that merge in the acid activatable territory of the corn adjusting PROTEIN C 1 relevant with hsv VP16 albumen or function demonstrates the expression (Goff etc., 1991) of the reporter gene that stimulates the GAL4 dependence in conjunction with the territory.When instantaneous importing tobacco protoplast, merge the chimeric transcription activator protein that the VP16 activation domain forms by the DNA of 434 phages in conjunction with the territory and show the reporter gene expression (Wilde etc., 1994) that can activate by the synthetic promoter startup of 35S minimal promoter that comprises fusion and 434 operons.The common proof of these researchs, the DNA of the allos factor can combine with the synthetic promoter that contains the appropriate combination site on the naked DNA template that imports vegetable cell in conjunction with the territory, and the non-plant activation domain can be effectively and the record changer configuration interaction of plant when covalently bound when combine the territory with DNA.
Be of value to the preliminary gene function of determining although analyze the transgenosis of instantaneous importing host cell, stable conversion will be the application system widely of research gene expression in plants.Yet a tree name report, GAL4 DNA is in conjunction with the very low (Reichel of territory expression efficiency in plant, C. etc., (1995) " GAL4 DNA is in conjunction with the low efficient expression (InefficientExpression of the DNA-Binding Domain of GAL4 inTransgenic Plants) in territory in transgenic plant " vegetable cell communication (Plant Cell Reports) 14 (12): 773-776).The ideal regulator control system of control transgene expression should have only very low when lacking the function transcription factor or not have background to express in plant, and high expression level is then arranged when having the function transcription factor.
Therefore, but needed be useful material and the method for abduction delivering that imports dna sequence dna in the stable conversion plant, providing.
The invention provides and be used for stable plant heterozygosis transcription factor and the synthetic promoter of importing, thereby satisfied the long-term pendent needs in this area with method, material of inducing activatable dna sequence such as genetically modified expression and the transgenic plant that contain allogeneic dna sequence.Importantly, invention described herein separates genetically modified insertion effectively with its activity, thereby allows to save the lethal transformant of this meeting, activates them afterwards again.The present invention can be applicable to study gene function, for example identifies plant-growth, growth and survival important function of gene.The feature of a particularly important of the present invention is the expression that can induce antisense dna sequence or dominance supressor in the stable conversion plant, if can destroy the adopted sequence that has that translating of gene function maybe can not translate, identify with forward plant normal growth is grown essential one or more genes.
The present invention includes heterozygosis transcription factor gene, synthetic promoter, activatable dna sequence and contain cell, tissue and the plant of these genes, promotor and dna sequence dna, and use the method for their plant identification gene functions.Select or design heterozygosis transcription factor gene and synthetic promoter, so that the DNA of heterozygosis transcription factor is in conjunction with the expression of territory energy specific combination synthetic promoter with the activatable dna sequence of activation synthetic promoter startup.
More specifically, the present invention includes and contain the first kind of cell or tissue that activates the necessary heterozygosis transcription factor of synthetic promoter encoding sequence, preferred plant cell or plant tissue or plant, with the second kind of cell or tissue that contains synthetic promoter, preferred plant cell or plant tissue or plant, wherein, can produce the cell, tissue or the plant that contain the described heterozygosis transcription factor of coding and the two sequence of synthetic promoter by operation first kind and second kind of cell, tissue or plant.Preferably, second kind of cell, tissue or plant contain the synthetic promoter of the activatable dna sequence that has been operably connected, and when the heterozygosis transcription factor activated promotor, synthetic promoter started the expression of activatable dna sequence.In another embodiment, design or selection heterozygosis transcription factor are so that can be controlled by independent factor such as oestrogenic hormon.
Method of the present invention comprises that first kind of merging and second kind of cell, tissue or plant contain the stable transgenic plant of heterozygosis transcription factor gene and synthetic promoter so that the expression of activatable dna sequence in plant with formation.One embodiment of the invention allow the transcription factor encoding gene of those skilled in the art by the destination gene expression of the special activation synthetic promoter control of sexual importing, activate this and are the expression of reticent goal gene (or gene fragment) as inverted defined gene.When goal gene can the deactivation native gene expression the time, plant and the sexual hybridization offspring between the effect plant of containing goal gene can not this native genes of normal expression.Normal growth or grow essential plant gene and can identify in this way.The evaluation of these genes provides and screened the useful target that effective herbicide is arranged from library of compounds.
Invention described herein proof heterozygosis transcription factor in stable conversion plant controlling gene that can play a role is effectively expressed.Describe first evidence below in detail, promptly the heterozygosis transcription factor can be in the complete stool plant activated gene function effectively, thereby the useful system of forward plant identification growth indispensable gene is provided.
The invention provides a kind of important novel method of research gene function in plant.The present invention to identify growth, grow or existence must or important plant endogenous dna sequence dna be useful especially.These dna sequence dnas be accredited as on safe, effective, the viable economically and environment of exploitation rationally effectively reasonably that product provides important information to solve important agricultural problem.In one embodiment, the present invention can be used for expressing to measure its function by knocking out native gene.Particularly, whether essential to growth and development of plant by determining goal gene, the present invention can be used for verifying possible herbicidal target gene.Early stage and important be connected that this just provides in screening and development chain, and provide the power arranging resource and instruct striving direction with evaluation with test compounds effective, thus immediate interest provided for the public.
