CN1276079C - Recombination high molecular form mannose binding lectin (MBL), preparing method and application thereof - Google Patents

Abstract

This invention comprises of construction of a recombinant CHO cell line that produces functional mannose binding lectin (MBL) and of special uses of MBL. Specially, use of MBL for development of a therapeutic agent for patients having systemic infection with viruses, bacteria, or fungus is described. More specifically, MBL as a trigger for complement activation and MBL so formulated to activate complement system for the purpose of treating patients with microbial infection.

Description

A kind of reorganization polymer MBL and preparation method thereof and application

Technical field

The present invention relates to a kind of reorganization MBL and preparation method thereof and application, particularly a kind of reorganization polymer MBL and preparation method thereof and application.

Background technology

MBL (mannose binding lectin, mannose binding lectin) relates to the serum protein of congenital immunity.Its molecular weight is 32KD, comprises C-terminal sugar in conjunction with territory (CRD), the rich halfcystine of collagen protein territory and N-terminal district.The collagen protein territory of three MBL molecules forms triple helix, causes forming tripolymer, and trimerical six unit form macromole by the intramolecular disulfide bond of N-terminal halfcystine.MBL can associate with other albumen, as relevant serine protease (MASP 1, and MASP 2, or MASP 3) of MBL or MBL associated protein (Map19).The whole shape of molecule of MBL is similar to first component (C1q) of complement system.The function of active MBL is also similar to C1q, and still, different with C1q is that it is by c4 cleavage and C2 activating complement system.The activation of MBL need be in conjunction with the microorganism with unique glycosylation pattern on their surface protein.In this process, the relevant serine protease of MBL is activated, and C4 and C2 are cleaved in the same manner, makes the C1q serine protease (C1r and C1s) of be correlated with activate by cracking C3 triggering complement system.The MBL that combines with microorganism also helps effective phagolysis of microorganism, just look like MBL be Opsonin.

At present, mbl gene has been expressed in the various clones, comprise Chinese hamster ovary celI (Katsuki Ohtani, etal.J.of Immunol.Methods 222,135-144,1999) or HLF hepatoma cell line or HEK 293 EBNA clones (T.Vorup-Jensen, etal.International Immunopharmacology 1,677-687,2001).In Chinese hamster ovary celI system, it is possible that high yield is expressed, but the MBL that reclaims mainly is monomer and dimer, does not have the oligomer of significant quantity.The expression of mbl gene in the human cell line who transforms produced obviously more oligomer, but overall yield is lower than 1 μ g/mL substratum.The MBL mixture energy activating complement system that has only the high molecular form.

The activation of complement system is very important for resisting infected by microbes.It is not only prepared for invading effectively engulfing with direct cracking of microorganism, and helps effectively to induce adaptive immunity.Up to the present, also do not have artificially to handle the patient of infected by microbes and the trial of transferring complement system.

The level of MBL alters a great deal on Different Individual in the serum, and scope is at 50ng/mL or lower to changing above between the 3 μ g/mL serum, and this mainly is because inheritable variation.Inheritable variation comprises point mutation and the promoter region mutation on the exon.The individual susceptible to infected by microbes of common low-level MBL.Especially, those ewborn infants with low-level MBL can be subjected to infected by microbes abnormally dangerously.According to an investigation (Y.Hakozaki, etal.Liver, 22,29-34,2002), depend on the serum level of MBL owing to the hepatitis b virus infected mortality ratio that stands the patient of liver failure.The patient of high level MBL (3 μ g/mL) can be not dead, and the patient of 80% low MBL level can be dead.Therefore, the individuality of those low MBL levels may be benefited because of MBL replenishes.

The present inventor has made up a recombinant yeast cell system, and it can produce pre-S district (the PCT/ Korean Patent Application No.: 02/00820 of hepatitis B virus envelope protein; Chinese patent 03102363.0).

The innovation and creation content:

The purpose of this invention is to provide a kind of reorganization polymer MBL that is used for the treatment of virus, bacterium or fungi infestation.

Reorganization polymer MBL provided by the present invention is to express the oligomer MBL that obtains by pMSG-MBL transformed host cell system back.

Wherein, (Korean Patent: KCCM10202) dna sequence dna makes up pMSG-MBL, and this sequence comprises the nuclear matrix attachment zone composition of betaglobulin sequence, SV40 polyadenylic acid, the transcription termination sequence of gastrin gene and MBL cDNA from pMSG.MBL cDNA prepares from people's liver cDNA library with PCR method.Host cell system is a zooblast; Be preferably Chinese hamster ovary (CHO) cell, human liver cell, and/or human embryo kidney (HEK) (HEK) cell; Most preferably be Chinese hamster ovary (CHO) cell.