Apply in order to provide invention comprehensive, clear, succinctly and accurately describe, term definition used herein is as follows.Activatable dna structure-refer to a kind of dna sequence dna or contain the recombination structure of this dna sequence dna and synthetic promoter, its transfered cell, preferably do not express during vegetable cell, be reticent, unless exist can in conjunction with and activate the complete heterozygosis transcription factor of synthetic promoter.Subsequently described activatable dna structure transfered cell, tissue or plant are formed the stable transgenic lines that can express this activatable dna sequence, hereinafter will do more fully to describe.Activatable dna sequence-the refer to dna sequence dna that regulatory gene is expressed in genome (preferably Plant Genome).Endogenous target DNA sequence complementation in activatable dna sequence and the genome.When activatable dna sequence transfered cell is also expressed therein, can suppress the expression of described target DNA.Useful activatable dna sequence comprises those codings or serves as the dna sequence dna of dominance supressor among the present invention, can not translate adopted sequence as in the stable conversion plant, destroying translating maybe of gene function, with one or more genes that it is essential that the forward plant identification grows.Preferred activatable dna sequence is an antisense dna sequence.The mechanism of action of antisense sequences it be unclear that, and supposition is sense-rna has suppressed the target DNA gene product in conjunction with target gene RNA expression.This RNA:RNA mixture of possibility has suppressed the combination or the function of body translation, also may be that this RNA:RNA mixture is degraded rapidly.May also have other mechanism.Described target gene is preferably compiled a kind of protein, as plant-growth or the essential biosynthetic enzyme of surviving, acceptor, signal transducer, structure gene product or translocator.The substance that the interaction of sense-rna sequence and target gene RNA causes the target DNA sequence to be expressed suppresses, to such an extent as to kill this plant or suppress normal plants growth or growth.Express-refer to plant endogenous gene or genetically modifiedly transcribe and/or translate.For example for antisense construct, expression can only refer to that antisense DNA transcribes.Gene-refer to encoding sequence and associated adjustment sequence, wherein encoding sequence be transcribed into RNA for example mRNA, rRNA, tRNA, snRNA, adopted RNA or sense-rna are arranged.Regulate example such as promoter sequence, 5 ' and 3 ' non-translated sequence and the terminator sequence of sequence.Other element that may exist is an intron etc.Goal gene-refer to when changing plant over to, give any gene of the desired characteristic of this plant, described characteristic is the quality that improves in the nutritive value of the resistance of for example antibiotics resistance, virus resistance, insect-resistant, disease resistance or other harmful organism, herbicide tolerant, improvement, the industrial processes or the fecundity of change." goal gene " also can be the gene that changes plant in order to produce enzyme that commercial value is arranged or metabolite in plant over to.Allogeneic dna sequence-refer to the dna sequence dna relevant with the host cell non-natural of its importing comprises the natural non-natural multiple copied that has dna sequence dna.Marker gene-refer to encode and to select maybe can screen the gene of proterties.If be operably connected/unite-position of modulability dna sequence dna and coding RNA or protein DNA sequence makes the modulability dna sequence dna influence the expression of DNA sequences encoding, and we just say that this modulability dna sequence dna " is operably connected " or " associating " this DNA sequences encoding.Minimal promoter-refer to do not have activity or the active promoter element, particularly TATA element that reduces greatly when existing in the activation of no upstream.When suitably transcription factor existed, minimal promoter can be brought into play function and cause and transcribe.Vegetable cell-refer to the comprise plant structure and the physiology unit of protoplastis and cell walls.The form of vegetable cell can be isolating individual cells or culturing cell, or as the part of plant tissue or plant organ for example of high-level organization unit more.Plant-refer to any plant, particularly spermatophyte.Any other parts or the product of part, fruit, pollen, pollen tube, ovule, blastular, ovum, zygote, embryo, seed, cutting, cell or tissue culture or the plant of the leaf of vegetable material-refer to plant, stem, root, flower or flower.The dna sequence dna that promotor-the startup associated dna sequence is transcribed.Promoter region also can comprise the element that serves as genetic expression regulon (regulator), as activates son, enhanser and/or repressor (repressor).The dna sequence dna molecule that recombinant DNA-refer to links together with recombinant DNA technology.Recombinant DNA technology-refer to is used for method that dna sequence dna is linked together, referring to for example Sambrook etc., 1989, cold spring port (Cold Spring Harbor), NY: press of cold spring harbor laboratory (Cold Spring Harbor Laboratory Press).Selected marker-refer to gives the gene of a kind of selectivity advantage of cell when expressing in vegetable cell.The selectivity advantage that cell had that has transformed the selected marker can be owing to compare with non-transformed cell, and they can be grown when negative selective agent such as microbiotic or sterilant exist.Compare with non-transformed cell, the selectivity advantage that transformant had also can be because they have the ability that compound such as nutritive substance, somatomedin or the energy are added in enhanced or new utilization.The selected marker gives the gene or the assortment of genes of this cell forward and two kinds of selectivity advantages of negative sense when also referring to express in vegetable cell.Stable conversion-refer to the contain cell of at least a allogeneic dna sequence, vegetable cell preferably, wherein said allogeneic dna sequence continues to exist in cell, brings into play function under the condition that is fit to its intended purpose, and can entail the offspring.Particularly, this term comprises allogeneic dna sequence no matter by initial those cells that import of which kind of method, and deutero-contains cell, tissue, plant or the seed of allogeneic dna sequence subsequently.The latter is also referred to as stable transgenic lines.Synthesize-refer to contain the nucleotide sequence of non-existent constitutional features in native sequences.For example, to be called be synthetic to the artificial sequence that distributes of similar dicotyledons and/or monocotyledons G+C content and normal codon.Transform-refer to the nucleic acid transfered cell.Be meant that especially the dna molecular stable integration is to the genome of purpose biology.
As hereinafter more fully describing, the present invention includes heterozygosis transcription factor gene, synthetic promoter, activatable dna sequence and contain cell, tissue and plant and the using method thereof of these genes, promotor and dna sequence dna.Select or design heterozygosis transcription factor gene and synthetic promoter in case the DNA of heterozygosis transcription factor in conjunction with the territory can the specific combination synthetic promoter to open the expression of the activatable dna sequence that starts by this synthetic promoter.
In one embodiment, the present invention is based on sexual hybridization and realize derivable gene activation, rely on and transcribe the activation of effect system in the reticent genetically modified expression that can activate under the synthetic promoter control.The proterties that available this system's control is expressed comprises the non-plant gene, be translating of encoding transcription controlling elements such as endogenesis promoter or post-transcriptional control element maybe can not translate Yi Jiyin is arranged and is used to knock out the inverted defined gene (AdSS as mentioned below) that native gene is expressed.In a scheme, such as hereinafter detailed description, contain coding heterozygosis transcription factor dna sequence dna transcribe effect system, with cell, tissue or department of botany's hybridization of the synthetic promoter that contains the activatable dna sequence that is operably connected.In another scheme, transcribe effect system and contain the dna sequence dna of encoding part heterozygosis transcription factor, encoded protein can form the heterozygosis transcription factor by the peptide-peptide interaction with this heterozygosis transcription factor bound fraction thereby make wherein.And the dna sequence dna of synthetic promoter, activatable dna sequence and the corresponding bound fraction of coding heterozygosis transcription factor is included in another strain that separates system.And in another scheme, the heterozygosis transcription factor is suppressed the agent deactivation, thereby stops it to activate synthetic promoter, for example blocks the heterozygosis transcription factor and combines with the functional of synthetic promoter.Therefore, have only the heterozygosis of removal transcription factor inhibitor, the activatable dna sequence just can be expressed.
Based on the disclosure, it will be understood by those skilled in the art that any target DNA sequence or gene can both control in this way.
Native system is expressed the transgenosis that starts with the possible proterties that can not save of other method such as composing type to allowing, and is useful especially.The foreign gene of potential lethal effect is for example arranged or is designed to eliminate the inverted defined gene of indispensable gene function or the sudden change of dominance negative sense, although in the fundamental research of plant biology highly significant, have the inherent experiment problem.Low transformation frequency often is cited as the evidence of the relevant lethality of specific transgenosis of composing type startup, but this class negative findings has been full of various insignificant explanations.This system described herein allows tested genetically modified stable existence to separate with its expression with propagation.This is crucial with expressing isolating ability for the reliable conclusion that obtains about gene function importance with the transgenosis insertion.Therefore, the present invention has substantial contribution to this area.
The phenotype that the changing conditions of phenotype degree of injury (severity of phenotype) can activate system by a plurality of independences that an inspection and a single incitant are hybridized obtains.Provide the ability to express of the various levels at different transgenosiss seat by relying on position effect, might obtain the phenocopy of the allelomorphic series of specific trait.The embodiment 2 that vide infra, embodiment 2 display design become to knock out the various different expression levels of the inverted defined gene of an essential metabolic gene, have produced the plant strain system with different phenotype degree of injury.Equally, also inactivation to some extent of other proterties in the independent strain system.
Optionally, the expression of specific trait can realize by further control has a heterozygosis activating factor gene of suitable promotor (as the promotor of being regulated) in time of growing or space expression.According to the preciseness of discussion promotor control, might estimate in specific cells, tissue or organ or in the function of specific developmental stage goal gene.For example, fetal development can be by testing with the known factor activator antisense transgene that the promotor of high expression level starts in the seed of growing to the demand of a certain gene function.This method is widely used in fruit bat (Drosophila), normally insert GAL4 effector structure at random to obtain and the fusions (Brand and Perrimon, 1993) that in dissimilar cells and tissue, instructs the range gene group enhanser of expressing.Equally, but dna structure of the present invention provides another kind of control to genetic expression by the promotor of using chemical induction, steroid inductive genetic expression (Proc.Natl.Acad.Sci. shown in Schena etc., USA, Vol.88, pp 10421-10425, December1991).
The further adjusting of expressing can realize by the activation domain of selecting to be fit to intensity for application-specific.Recently, with the functional Screening and Identification of yeast have a plant transcription activation domain (.1994 such as Estruch) of clean positive charge or negative charge.When these structural domains combined the territory and all import corn or tobacco cell by particulate with the DNA of GAL4, the two merged mutually and has produced the protein that can activate GAL4 dependency promoter gene.Like this, various different activation domain can screen by direct function or structure and identify.
Although work described herein is that to belong to (Arabidopsis) with Ah cloth be example, described trans-activation itself is not limited to these species.Adopt suitable promotor, system described herein can work in any species, they comprise commercially important plant, include but not limited to corn, paddy rice, wheat, beet, barley, rye, cotton, rape, oat, Chinese sorghum, grain, turfgrass and ornamental plant.The heterozygosis transcription factor gene
The heterozygosis transcription factor gene comprises coding 1) DNA is in conjunction with territory and 2) constitute the dna sequence dna that divides the activation domain that interacts with the record changer of promotor place assembling.Connect gene fragment, typically DNA in conjunction with the territory at 5 ' end and activation domain at 3 ' end, to form the heterozygous genes of expressing the heterozygosis transcription factor.Those skilled in the art can couple together various coding DNAs according to a conventional method in conjunction with the dna sequence dna in territory and the dna sequence dna of various coding activation domains, thereby form the heterozygosis transcription factor gene of multiple combination.
The example that can be used for producing the dna sequence dna of the useful heterozygosis transcription factor of the present invention GAL4, phage 434, lexA, lad and lambda particles phage aporepressor DNA the sequence that includes, but are not limited to encode in conjunction with the territory.
The example that can be used for producing the dna sequence dna of the useful heterozygosis transcription factor of the present invention includes, but are not limited to the acid activatable domain encoding sequence of herpes simplex VP16, corn C 1 and P1.In addition, can directly carry out method that function selects then and separate suitable activation domain (Estruch etc., 1994, incorporate this paper fully into) by merging in conjunction with the territory from selected organic dna fragmentation and suitable DNA in the reference mode.Between the transcription activating protein of different sources mutually the switching fabric territory (Brent and Ptashne (1985) cell (Cell), 43:729-736).
A kind of favourable heterozygosis transcription factor gene contains coding combines the territory with the GAL4DNA that corn C 1 activation domain merges dna sequence dna.Those skilled in the art can adopt conventional molecular biology and recombinant DNA technology to produce the transcription factor gene of expectation.Synthetic promoter
Synthetic promoter comprises at least one heterozygosis transcription factor DNA DNA binding site and minimal promoter in conjunction with territory identification, preferably from the TATA element of the promotor of vegetable cell identification.More specifically, the promotor discerned of the TATA element vegetable cell type that will change over to from synthetic promoter.Preferably the DNA binding site repeatedly repeats so that minimal promoter can more effectively be activated in synthetic promoter, and the activatable dna sequence that links to each other with synthetic promoter so just can obtain more effective expression.
The example that can be used for producing the DNA binding site of synthetic promoter of the present invention includes but not limited to upstream activating sequence (UASG), lac operon and the lexA binding site of the conjugated protein identification of GAL4 DNA.The example of the promotor TATA element of vegetable cell identification comprises those TATA elements from following promotor: hsp80 of CaMV 35S, corn Bz1 promotor, UBQ3 promotor, Agrobacterium (Agrobacterium) rouge alkali synthetase or mannopine synthase promoter such as SuperMAS, cooked food mustard (Brassica oleracea) and A Bu belong to Actin muscle-2 promotor.
A kind of favourable synthetic promoter comprises and has the TATA element CaMV 35S sequence of the brachymemma of (transcription initiation position-59 is to+48 Nucleotide relatively), and about 10 series aidings that its 5 ' end has merged the upstream activating sequence (UASG) that GAL4 discerns in conjunction with the territory repeat.Those skilled in the art can adopt conventional molecular biology and recombinant DNA technology to produce the synthetic promoter of expectation.The activatable dna sequence
The activatable dna sequence comprises any desired stable importing vegetable cell and the dna sequence dna of expressing.The special activatable dna sequence of expecting is that justice or antisense sequences are arranged, the reduction that its expression causes its corresponding native gene to be expressed, thus suppress normal growth of plant or growth.