Second purpose of the present invention provides a kind of method for preparing reorganization polymer MBL.

The method for preparing reorganization polymer MBL provided by the present invention is with pMSG-MBL transformed host cell system, is filtered out reorganization polymer MBL cloning by expression by transformed host cells system through cultivation, and polymer MBL obtains recombinating.

Wherein, host cell system is a zooblast, is preferably Chinese hamster ovary (CHO) cell, human liver cell, and/or human embryo kidney (HEK) (HEK) cell.The cultural method of host cell system comprises suspension culture, cell fixation is cultivated on culture flask or bottle or bio-reactor etc.

The reorganization polymer MBL cloning by expression that is filtered out is CHO MBL/D1-3KCTC 10472BP.Described CHOMBL/D1-3 selects to obtain by add increment methotrexate (MTX) in substratum.

The present invention also provides the method for purification of Recombinant polymer MBL.Can use reorganization pre S or any other glycosylated protein purification of Recombinant polymer MBL.For example, the pre S that at first will recombinate (recombinant pre S fromYeast, patent; PCT/KR02/00820) be fixed on the suitable base for post matter, then adorn post, use suitable this post of damping fluid balance then, exist the substratum application of sample that will have reorganization polymer MBL under the situation of calcium ion to this post at last, with the buffer solution elution reorganization polymer MBL that contains EDTA or EGTA.This base for post matter can be any suitable matrix, for example agarose.The balance of this post can be carried out with the damping fluid of the best combination that reorganization polymer MBL and pre S are provided.The scope of this damping fluid institute calcium ions is between 2mM-20mM.The source of the reorganization polymer MBL that this is purified can be that human serum or any other contain the material of reorganization polymer MBL, as the substratum of CHO MBL/D1-3.Wash-out reorganization polymer MBL can carry out with the solution of any EDTA of containing or EGTA from the post, and the concentration range of contained EDTA of wherein said solution or EGTA is between 5mM-10mM.If necessary, can repeat this affinity column step.

The 3rd purpose of the present invention provides two kinds of purposes of reorganization polymer MBL.

First kind of purposes of reorganization polymer MBL provided by the present invention is that the reorganization polymer MBL with purifying is that activeconstituents treatment microorganism (as SARS virus) infects and/or strengthens zero or the medicine of the individual immunity power of low-level serum MBL.

This medicine can comprise water, damping fluid, and/or stablizer.Stablizer comprises 3% to 30% at least a following substances: glycerine, glucose, sucrose, sorbyl alcohol, trehalose, maltose, albumin, and amino acid.

This medicine can also comprise the MBL Rapsyn, and as MASP 1, MASP 2, and MASP 3, and/or Map19.These MBL Rapsyns can be natural source or recombinant protein.

This medicine can be oil suspension, solution or solid form.As this medicine is solid, can before the administration with this medicine dissolution in above-mentioned solution (being specially which solution).

The route of administration of this medicine can be an abdominal injection, subcutaneous abdominal injection, intramuscular injection or intravenous injection or a combined method.

It is 15 to 30 days that the suggestion consumption of said medicine is generally 0.2-0.5mg/kg/day course of treatment.

Second kind of purposes of reorganization polymer MBL provided by the present invention is to trigger thing as complement activation.

It is to be the mixture of activeconstituents with reorganization polymer MBL that complement activation provided by the present invention triggers thing.This mixture is can by pre S or any and MBL bonded glycosylated protein or peptide or seminose is coated on liposome or PLGA[poly-(D, L-lactic acid-altogether-oxyacetic acid)] on the nano particle, and then combine with reorganization polymer MBL and to obtain.This mixture is preferably reorganization polymer MBL-pre S-PLGA mixture, and it is to obtain in conjunction with reorganization polymer MBL by the PLGA nano particle that is coated with pre-S, and under the situation of the serum that has no MBL activating complement.Receive this meter particulate diameter between 10nM-10 μ M.

This complement activation triggers thing can be widely used in treating microorganism as virus, bacterium and/or fungi infestation.