The activatable dna sequence operationally is connected with synthetic promoter, forms the activatable dna structure.In transgenic lines, the activatable dna sequence in the activatable dna structure is not expressed, and promptly it is reticent, unless also exist simultaneously can in conjunction with and activate the heterozygosis transcription factor of synthetic promoter.With activatable dna structure transfered cell, tissue or plant, form the stable transgenic lines of expressing the activatable dna sequence subsequently, hereinafter will do more fully to describe.Contain the heterozygosis transcription factor, or cell, tissue or the plant of synthetic promoter and activatable dna sequence
The present invention also comprises first kind and the second kind of cell or tissue that contains heterozygosis transcription factor gene and activatable dna structure respectively, preferred plant cell or plant tissue, or plant.Select first kind of cell, tissue or plant and second kind of cell, tissue or plant so as by operate they can form contain the heterozygosis transcription factor gene and express the heterozygosis transcription factor, simultaneously also contain and the synthetic promoter that activates the activatable dna structure with vegetable cell, plant tissue or the plant of the activatable dna sequence expressing this promotor and start.
With above-mentioned heterozygosis transcription factor gene and activatable dna structure transfered cell, tissue or plant, can adopt ordinary method well known in the art, include but not limited to hybridize, agriculture bacillus mediated conversion, Ti-plasmids carrier, directly the DNA picked-up is as microparticle bombardment, liposome-mediated picked-up, microinjection etc.
For example, can adopt agriculture bacillus mediated conversion generation to contain the transgenic plant strain system of heterozygosis transcription factor gene.By instantaneous conversion reporter gene structure, screening can activate the elementary transformant (T1 for) of corresponding synthetic promoter (can by heterozygosis transcription factor activated synthetic promoter) guiding expression.Adopt conventional RNA gel engram analysis conclusive evidence transformant to express the heterozygosis transcription factor gene.The separation of the kalamycin resistance (or inserting other suitable selected marker that DNA carries) by single seat further detects the transgenosis character that strain is in T2 generation after selfing.The existence that single T-DNA inserts can confirm by carry out genomic dna gel engram analysis in performance isolating strain in 3: 1 is.Can adopt RNA gel blotting further to analyze the expression of heterozygosis transcription factor in these strain systems.Some T2 plant selfings are produced the T3 offspring, therefrom the homozygote of the heterozygosis transcription factor gene of screening insertion.
Adopt similar method to contain the transgenic lines of the heterozygosis transcription factor activated synthetic promoter that can be supposed to by agriculture bacillus mediated conversion preparation.The transgenic line of the selected marker that adopts the standard method preparation to contain synthetic promoter and activatable dna sequence (activatable dna structure) and can select to contain.Optionally, can utilize this label screening transgenic line to prove conclusively existing of activatable dna structure.The F1 plant that contains heterozygosis transcription factor and activatable dna structure
The F1 plant that contains heterozygosis trans-activating factor gene and activatable dna structure produces by allogamy and utilizes the existence of appropriate flags such as kantlex to screen.Compare with the plant that only contains the activatable dna structure, the F1 plant has produced high-caliber activatable dna sequence expression product, and it can be compared with the expression of using strong constitutive promoter such as CaMV 35S to obtain.
Useful analytical procedure of the present invention comprises
A) will contain first kind of stable conversion plant of heterozygosis transcription factor gene, the heterozygosis transcription factor of wherein said heterozygosis transcription factor gene coding can activate this synthetic promoter when synthetic promoter is present in this plant, and this plant is isozygotied for this heterozygosis transcription factor; With
B) contain the activatable dna sequence and can be hybridized by second kind of stable conversion plant of described heterozygosis transcription factor activated synthetic promoter, wherein dna sequence dna can obtain to express when the heterozygosis transcription factor exists, and described hybridization produces the F1 plant of expressing this dna sequence dna; With
C) expression effect of this dna sequence dna in the mensuration F1 plant.
Described method is preferred, and wherein the DNA of heterozygosis transcription factor gene coding yeast GAL4 gene source is in conjunction with the transcription activating domain of territory and corn C 1 gene source.
Described method is further preferred, and wherein minimal promoter is selected from the Bzl promotor and the UBQ3 promotor of CaMV 35S minimal promoter, corn.
Described method is preferred, and wherein the synthetic promoter sequence comprises the CaMV 35S minimal promoter that contains the TATA element, and it has merged 10 tandem copies of GAL4 DNA in conjunction with the upstream activating sequence of territory identification at 5 ' end.
Described method is preferred, wherein the DNA of heterozygosis transcription factor gene coding yeast GAL4 gene source is in conjunction with the transcription activating domain of territory and corn C 1 gene source, and wherein the activatable dna structure comprises the synthetic promoter sequence with CaMV 35S minimal promoter, and this CaMV 35S minimal promoter 5 ' end that contains the TATA element has merged GAL4 DNA 10 tandem copies of upstream activating sequence in conjunction with territory identification.
Another useful method of the present invention provides the method for the inhibitor of identifying essential plant gene such as plant AdSS gene, and it comprises,
A) when the suspicious inhibitor of plant AdSS enzyme function exists with AdSS enzyme and AdSS substrate reactions; With
Whether the AdSS enzyme reaction speed ratio when AdSS enzyme reaction speed and suspicious inhibitor do not exist when b) suspicious inhibitor being existed under the similarity condition has suppressed AdSS with definite this suspicious inhibitor.
A preferred embodiment of the present invention comprises the plant that contains heterozygosis transcription factor gene and activatable dna structure, wherein the heterozygosis transcription factor of heterozygosis transcription factor gene coding can activate the activatable dna structure synthetic promoter to induce the expression of the antisense dna sequence that can be operatively connected, wherein this plant stability has transformed heterozygosis transcription factor and activatable dna structure.
Preferred described plant, wherein the heterozygosis transcription factor gene comprises
From the DNA of the gene that is selected from yeast GAL4 gene, phage 434, lexA, lacI and lambda particles phage repressor in conjunction with the territory;
From the gene transcription activation domain that is selected from herpes simplex VP16, corn C 1 and P1;
The activatable dna structure comprises the minimal promoter that is selected from CaMV 35S minimal promoter, corn Bz1 promotor and UBQ3 promotor.
Described plant is further preferred, and wherein the synthetic promoter sequence comprises that 5 ' end has merged the CaMV 35S minimal promoter of GAL4DNA in conjunction with 10 tandem copies of the upstream activating sequence of territory identification, and this CaMV 35S minimal promoter contains the TATA element.
Described plant is further preferred, wherein the DNA of heterozygosis transcription factor gene coding yeast GAL4 gene source is in conjunction with the transcription activating domain of territory and corn C 1 gene source, and wherein the activatable dna structure comprises that containing 5 ' end has merged the synthetic promoter sequence of GAL4 DNA in conjunction with the CaMV 35S minimal promoter of 10 tandem copies of the upstream activating sequence of territory identification, and CaMV 35S minimal promoter contains the TATA element.
Described plant is further preferred, and wherein the activatable dna sequence is the AdSS antisense sequences.
Embodiment
The embodiment of following discloses explanation, the heterozygosis transcription factor controlling gene that can effectively work is expressed in the stable conversion plant.According to following indefiniteness embodiment, the present invention will be further described and further be understood by those skilled in the art.Embodiment 1-stablizes the expression of reticent reporter gene in the transgenic plant
Present embodiment is illustrated, and with expressing the transgenic plant strain system of the GAL4/C1 heterozygosis factor and the strain cross of the reporter gene that contains suitable synthetic promoter control, causes the induced strong to reporter gene expression.For this system of test in Ah cloth belongs to, make up suitable gene by following more fully the description.
From showing the GAL4 that has DNA combination and transcriptional activation function respectively and the composition of C1 gene, make up the heterozygosis transcription factor gene.(the structure pAT 53 that is used for Plant Transformation contains left margin sequence, 35S promoter successively, transcribes fragment, 35S 3 ' terminator sequence and pNOS/NPT/nos 3 ' selected marker box with the heterozygosis that GAL4 DNA combines territory and C1 activation domain that contains that 35S promoter can be operatively connected, and connects right border sequence afterwards).147 amino acid of coded proteinic N end are from GAL4, and 101 amino acid of C end are from C1 carboxyl terminal 173-273 amino acid.Past has shown and similarly has been combined in the transient expression experiment work (Goff etc., 1991).
Being designed to be adopted 5 ' by the synthetic promoter of this factor activator holds the Bz1 TATA element (also selectively adopting the CaMV 35S promoter of the brachymemma that contains TATA element (transcripting start point-59 is to+48 Nucleotide relatively)) of 1O tandem copy of the upstream activating sequence (UASG) that has merged the identification of GAL4 albumen to make up.(pAT 73 structures contain left margin sequence, 35S promoter successively, Tetrahydrofolate dehydrogenase encoding sequence, the 35S 3 ' terminator sequence that can be operatively connected with 35S promoter, 10 the GAL4 binding site structures of connecting, the gus reporter gene element that can be operatively connected, 35S 3 ' terminator sequence and right border sequence that contain the TATA element).In order in the stable conversion body, to estimate the efficient of this system, select a reporter gene as the activatable dna sequence, as the intestinal bacteria uidA (β-glucuronidase of the modification of UASG/TATA synthetic promoter startup; GUS) encoding sequence.The pattern report gene that gus gene is considered to express is because its gene product detects easily and be quantitative.
The transgenosis Ah cloth platymiscium system of containing the heterozygosis transcription factor gene adopts the agriculture bacillus mediated generation that is converted.By instantaneous conversion luciferase reporter gene structure, screening can activate the UASG/TATA synthetic promoter and cause the elementary transformant of expressing (T1 generation).Only about half of tested T1 transformant shows uciferase activity behind the microparticle bombardment.RNA gel engram analysis confirms these transformant expression GAL4/C1 gene.Separation by T2 kalamycin resistance (selected marker that T-DNA carries) at single seat in generation after the selfing further detects these strain systems.The existence that single T-DNA inserts is proved conclusively (data not shown) by carry out genomic dna gel engram analysis in performance isolating strain in 3: 1 is.Adopt RNA gel blotting further to analyze GAL4/C1 expression of gene in these strain systems.But rna blot analysis shows two strain systems and all expresses the genetically modified stable RNA of detection level.Choose an effect system, called after pAT53-103 is used for further experiment.Some T2 plant selfings produce the T3 transgenic progeny, therefrom screen the homozygote that T-DNA inserts.
The transgenosis Ah cloth platymiscium strain system of containing the UASG/TATA/GUS gene adopts the agriculture bacillus mediated generation that is converted, and selects to screen homozygote by methotrexate.Choose two strain systems, called after pAT73-309 and pAT73-346 are used for the GUS activation analysis, find that the GUS activity is very low, do not have significant difference (table 1) with the experiment background.Produce the F1 contain heterozygosis trans-activating factor gene and can activate reporter gene for plant by allogamy, screen with kantlex then.Compare with the plant that only contains reporter gene, F1 has produced very high GUS activity for plant, and it can compare (table 1) with the expression level that uses strong promoter such as CaMV 35S to obtain.Table 1.F1 is for β-glucuronidase activity of plant.
The GUS activity
*Transformant (nmol MU/min/mg albumen) 35S/GUS strain is 7 17.6 ± 4.3
Strain is 105 19.1 ± 7.2
Strain 115 12.1 ± 3.7 non-conversion Nossen 0.03 ± 0.O1pAT53-103 0.01 ± O.0pAT73-309 0.01 ± 0.01pAT73-309 * pAT53-103 F1 4.97 ± 3.41pAT73-346 0.01 ± 0.0pAT73-346 * each strain of pAT53-103 F1 6.02 ± 2.3* or F1 filial generation are measured GUS activity (mean+SD) embodiment 2-expression silencing antisense dna sequence in stablizing genetically modified plants of 20 strain plants
In addition, gene function is studied in the expression of the inverted defined gene that the present invention can be by inducing the tested genetic expression of special deactivation.The present invention is used to start inverted defined gene and expresses to eliminate gene function.Adenylosuccinate synthetase (AdSS) encoding gene changes into IMP one of from the beginning biosynthetic two steps of purine of AMP, is used as the activatable dna sequence.AdSS is considered to natural action target (Cseke etc., 1996 of effectively removing grass product hydantocidin recently; Fonne-Pfister etc., 1996; Siehl etc., 1996).The active available standard enzymatic analysis well known in the art of AdSS is measured, for example pass through AdSS enzyme and AdSS substrate reactions, the AdSS enzyme can form a kind of the measurement and the remarkable different product of substrate by this substrate of catalysis, measures the catalyzed conversion speed that substrate conversion becomes product then.This conversion can directly be measured by determining the substrate, product or both amounts that exist in the different time reaction, perhaps by determining the amount of only relevant with substrate or product mark, as radioactivity or color indicator, comes indirect measurement.The full-length cDNA that Southern engram analysis announcement this paper is used for the inverted defined gene structure is the term single gene that Ah cloth belongs to genome.