Reorganization polymer MBL of the present invention is similar to the natural MBL from the human serum purifying, shows high molecular poly build.And Chinese hamster ovary celI of the present invention is that especially CHO MBL/D1-3 has produced a large amount of functional MBL, and this makes that this clone is used for industrial production MBL becomes possibility.

Description of drawings

Figure 1A is polyacrylamide gel electrophoresis (PAGE) figure of the reorganization polymer MBL of purifying

Figure 1B is the Western engram analysis figure of the reorganization polymer MBL of purifying

Fig. 2 A is the binding curve of human plasma MBL and glycosylated protein or mannosans

Fig. 2 B is the recombinate binding curve of polymer (rhMBL) and glycosylated protein or mannosans of people

Fig. 3 is the complement activation curve of rhMBL

Fig. 4 A is that pre S is in conjunction with PLGA nano particle synoptic diagram

Fig. 4 B wraps the synoptic diagram of the PLGA nano particle of quilt at aqueous phase for pre S

Fig. 5 A for PLG-pre S be attached to bag by the PLG on the rhMBL immunity plate in conjunction with volume-OD curve

Fig. 5 B be rhMBL be attached to PLG-pre S bag by the rhMBL on the immune plate in conjunction with concentration-OD curve

Fig. 6 is the C4 activating curve of PLG-pre S

Fig. 7 be in the presence of the rhMBL of increasing amount gradually sars coronavirus to the infection histogram of FRhk-4 cell

Fig. 8 A is the FRhK-4 cell infects SARS virus in the rhMBL of 2.5ug/ml microscopic examination figure

Fig. 8 B is the FRhK-4 cell infects SARS virus in the rhMBL of 0.63ug/ml microscopic examination figure

Fig. 8 C is the FRhK-4 cell infects SARS virus in the rhMBL of 0.16ug/ml microscopic examination figure

Fig. 8 D is the FRhK-4 cell infects SARS virus in the rhMBL of 0.02ug/ml microscopic examination figure

Fig. 8 E is the FRhK-4 cell infects SARS virus in the rhMBL of 0.0024ug/ml microscopic examination figure

Fig. 8 F is the FRhK-4 cell infects SARS virus in contrast microscopic examination figure

Embodiment

The structure of the Chinese hamster ovary celI system of embodiment 1, reorganization polymer MBL

(1) structure of expression vector

MBL cDNA is to use people's liver cDNA library by PCR method preparation, and it can be advanced the pEZ carrier by the clone, among the pEZ-MBL2-5.Nucleotide sequence is to verify with the sequence (Gene Bank NM_000242) that is stored in the gene pool.Use this pEZ-MBL2-5DNA as template, by be used for the 750bp MBL cDNA that MBL express of PCR method with positive primer (ctagctagccaccatgtccctgtttccatcactc) and anti-primer (gaagatctcagatagggaactcacagacg) preparation.This comprises Kozak sequence and the restriction endonuclease site that is used to clone to primer.This cDNA is cloned in the pMSG carrier with preparation pMSG-MBL.The sequence of MBL is verified once more by the gene pool sequence.

(2) the pMSG-MBL transfection is advanced in the expressive host

1. the preparation of pMSG-MBL DNA

Advance DH5 α [supE44, Δ lacU169 (Φ 80 lacZ Δ M15), hsdR17 in pMSG-MBL DNA transfection, recA1, endA1, gyrA96, thi-1, relA1] in the intestinal bacteria after, in the 100mL LB substratum that contains 100 μ g/mL penbritins, cultivate transformant.(Quiagen USA), prepares pMSG-MBL from this culture by using QUIAPREP plasmid Midi test kit.This pMSG-MBL linear DNA digests with Sca I and prepares.

2. prepare host cell

CHO DG44 (dhfr-/dhfr-) is cultivated in containing the α of 10%cFBS-MEM substratum, determine cell count with hematimeter.Regulate cell count then, become in containing α-MEM of 10%cFBS 2 * 10 ⁵Individual/the mL cell, in the CO2 incubator, cultivated 24 hours.

3. transform

The pMSG-MBL DNA that at room temperature will contain 2 μ g, 5.3 μ L Dosper ^TMAnd 16ng pDCHlP (Plasmid with DHFR gene, Venolia, etal.1987, Somat.Cell Mol.Genet.13, mixture 491-501) was cultivated 45 minutes.Then this mixture is joined in the host cell, cultivated 6 hours in 37 degrees centigrade.After the cultivation, remove substratum, add fresh α-MEM that 3mL contains cFBS.Then after 3 days, when cell transformed is increased to when abundant, by trypsin trypsine) handle harvested cell, and in 2mL does not have the α-MEM that contains 10% dialysis FBS of nucleosides, cultivate.Transformant was cultivated about 10 days, and substratum changed once in per 2 days.