Based on the successful expression of antisense dna sequence in the stable conversion plant of embodiment 1, the successful expression of supposition AdSS antisense sequences in the stable transgenic plant of the synthetic promoter that contains heterozygosis transcription factor gene and the expression of startup AdSS antisense sequences will cause the deactivation of endogenous AdSS genetic expression.Also infer, if AdSS antisense sequences successful expression will cause causing death with the similar plant of hydantocidin herbicide effects so.But before carrying out these experiments, those skilled in the art also do not know whether whether the expression of antisense sequences in the stable conversion plant can take place, cause the inactivation of AdSS gene.Describe in detail as following, in stablizing transgenic plant successful expression the AdSS antisense sequences, and the expression of endogenous AdSS enzyme also is suppressed.
15 transfer-gen plants that contain UASG/TATA/ antisense AdSS structure have been produced with Agrobacterium-mediated Transformation.(structure pJG261AntiAdSS contains left margin sequence, pNos/BAR/ gene 73 ' selected marker box successively, contains 10 series connection GAL4 binding site structures, AdSS antisense encoding sequence, 35S 3 ' terminator sequence and right border sequence of TATA element.) flower of elementary transformant and trans-activating factor are isozygotied is the pollen hybridization of pAT53-103.F1 grows on the flat board that contains kantlex for seed, to select outcross.These elementary transformant be the T-DNA that imports (containing inverted defined gene) narrow, it in most of the cases will separate by single Mendelian character.Therefore, inverted defined gene should be pressed separation in 1: 1 with the background that contains the state trans-activating factor gene that narrows all the time (except the pollution seed that rare selfing produces, it can germinate and is selected) in the presence of selected marker such as kantlex.In 6 strain systems, about 50% growth of seedling is seriously slow, can not germinate fully in some cases.5 other strain systems survive to the true leaf expansion, but demonstrate various growth failures after changing in the soil.Last 4 strains system shows seldom or does not have an abnormal phenotype.
In order to prove conclusively observed severe growth retardation and to cause death owing to existing described antisense transgene to cause, the design primer carries out the polymerase chain reaction with the zone between amplification AdSS cDNA 5 ' end and the minimum 35S promoter.Gel electrophoresis shows, has man-to-man consistence between unusual seedling and inverted defined gene.In order to check the variation of phenotype between the different antisense strains system, we have carried out RNA gel blot hybridization in F1 generation of different antisense strains system.With AdSS probe and the gel blot hybridization that contains from the RNA of non-conversion Col-0 plant, pAT53-103 plant and pAT53-103 * antisense AdSS first familiar generation plant, be presented in the strain system with severely subnormal phenotype and seldom detect AdSS RNA.(must omit the most serious seedling killer strain system in the analysis, RNA is extractive to be organized very little because can be used for.) these embodiment can consider that following technical description further understands.Recombinant plasmid
PSGZL1 makes up by the EcoR I site that the GAL4-C1 EcoRI I fragment with pGALC1 (Goff etc., 1991) is connected to pIC20H.The GAL4-C1 fragment of pSGZL1 is cut with BamH I-Bgl II enzyme, and the BamH I site of inserting pCIB770 (Rothstein etc., 1987) then is to produce pAT53.
Downcut 10 UASG sites and minimum 35S promoter (59 to+1) as EcoR I-Pst I fragment from pGALLuc2 (Goff etc., 1991), insert the corresponding site of pBluescript, produce pST52.PAT66 connects with the three parts between Hind III-EcoR I endonuclease bamhi of the Pst I-EcoR I fragment of Hind III-Pst I fragment of pAT52, pCIB1716 (containing 35S untranslated homing sequence, gus gene and 35S terminator sequence) and pUC18 and makes up.The 35S homing sequence of pAT66 cut with Pst I-Nco I enzyme and with PCR produce+1 to+48 35S homing sequence substitutes, with generation pAT71.
Insert Tetrahydrofolate dehydrogenase (dhfr) plant selectable marker gene in the BamH I site of pCIB710 (Rothstein etc., 1987) and produce pCIB921.The 35S promoter of pCIB921/dhfr box gene downcuts with Xba I-EcoR I, is inserted into the corresponding site of pCIB730 (Rothstein etc., 1987), produces pAT58.The EcoR I fragment that will contain the pAT71 of 10 UASG sites/minimum 35S promoter/GUS/35S terminator sequence is inserted the EcoR I site of pAT58, to make up pAT73.
(Stratagene, LaJolla CA) with the linearizing of Sac I, handle with mung-bean nuclease and remove Sac I site plasmid pBS SK+ then, reconnect with the T4 ligase enzyme, to produce pJG201 again.From pAT71, separate UASG/CaMV 35S minimal promoter/gus gene/CaMV terminator sequence box with KpnI, be cloned into the Kpn I site of pJG201, produce pJG304.Partly digest pJG304 with restriction enzyme A sp718, separate the total length linear fragment.This fragment is connected with oligonucleotide 5 ' the GTA CCT CGA GTC TAG ACT CGA G 3 ' of molar excess number.Insert the clone that hold in this site 5 ', this plasmid called after pJG304 Δ Xho I with the described joint of Restriction Enzyme Analysis and Identification.
The fragment that the AdSS synthetic enzyme cDNA that had described with Oligonucleolide primers 5 ' GATTCGAGCTCATGTCTCTCTCTTCCCTC 3 ' and 5 ' GATTCCCATGGTGGACCTGAACCAACTC, 3 ' pcr amplification clones (Fonne-Pfister etc., 1996) (GenBank accession#U49389).With Sac I and Nco I digested vector pJG304 Δ Xho I, to downcut the gus gene encoding sequence.AdSS PCR fragment is connected in the pJG304 Δ Xho I with Sac I and the digestion of Nco I, produces pJG304AntiAdSS.
Remove rouge alkali synthetase promoter/GUS box with EcoR I and Hind III digested vector pGPTV (Becker etc., 1992).Simultaneously, downcut super joint from pSE380, be cloned into EcoR I/linearizing pGPTV of Hind III, produce pJG261 with EcoR I and Hind III.
With Xho I digestion pJG304AntiAdSS, contain the box of UASG/35S minimal promoter/antisense AdSS/CaMV terminator sequence fusions with cutting-out.This box is connected to the pJG261 of Xho I digestion, so that this transcribes the Divergence of transcribing with the bar selected marker, produces pJG261AntiAdSS.Transgenic plant
The pJG261AntiAdSS electricity is converted into agrobacterium tumefaciens (Agrobacteriumtumefaciens) GV3101 (pMP90) strain (Koncz and Schell, 1986) in, and soak into the bacterial strain that obtains and to transform (Bechtold etc., 1993) Ah cloth's platymiscium (the Columbia ecotype).Soak into the conversion plant seed and containing 15 mg/litre glufosinate (Basra, AgrEvo) agar germination substratum (4.3 grams per liter Murashige-Skoog salt, 0.5 grams per liter MES, 1% sucrose, 10 micrograms per litre VITMAIN B1,5 micrograms per litre vitamin B6s, 5 micrograms per litre nicotinic acids, 1 mg/litre inositol, pH 5.8) go up and select.
Belong to root explant (the Nossen ecotype) by (1988) such as Valvekens are described with pAT53 conversion Ah cloth.
The transgenic plant that 15 strains contained the minimum CaMV 35S promoter of UASG//antisense AdSS structure are transplanted in the soil, grow to maturation in the greenhouse.Is the pollen hybridization of pAT53-103 with the flower of elementary transformant with the GAL4/C1 trans-activating factor that isozygotys.F1 for seed growth on the germination substratum that contains 50 mg/litre kantlex.Foranalysis of nucleic acids
It is described to press Lagrimini etc. (1987), with phenol/chloroform extracting, LiCl precipitate and separate RNA.RNA gel trace is undertaken by (1991) such as Ward are described.Hybridization probe adopts the PrimeTime test kit, and (New Haven CT) uses with random priming for International Biotechnologies, Inc.
32The P-dCTP mark.Hybridization conditions is 7% sodium lauryl sulphate (SDS), 0.5M NaPO
4(pH7.0), 1mM EDTA, 1% bovine albumin, 65 ℃.After hybridization is spent the night, with 1%SDS, 50mM NaPO
4, 1mM EDTA washes film (Church and Gilbert, 1984) in 65 ℃.
Claims (11)
1. analytical procedure, it comprises
A) will contain first kind of stable conversion plant of heterozygosis transcription factor gene, the heterozygosis transcription factor of wherein said heterozygosis transcription factor gene coding can activate this synthetic promoter when synthetic promoter is present in this plant, and this plant is isozygotied for this heterozygosis transcription factor; With
B) contain the activatable dna sequence and can be hybridized by second kind of stable conversion plant of described heterozygosis transcription factor activated synthetic promoter, wherein the activatable dna sequence can obtain to express when the heterozygosis transcription factor exists, and described hybridization produces the F1 plant of expressing this dna sequence dna; With
C) expression effect of this activatable dna sequence in the mensuration F1 plant.
2. the analytical procedure of claim 1, wherein the DNA of heterozygosis transcription factor gene coding yeast GAL4 gene source is in conjunction with the transcription activating domain of territory and corn C 1 gene source.
3. the analytical procedure of claim 1, wherein minimal promoter is selected from CaMV 35S minimal promoter, corn Bz1 promotor and UBQ3 promotor.
4. the analytical procedure of claim 1, wherein the synthetic promoter sequence comprises that 5 ' end has merged the CaMV35S minimal promoter that contain TATA element of GAL4DNA in conjunction with 10 tandem copies of upstream activating sequence of territory identification.
5. the analytical procedure of claim 1, wherein the DNA of heterozygosis transcription factor gene coding yeast GAL4 gene source is in conjunction with the transcription activating domain of territory and corn C 1 gene source, and wherein the activatable dna structure contains the synthetic promoter sequence of CaMV 35S minimal promoter, and this CaMV35S minimal promoter 5 ' end that contains the TATA element has merged GAL4 DNA 10 tandem copies of upstream activating sequence in conjunction with territory identification.
6. method of identifying AdSS weeding inhibitor, it comprises
A) when the suspicious weeding inhibitor of plant AdSS enzyme function exists, plant AdSS enzyme and AdSS substrate are reacted; With
Whether the AdSS enzyme reaction speed ratio when AdSS enzyme reaction speed and suspicious inhibitor do not exist when b) suspicious inhibitor being existed under the similarity condition has suppressed plant AdSS with definite this suspicious inhibitor.
7. the plant that contains heterozygosis transcription factor gene and activatable dna structure, the synthetic promoter that the heterozygosis transcription factor of wherein said heterozygosis transcription factor gene coding can activate the activatable dna structure is to induce the expression of the antisense dna sequence that can be operatively connected, and wherein said plant stability has transformed heterozygosis transcription factor and activatable dna structure.
8. the plant of claim 7, wherein the heterozygosis transcription factor gene comprises
A) be selected from the DNA of gene source of yeast GAL4 gene, phage 434, lexA, lacI and lambda particles phage repressor in conjunction with the territory;
B) be selected from the transcription activating domain of the gene source of hsv VP16, corn C 1 and P1;
C) contain the activatable dna structure of the minimal promoter that is selected from CaMV 35S minimal promoter, corn Bz1 promotor and UBQ3 promotor.
9. the plant of claim 7, wherein said synthetic promoter sequence comprise that 5 ' end has merged the CaMV35S minimal promoter that contain TATA element of GAL4DNA in conjunction with 10 tandem copies of upstream activating sequence of territory identification.
10. the plant of claim 7, wherein said heterozygosis transcription factor gene coding from the DNA of yeast GAL4 gene in conjunction with the territory with from corn C 1 gene transcription activation domain, and wherein said activatable dna structure comprises the synthetic promoter sequence that contains CaMV 35S minimal promoter, and wherein this CaMV 35S minimal promoter 5 ' end that contains the TATA element has merged GAL4 DNA 10 tandem copies of upstream activating sequence in conjunction with territory identification.