(3) MBL produces the selection of cell and the amplification of mbl gene

By in substratum, add the MTX of increment gradually, the mbl gene that amplification is transduceed in transformant.The transformant number is adjusted to 4 * 105/hole, and under the situation that has 10nM MTX, cultivates, reach the fusion state up to cell.By similar fashion the concentration of MTX is increased to 1 μ M then.In each step, use anti-MBL antibody to determine the MBL expression level by the Western engram analysis.The level of MBL increases along with the increase of MTX concentration, and mono-clonal is selected from the cell that is suitable for 1 μ M MTX.

(4) selection of single optimum cell (clone)

For single cell clone, 1 μ M MTX is adapted to cell be assigned in 96 orifice plates 0.5 cells/well.This flat board is cultivated in the α-MEM that contains 10% dialysis FBS and 1 μ M MTX.After about 2 weeks, when unicellular colony forms, with cell transfer in 24 orifice plates.When cell is increased to when enough, after analyzing expression level, with cell freezing.Selected clone is CHO MBL/D1-3.

Under reduction and non-reduced condition, the MBL that recombinant cell lines produces is carried out polyacrylamide gel electrophoresis and Western engram analysis according to traditional method, the result is shown in Figure 1A and B, and the people who the shows generation polymer (rhMBL) of recombinating is (rhMBL) consistent with polyacrylamide gel electrophoresis and the Western engram analysis collection of illustrative plates of natural MBL.Among Figure 1A, swimming lane 1 is non-reduced condition, rhMBL (1.2 μ g); Swimming lane 2 is a reductive condition, rhMBL (6 μ g); Swimming lane 3 is non-reduced condition, blood plasma MBL (0.3 μ g); Swimming lane 4 is a reductive condition, blood plasma MBL (1.5 μ g); Swimming lane M is the molecular weight marker thing.In the Western engram analysis, first antibody is anti-people MBL (1: 1,500 a dilutions) polyclonal antibody, and second antibody is anti-mouse IgG-HRP (1: 5,000 a dilution) antibody; Swimming lane 1 is rhMBL among the figure, non-reduced condition; Swimming lane 2 is rhMBL, reductive condition; Swimming lane 3 is blood plasma MBL, non-reduced condition; Swimming lane 4 is blood plasma MBL, reductive condition; Swimming lane M is the molecular weight marker thing.

(5) estimation of reorganization polymer MBL expression level

Use CHO MBL/D1-3 clone, by comparing purifying MBL estimation MBL expression level from the known quantity of human serum.With 5 * 10 ⁵Individual cell is cultivated in the T25 flask, and the T25 flask is equipped with α-MEM that no nucleosides contains 10% dialysis FBS.When cell density reached 90% warm spending, the same medium that contains 5% dialysis FBS with 3mL replaced above-mentioned substratum.After 4 days, with 10 times of substratum dilutions, the amount of reorganization polymer MBL is 50 μ g/10 in estimating substratum ⁶Individual cell/sky.

The purifying of embodiment 2, reorganization polymer (rMBL)

(1) preparation of pre S agarose column

1 gram CNBr activatory sepharose 4B is suspended in the 1mM HCl solution, cleans for several times with same solution.Contain 0.2M NaHCO at pH 8.3 ₃In the associating damping fluid of 0.5M NaCl, with 6.4mg pre S with clean after agarose mix, be 0.5-10mg/mL with the final concentration that obtains pre S.After cultivating 2 hours under the room temperature, add the sealing damping fluid that contains 0.1M tris, pH 8.0, and keep 2 hours under room temperature.Then with sealing buffer solution for cleaning pre S-agarose, by the amount of Western engram analysis evaluate fixed pre-S.

(2) by using pre S-agarose column purifying rMBL

Carry out purifying by using pre S and MBL bonded character.Pre S can utilize the recombinant yeast cell system that the present inventor makes up (PCT/ Korean application number: 02/00820; China's application number: 03102363.0), carry out large-scale production.Pre S-agarose is filled on the post, with containing 20mM Tris pH 7.6,150mM NaCl, 10mM CaCl ₂And the MBL binding buffer liquid balance of 0.05%Tween 20.With in the Chinese hamster ovary celI substratum or the MBL in the serum be added on this post, and carry out extensive cleaning with sample loading buffer.Then with containing 20mM TrispH 7.6,150mM NaCl, the elution buffer of 5mM EDTA and 0.05%Tween 20 wash-out MBL from this post.In this way, only can produce 99.9% pure MBL, shown in Figure 1A and 1B once going on foot.

The confirmation of embodiment 3, rMBL (reorganization polymer MBL) function

The biological activity of rMBL is determined by two kinds of difference in functionalitys: (1) rMBL specificity is attached on the glycosylated protein in calcium dependence mode and (2) activating complement (C4 cracking) under the situation that has glycosylated protein and MASPs.

(1) rMBL and glycosylated protein combines

1. mannosans combination

Will be at the mannan solution in 50mM carbonate-bicarbonate buffer, application of sample makes every hole 1 μ g in Nunc Maxisorp immunity plate.In 4 degrees centigrade of incubated overnight, so as with the mannosans bag by flat board.With it with containing 20mM Tris pH 7.6,150mM NaCl, 10mM CaCl ₂And the dcq buffer liquid of 0.05%Tween-20 flushing 4 times, and handled 1 hour with 0.2%BSA.After with dcq buffer liquid washing plate 3 times, containing 20mM Tris pH 7.6,1M NaCl, 10mM CaCl ₂, 0.1%BSA adds 1 μ g MBL/ hole in the 100 μ L binding buffer liquid of 0.05%Tween-20., flat board is washed 6 times after 2 hours in the room temperature incubation with dcq buffer liquid, and colour developing.At first, with flat board with mouse anti human MBL monoclonal antibody (Dobeel, MBL8F6, dilution in 1: 100) in room temperature incubation 2 hours.Then add anti-mouse IgG-HRP antibody (1: 1500 dilution), and under room temperature incubation 1 hour.At last by OPD (Sigma, USA) colour developing, 150 μ l/ holes.By adding 3M HCl color development stopping, 50 μ l/ holes.Measure OD with automatic ELISA flat bed reader (microplate reader) in 492nm.

Relatively mannosans is active with combining of rMBL with natural MBL.The result shows that rMBL is with active similar from combining of the natural MBL of human serum purifying shown in Fig. 2 A and B.The both is equally with dose-dependent mode mannan-binding, but can not combine with BSA.

2. rMBL and pre S's combines

Use and MBL and mannosans be in conjunction with identical method, uses 1 μ g pre S to finish combining of MBL and pre S.Relatively mannosans is active with combining of rMBL with natural MBL.The result shows that rMBL is with active similar from combining of the natural MBL of human serum purifying shown in Fig. 2 A and B.The both equally in dose-dependent mode in conjunction with preS, but can not combine with BSA.

(2) complement activation of rMBL

1. carried out complement activation with the mannosans bag by plate

As in (1) 1. as described in usefulness 1 μ g/ hole mannosans bag by Nunc Maxisorp immunity plate hole, should under room temperature, use the rMBL incubation by flat board.The MBL that does not contain serum is used as the source of MASPs (MBL be correlated with serine protease)., flat board is cleaned 6 times after 2 hours at incubation, and under room temperature, use 500ng/ hole C4 incubation with cleaning buffer solution.Then, with its under room temperature with anti-C4 antibody-HRP incubation 1 hour, by adding 150 μ L OPD colour developing.After 20 minutes, add the reaction of 3M HCl color development stopping, the OD value is measured in 492nm in 50 μ L/ holes.This experiment has shown that rMBL has the activity with respect to comparability U.S. of C4 cracking serum MBL.

2. carried out complement activation with pre S bag by plate

With with (2) in 1. similar mode, determine MBL complement activation activity with pre S bag quilt (1 μ g/ hole) plate.The result shows that pre S is better than mannosans in the activation of the relevant serine protease of MBL as shown in Figure 3.

Embodiment 4, trigger the reorganization polymer MBL mixture of thing as complement activation

(1) pre S bag is by the preparation of nano particle

1. the preparation of PLGA nano particle

With molecular weight ranges is 1,000-100, and 000 poly-(D, L-lactic-co-glycolic acid) [PLGA] is dissolved in the organic solvent, in methyl alcohol or methylene dichloride.Then it is distributed in SDS or the Tween solution, in fierce the stirring, keeps spending the night.Therefrom reclaim nano particle.

2. the conjugation of PEG and nano particle

Use has poly-(ethylene glycol) [PEG] of assorted functional response's group (X-PEG-Y).In the organic solvent or the aqueous solution, reactive group X is activated, then on nano particle with reactive group (OH ,-COOH) conjugation.Used connector (X-) can be as following chemical group in this conjugation:

--S--S--

3. the conjugation of pre S and the conjugation nano particle to the PEG

The conjugation of pre S can realize by ε-amine on Methionin or the arginine or N-terminal amine.C-end or ε-carboxylic acid also can be used, to carry out the conjugation of pre S and the conjugation PEG to the nano particle.In these free Y reactive groups, PEG can be by on the carboxylic acid or amine of conjugation to the pre S.Wherein connector (Y-) can be following chemical group:

--S--S--

The conjugation synoptic diagram of pre S and the conjugation nano particle to the PEG is shown in Fig. 4 A and Fig. 4 B.About in the former publication of protein and PLGA nano particle bonded DOP detailed operating procedure description (H.S.Yoo et al being arranged, J.Controlled Release, 82,17-27,2002 and S.H.Choi and T.G.Park, Intl.J.Pharmaceutics, 203,193-202,2000).Pre S and a PLGA particle bonded quantity are 100,000-300,000.

(2) pre S-PLGA is as MBL activated functional molecular

Finish combining of rhMBL and pre S-PLGA according to pre S among the embodiment 3 and rhMBL bonded method, and realize complement activation by rhMBL-pre S-PLGA mixture.The result is respectively as Fig. 5 A and B and shown in Figure 6, and Fig. 5 A shows the amount decision of complement activation by PLG-pre S; Fig. 5 B shows the increasing amount decision of complement activation by rhMBL; Fig. 6 shows the increase along with PLG-pre s quantity, and the associating MASPs of rhMBL is activated on the division C4.Among Fig. 5 A and B and Fig. 6, PLG-pre S＜C〉expression PEG by conjugation to the carboxyl of pre S; PLG-preS＜N〉expression PEG by conjugation to the amido of pre S.At this, find the MBL bag by plate can not be used for the complement activation effect general since blocked MASPs and the MBL that is fixed solid surface form and.Therefore, also carried out the mensuration of complement activation effect, conjugation, MBL, MASPs and the C4 of PLGA-pre S and the conjugation nano particle to the PEG at aqueous phase.From this test, find, the conjugation of monomeric pre S and the conjugation nano particle to the PEG, the conjugation that is different from PLGA-pre S and the conjugation nano particle to the PEG, can not be stable compound with MBL, can not activate the complement activation effect of MBL and MASPs associating.

Embodiment 5, rhMBL are to the neutralizing effect of sars coronavirus

The rhMBL substratum that contains with different quantities carries out the test that fetus RhMK (FRhk-4) infects sars coronavirus, the result is shown in Fig. 7 and Fig. 8 A-F, Fig. 7 shows that the rhMBL of 2.5ug/ml can block the infection of virus, compare with the cell that does not have rhMBL to exist, can reduce below the virus infection to 15%.Fig. 8 A-F shows that in the presence of the MBL of 2.5ug/ml, microscope figure shows healthy cell.Do not exist down and there is MBL, the cell of infective virus only shows the cell of dead and enlargement.Consider that normal MBL level is 2.5ug/ml in the human serum, rhMBL blocks sars coronavirus under physiological concentration.About the growth of sars coronavirus with by existing (Ksiazek T.G.et al, the N.Engl.J.Med.2003 of describing in the former publication of the detailed experiment of RT-PCR virus detection; 348,20:1953-66and Peiris J.S.et al, Lancet 2003; 361,9366:1319-25).

Claims (4)

1, a kind of method for preparing reorganization polymer MBL, be to transform Chinese hamster ovary line with plasmid pMSG-MBL, by cell transformed is as the screening material with methotrexate, by in substratum, adding the increment methotrexate, and analysis MBL expression level, filter out reorganization polymer MBL cloning by expression, express the polymer MBL that obtains recombinating.

2, method according to claim 1 is characterized in that: the cultural method of described Chinese hamster ovary line comprises suspension culture, cell fixation is cultivated on culture flask or bottle or bio-reactor.

3, method according to claim 1 and 2 is characterized in that: the reorganization polymer MBL that described expression obtains also wants purified step.

4, method according to claim 3 is characterized in that: described purifying is to use the hepatitis B virus envelope protein to carry out.

Images