11. the plant of claim 7, wherein the activatable dna sequence is the AdSS antisense sequences.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US97883097A | 1997-11-26 | 1997-11-26 | |
| US08/978,830 | 1997-11-26 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN1280623A true CN1280623A (en) | 2001-01-17 |
Family
ID=25526430
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 98811629 Pending CN1280623A (en) | 1997-11-26 | 1998-11-24 | Method and compositions useful for activation of silent transgenes |
Country Status (9)
| Country | Link |
|---|---|
| EP (1) | EP1034284A1 (en) |
| JP (1) | JP2001524315A (en) |
| CN (1) | CN1280623A (en) |
| AR (1) | AR016696A1 (en) |
| AU (1) | AU745867B2 (en) |
| BR (1) | BR9815035A (en) |
| CA (1) | CA2311632A1 (en) |
| WO (1) | WO1999027119A1 (en) |
| ZA (1) | ZA9810771B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104202970A (en) * | 2012-02-15 | 2014-12-10 | 小鼠角有限责任公司 | Transgenic animals with customizable traits |
Families Citing this family (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1220937A2 (en) * | 1999-09-20 | 2002-07-10 | Center for the Application of Molecular Biology to International Agriculture | Methods for site-associated modification of gene activity and nucleic acid structure |
| EP1222293A2 (en) * | 1999-10-01 | 2002-07-17 | Basf Aktiengesellschaft | Gmp synthetase derived from plants |
| WO2001031025A2 (en) * | 1999-10-25 | 2001-05-03 | Basf Aktiengesellschaft | Formylglycinamidinribotide synthase from plants |
| US6376746B1 (en) | 1999-12-13 | 2002-04-23 | Paradigm Genetics, Inc. | Modified minimal promoters |
| US6331663B1 (en) | 1999-12-13 | 2001-12-18 | Paradigm Genetics, Inc. | Modified full length promoters |
| GB0017547D0 (en) * | 2000-07-17 | 2000-09-06 | Bp Chem Int Ltd | Supported polymerisation catalysts |
| GB0125784D0 (en) * | 2001-10-26 | 2001-12-19 | Syngenta Ltd | Novel expression system |
| US20060075522A1 (en) | 2004-07-31 | 2006-04-06 | Jaclyn Cleveland | Genes and uses for plant improvement |
| EP1788861B1 (en) | 2004-08-24 | 2017-04-12 | Monsanto Technology, LLC | Adenylate translocator protein gene non-coding regulatory elements for use in plants |
Family Cites Families (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0375407B1 (en) * | 1988-12-21 | 1995-06-14 | Canon Kabushiki Kaisha | Recovery mechanism of an ink jet recording apparatus |
| CA2047633A1 (en) * | 1990-09-12 | 1992-03-13 | Ben Bowen | Inactivation of gene transcription in plants using altered transcriptional activators |
| US5409823A (en) * | 1992-09-24 | 1995-04-25 | Ciba-Geigy Corporation | Methods for the production of hybrid seed |
| US5688939A (en) * | 1994-12-22 | 1997-11-18 | Novartis Finance Corporation | Plant adenylosuccinate synthetase and DNA coding therefor |
| GB9502456D0 (en) * | 1995-02-08 | 1995-03-29 | Univ Warwick | Control of genes in transgenic plants |
| GB9603069D0 (en) * | 1996-02-14 | 1996-04-10 | Medical Res Council | Improvements in or relating to gene expression |
| EP0823480A1 (en) * | 1996-08-06 | 1998-02-11 | Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. | Controlled gene expression in plants |
| US5968793A (en) * | 1997-06-24 | 1999-10-19 | E. I. Du Pont De Nemours And Company | Specific gene activation by chimeric Gal4 transcription factors in stable transgenic plants |
-
1998
- 1998-11-24 CN CN 98811629 patent/CN1280623A/en active Pending
- 1998-11-24 AR ARP980105950 patent/AR016696A1/en not_active Application Discontinuation
- 1998-11-24 EP EP98964437A patent/EP1034284A1/en not_active Withdrawn
- 1998-11-24 JP JP2000522260A patent/JP2001524315A/en active Pending
- 1998-11-24 CA CA002311632A patent/CA2311632A1/en not_active Abandoned
- 1998-11-24 BR BR9815035-9A patent/BR9815035A/en unknown
- 1998-11-24 WO PCT/EP1998/007577 patent/WO1999027119A1/en not_active Application Discontinuation
- 1998-11-24 AU AU19639/99A patent/AU745867B2/en not_active Ceased
- 1998-11-25 ZA ZA9810771A patent/ZA9810771B/en unknown
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104202970A (en) * | 2012-02-15 | 2014-12-10 | 小鼠角有限责任公司 | Transgenic animals with customizable traits |
| CN104202970B (en) * | 2012-02-15 | 2017-02-22 | Ag遗传学股份有限公司 | Transgenic animals with customizable traits |
Also Published As
| Publication number | Publication date |
|---|---|
| AR016696A1 (en) | 2001-07-25 |
| CA2311632A1 (en) | 1999-06-03 |
| BR9815035A (en) | 2000-10-03 |
| JP2001524315A (en) | 2001-12-04 |
| ZA9810771B (en) | 1999-05-26 |
| AU1963999A (en) | 1999-06-15 |
| EP1034284A1 (en) | 2000-09-13 |
| AU745867B2 (en) | 2002-04-11 |
| WO1999027119A1 (en) | 1999-06-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11008578B2 (en) | Engineered landing pads for gene targeting in plants | |
| WO2019207274A1 (en) | Gene replacement in plants | |
| US20240110197A1 (en) | Expression modulating elements and use thereof | |
| US20030221224A1 (en) | Enhanced silk exsertion under stress | |
| US20130007927A1 (en) | Novel centromeres and methods of using the same | |
| CN114008203A (en) | Methods and compositions for generating dominant alleles using genome editing | |
| CN1280623A (en) | Method and compositions useful for activation of silent transgenes | |
| Chang et al. | Characterization of a plant-transformation-ready large-insert BIBAC library of Arabidopsis and bombardment transformation of a large-insert BIBAC of the library into tobacco | |
| EP3519574A1 (en) | Plant promoter for transgene expression | |
| CN101883572B (en) | Sorghum aluminum tolerance gene SBMATE | |
| CN105504031B (en) | From the grain weight GAP-associated protein GAP and its relevant biological material of soybean and application | |
| KR20200070357A (en) | Plant resistance | |
| CN101389212A (en) | Transgenic corn seed with enhanced free lysine | |
| CN108473997B (en) | Plant promoters for transgene expression | |
| JP2001514856A (en) | Selective expression of genes in plants | |
| WO2007073445A1 (en) | Transgenic corn seed with enhanced free lysine | |
| CN106062189A (en) | Novel maize ubiquitin promoters | |
| CN111295093A (en) | Plant promoters for transgene expression | |
| US20120096583A1 (en) | Methods and compositions for enhanced gene expression through intron free energy reduction | |
| WO2023118541A1 (en) | Regulatory nucleic acid molecules for modifying gene expression in cereal plants | |
| CN116836249A (en) | Three homologous genes and related proteins related to wheat yield | |
| US7829690B2 (en) | Regulatory DNA elements from Agrobacterium vitis S4 | |
| CN117209575A (en) | Application of protein and encoding gene thereof in regulation and control of corn northern leaf blight and northern leaf blight | |
| CN104788553A (en) | Application of stress-tolerant related protein R10 to regulating plant adverse resistance |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |