CN1266460A - Diacrylglycerol acyl transferase proteins - Google Patents

Abstract

By this invention, acyltransferase proteins are provided capable of catalyzing the production of triglycerides from 1,2-diacylglycerol and an acyl-CoA. The invention comprises a partially purified diacylglycerol acyltransferase (DAGAT), wherein said protein is active in the formation of triacylglycerol from fatty acyl-CoA and diacylglycerol substrates. Of special interest is a Mortierella ramanniana DAGAT having a molecular mass of approximately 40kD. Also considered are amino acid and nucleic acid sequences obtainable from DAGAT proteins and the use of such sequences to provide transgenic host cells with modified triacylglycerol levels.

Description

Diacrylglycerol acyl transferase proteins

The application is U.S. Patent application No.60/048, the continuation application of 625 part continuation application and U.S. Patent No. 5,679,881.

Technical field:

The present invention relates to enzyme, purifying also obtains method and the related amino acid and the nucleotide sequence of enzyme, and the using method of this composition in genetic engineering is used.

Introduction

Background:

Vegetables oil can be used for all industry and edible purposes.Need new vegetable oil composition and/or from biosynthesizing or natural phant source, obtain the modification method of oil compositions.According to the application of oil, need various different fatty acid compositions.For example, have in some cases and higher can be used for cheap and obtain required oil with kind of the oil grain of meat ratio again.This is the typical case of high value oil product, or oil grain like this can constitute the good feed of animal.Have low oil in some cases and will be used to purpose low in calories with the oil grain of planting the meat ratio.In other was used, having than the percentile edible plants oil of high unsaturated fatty acid was the required of cardiovascular health.Perhaps, high saturated tropical crops oil also finds to be used for various industry and edible the application as the appropriateness replacement of plam oil, Oleum Cocois or theobroma oil.

A kind of is the method for purpose to obtain fatty acid composition so oily and/or that modify, is to be undertaken by the genetic engineering of plant.But be genetically engineered plant, must have and suitable genetic material is transferred to method in the plant with stable and heritable mode.In addition, must have the nucleotide sequence that can produce the desired phenotype result, can instruct the regulatory region etc. of the correct application of this sequence.In addition, need recognize, require the so-called synthetic Kennedy approach of glyceride that is used for to be modified, so that the reactant of this approach of process and metabolic flux ratio are conditioned or change for producing desired phenotype.

As if higher plant through common pathways metabolism synthetic oil.Lipid acid in plastid from acetyl-CoA through series reaction, under the known catalysis that is referred to as fatty acid synthetase (FAS), produce.The lipid acid that produces in the plastid is output the cytoplasmic region to cell, and esterified be coenzyme A.These acyl-CoAs are glyceride synthetic substrates in the endoplasmic reticulum (ER).Glyceride is synthetic to be the series reaction that at first causes phosphatidic acid (PA) and diacylglycerol (DAG).One of these metabolic intermediates or both can form membrane phospholipid such as phosphatidyl glycerol (PG), phosphatidylethanolamine (PE) or phosphatidylcholine (PC), perhaps they can form neutral triacylglycerol (TAG), and triacylglycerol is by the plant main body of oil of seed as the energy storage form during seed germination.

Diacylglycerol (DAG) synthetic be by glycerol-3-phosphate and aliphatic alcohol through two steps through glycerol-3-phosphate acyltransferase (G3PAT); lysophosphatidate acyltransferase (DAGAT) catalysis successively produces PA, produces DAG through the catalytic hydrolysing step of phosphatidic acid phosphatase (PAP) then.In most cells, DAG is used to produce membrane phospholipid, and first step is through the synthetic PC of CTP-phosphorylcholine-cytidyl-transferase catalysis.In the cell that produces storage oil, DAG by the 3rd lipid acid through Diacrylglycerol acyl transferase (DAGAT) catalyzed reaction acidylate.Generally speaking, this reaction has constituted and has been often referred to a part of making the Kennedy approach.

The location specific of the structure of TAG, particularly lipid acid through every kind of three kinds of acyltransferases to the specificity of aliphatic alcohol and glycerol backbone substrate and determine.So for example, the acyltransferase in the seed of many temperate zones species allows the saturated or unsaturated fatty acids of sn-1 or sn-3 position, but only allows unsaturated fatty acids in the sn-2 position.The absolute specificity of the unsaturated fatty acids of sn-2 position is preferably determined through the substrate of DAGAT enzyme.In some species such as cocoa, the TAG composition is pointed out this tendency further: if promptly the sn-1 position is esterified is saturated fatty acid, and the sn-3 position is obviously preferential by the saturated fatty acylating acid.The TAG structure of SUS form (wherein S=saturated fatty acid, U=unsaturated fatty acids) like this is than based on stochastic distribution desired be than high percent of sn-2 position with unsaturated fatty acids fixed overall fatty acid composition.This prompting DAGAT also plays an important role in the adjusting of TAG structure, if do not play an important role in the control of TAG synthetic.

Through catalytic being reflected in the glyceride biosynthesizing of DAGAT is critical branching point.The main material standed for that is considered to the metabolism regulatory site at the enzyme of this tapping point.On the synthetic basis of diacylglycerol, the synthetic G3PAT that shares of TAG and film fat, DAGAT, and PAP.Because all cells all has cytolemma, they must have these enzymes.Making the synthetic homogeneous of oil is due to DAGAT reacts.The active DAG of existing for of DAGAT provides and removes the another kind of final result that enters in the film.Can guess that to drive the TAG synthetic be the existence of DAGAT enzyme, no matter and directly or indirectly by regulating cascade, DAGAT activity and/or diacylglycerol concentration enter in the glyceride flow in adjusting and play an important role.

Acquisition can be mixed in the glycerol backbone at lipid acid and be produced phenotype result's nucleotide sequence in a kind of oily process and have various obstacles to produce, include but not limited to the discriminating of metabolic factor interested, selection and evaluation with protein source of useful kinetic property, protein of interest matter is purified to the level that to carry out amino acid sequencing, utilizing amino acid sequence data to obtain can be as the nucleotide sequence of the probe that obtains required dna sequence dna, the preparation of construct, the analysis of conversion and gained plant.

Therefore, need to differentiate target enzyme and nucleotide sequence useful tissue-derived that can modify the target enzyme like this of oily structure and quantity.Ideally, the target enzyme is suitable for one or more and uses separately or produce with other and raising/reduction oil, the TAG structure, the ratio of saturated and unsaturated fatty acids in the lipid acid aggregate, and/or the lipid acid aggregate modified and the relevant nucleotide sequence applied in any combination of other new oil compositions that produces.One and the target enzyme qualitative by discriminated union, need proteinic amount and purification scheme with order-checking.Ultimate demand the useful nucleic acid construct of the essential element that the phenotype of providing modifies is provided and contains the plant of this construct.

The separating step of inferring of some DAGAT comes forth.Polokoff and Bell (1980) reported from rat liver microsomes the dissolving and partial purification DAGAT.This prepared product is pure inadequately thereby can not differentiate the responsible active specific proteins factor.Kwanyuen and Wilson (1986,1990) have reported from soybean cotyledon purifying and have identified this enzyme.But point out the fully dissolving of this prepared product, and in this contained any DAGAT protein part that is the big aggregate of numerous protein by molecular weight (1983kDa).Little etc. (1993) have reported the dissolving of DAGAT from the little spore deutero-of Semen Brassicae campestris embryo, but identical with Kwanyuen and Wilson, and the molecular weight of the material relevant with activity is too high, not dissolving fully.Andersson etc. (1994) have reported and have utilized immunoaffinity chromatography to dissolve from rats'liver and 415 times of purifying DAGAT.But not having the antibody recognition DAGAT epi-position that evidence shows that they are used or the protein of their purifying is genuine DAGAT.In fact, identical with Kwanyuen and Wilson, the activity of DAGAT presents the typical molecular weight of assembling membranin in their prepared product.At last, Kamisaka etc. (1993,1994,1996,1997) have reported and have dissolved DAGAT that from mortierella ramanniana subsequent purificn is to homogeneous.They illustrate since then that the molecular weight of the DAGAT of fungal species is 53kDa, this be first open report may real dissolved DADAT.We attempt duplicating in our laboratory its research (seeing embodiment 4) again, but fail to obtain the homogeneous prepared product, or with 53kDa polypeptide involved enzyme activity.In fact, we that the similar abundant 53kDa polypeptide that requires to Kamisaka etc. can be shown is uncorrelated with the DAGAT activity in the component of scheme acquisition with them.

Pertinent literature:

It is reported that the acellular homogenate of the jojoba embryo of growing has acyl-CoA Fatty Alcohol(C12-C14 and C12-C18) acyltransferase activity.This unsteady wax layer active and in differential centrifugation formation relevant (Pollard etal., (1979) document is the same; Wu et al., (1981) document is the same).

Dissolving with the active multienzyme complex from tiny Euglena of acyl-SCoA transaldolase is by Wildner and Hallick (Abstract from the Southwest Consortium FifthAnnual Meeting, April 22-24,1990, Las Cruces, NM.) report.

Pushnik etc. have reported the jojoba acyl-CoA: and the proteic 10 times of purifying of pure transaldolase (.Abstract from the Southwest Consortium Fourth Annual Meeting, February 7,1989, Riverside, Ca.).

Garver etc. have reported the jojoba acyl-CoA: the active analysis of pure transaldolase (Analytical Biochemistry (1992) 207:335-340).

WO 93/10241 relates to the plant aliphatic alcohol: Fatty Alcohol(C12-C14 and C12-C18) 0-acyltransferase.A kind of jojoba 57kD protein is accredited as the jojoba aliphatic alcohol: Fatty Alcohol(C12-C14 and C12-C18) 0-acyltransferase (Wax synthase).The inventor has reported that after a while the 57kD albumen from jojoba is a kind of β-ketoacyl coenzyme A synthase that participates in the biosynthesizing of very long longer chain fatty acid, (Lassner et al. (The plant Cell (1996) 8:281-292)).

Shockey etc. have also reported and have been estimated as acyl-CoA: the photoaffinity labeling of the 57kDjojoba seed polypeptide of Fatty Alcohol(C12-C14 and C12-C18) acyltransferase.(Plant?phys.(1995)107：155-160)。

Kamisaka and Nakahara: " Diacrylglycerol acyl transferase activity identification in the oil-containing fungi liposome component " J.Biochem. (1994) 116:1295-1301.

Kamisaka and Nakahara, " by the activation of anionic phospholipid stain remover dissolved Diacrylglycerol acyl transferase ".J.Biochem.(1996)119：520-523。

Kamisaka etc." active purifying of Diacrylglycerol acyl transferase and evaluation in the oil-containing fungi liposome component " J.Biochem. (1997) 121:1107-1114.

WO93/10241 relates to the plant aliphatic alcohol: Fatty Alcohol(C12-C14 and C12-C18) 0-acyltransferase.A kind of jojoba 57kD protein is accredited as the jojoba aliphatic alcohol: Fatty Alcohol(C12-C14 and C12-C18) 0-acyltransferase (Wax synthase).The inventor has reported that after a while the 57kD protein from jojoba is a kind of β-ketoacyl coenzyme A synthase (Lassner et al. (The Plant Cell (1996) 8:281-292)) that participates in the very long longer chain fatty acid biosynthesizing.

Brief description of the drawings

Fig. 1 represents the active analytical results of Wax synthase in the post component of first kind of Wax synthase purification scheme.Figure 1A provides the result of Blue A agarose chromatography.Figure 1B provides the result of ceramic hydroxyapatite.Fig. 1 C provides the result of polyacrylamide S-100 size exclusion chromatography.Fig. 1 D provides the result of hydroxyapatite.

Fig. 2 represents the active analytical results of Wax synthase in the post component of second kind of Wax synthase purification scheme.Fig. 2 A provides the result of Blue A agarose chromatography.Fig. 2 B provides the result of hydroxyapatite.Fig. 2 C provides the result of Superdex75 size exclusion chromatography.

Fig. 3 representative is according to Wax synthase and the active result of DAGAT in the purifying Wax synthase prepared product component of the Wax synthase purifying preparation of Fig. 1 representative.The result derives from the component after the hydroxyapatite step.

Fig. 4 representative utilizes the active analytical results of Wax synthase in the post component of DAGAT purification scheme of Yellow86-agarose chromatography.

Fig. 5 represents the active analytical results of DAGAT in the post component of second kind of Wax synthase purification scheme.Fig. 5 A provides the result of heparin sepharose CL-6B chromatography.Fig. 5 B provides the SDS-PAGE analytical results of peak component.

Fig. 6 A represents DAGAT purification result in the Yellow86-agarose chromatography.On behalf of the SDS-PAGE of peak component in the Yellow86-agarose chromatography, Fig. 6 B analyze.

Fig. 7 representative utilizes the result of yellow 86-agarose chromatography purifying DAGAT from mortierella ramanniana.

Fig. 8 represents the active analytical results of DAGAT in the post component of second kind of Wax synthase purification scheme.Fig. 8 A provides the result of hydroxyapatite.Fig. 8 B provides the SDS-PAGE analytical results of peak component.

Fig. 9 represents the active analytical results of DAGAT in the post component of DAGAT purification scheme.Fig. 9 A provides series connection Yellow86-agarose/hydroxyapatite result.Fig. 9 B provides the SDS-PAGE analytical results of series connection chromatographic peak component.

Brief summary of the invention

In the present invention, provide composition and the using method relevant with Diacrylglycerol acyl transferase (DAGAT).The composition and the method for the aminoacid sequence relevant with biological activity DAAGT (s) also are provided.

What cherish a special interest is the interior and external various application of body with the active DAGAT protein Preparation of relative high specific thing.Be particularly related to and have the active protein Preparation thing of DAGAT.Interested especially is the DAGAT that can obtain from mortierella ramanniana.

Also interested especially is that jojoba Wax synthase of the present invention also confirms to have active this discovery of diacylglycerol (DAGAT).TAG is not natural generation among the jojoba, therefore the activity prompting Wax synthase to the Wax synthase of DAG substrate is relevant with DAGAT, and DAGAT is a kind of enzyme that seed contained high levels is especially preserved generation TAG in the oil grain crop plants of TAG of being responsible in most of plant species.This sample invention comprises jojoba wax synthase protein and/or the application of its encoding sequence in the plant gene that separates encoding D AGAT.

Jojoba that is given an example and mortierella ramanniana DAGATs purifying be from film (i.e. dissolving), and dissolved DAGAT prepared product is carried out various chromatographic analysises, to differentiate and the relevant protein of DAGAT activity.The protein that has about 40kDa molecular weight in this mode is accredited as relevant with the DAGAT activity.Utilization is further purified method such as column chromatography and polyacrylamide gel electrophoresis, carries out amino acid sequence analysis with the DAGAT albumen that obtains enough purity.

The proteinic peptide fragment of DAGAT is used as template in design various can be used as in the synthetic oligonucleotide that obtains the complete or part DAGAT nucleic acid sequences to proteins of coding.Utilize the DAGAT encoding sequence that so obtains, it also can separate the proteinic DAGAT gene of other encoding D AGAT.

Like this, the present invention includes the corresponding aminoacid sequence of DAGAT peptide and these peptides, this sequence finds to have special role at the oligonucleotide that preparation contains the DAGAT encoding sequence to analyze and to reclaim in the DAGAT gene order.The complete or partial sequence of this DAGAT encoding sequence codified of application according to expectation.The all or part genome sequence, or the cDNA sequence is expected.

The recombinant DNA construction body of (expression) is transcribed or transcribe and translated to the special interested DAGTA of providing sequence.Especially the construct that can transcribe in plant host cell or transcribe and translate is preferred.This construct can contain various regulatory regions, comprise preferential gene transcription initiator of expressing in the comfortable plant seed tissue.

On the other hand, the present invention relates to by construct being expressed in the host cell or producing the method for DAGAT in its filial generation in cell.The cell that is contained DAGAT by the generation of DAGAT encoding sequence also comprises in the present invention.

In addition, the present invention relates to use the dna sequence dna modification triglyceride level molecule of encoding D AGAT, especially the method for the triglyceride level molecule in the seed oil of vegetable oil material seed crop.Vegetable cell with triglyceride level of modification like this also is included in the present invention.

The present invention also comprises plant, seed and the oil of the modification that is obtained by plant LPAAT protein expression of the present invention.

Detailed Description Of The Invention:

Diacrylglycerol acyl transferase of the present invention (DAGAT) comprises any aminoacid sequence that derives from the cell source; as protein, polypeptide or peptide; it has under the enzyme reaction condition from 1, the ability that 2-diacylglycerol-3-phosphoric acid and acyl-CoA substrate catalysis triacylglycerol produce." enzyme reaction condition " is the necessary environment condition (that is: as temperature, pH, factors such as inhibition disappearance) of instigating enzyme performance function.

" dissolving " is meant from film and extracts the DAGAT enzyme, and it is not then being that the typical way of film involved enzyme works.Because film effectively is connected DAGAT albumen with the protein that other also wherein exists, as described in the following Examples, dissolving is to differentiate and the proteic essential requirement of purifying DAGAT.In the active solubility test of DAGAT, be taken into account as the different indications of three kinds of dissolved that in following examples, are described in further detail.

1) the DAGAT activity is not through very high speed centrifugation is settled.

2) the DAGAT activity is moved on the size exclusion chromatography post, and it has the typical natural molecule amount that is not the film involved enzyme seemingly.

3) protein that exists in the DAGAT prepared product is disconnected from each other through the column chromatography part at least.

Because above-mentioned each standard can have different the explanation, need to confirm that three kinds of standards have satisfied entirely to confirm the DAGAT dissolving.For example, first kind of standard promptly can not sedimentation under very high g power, if it is similar to the density of dissolving film not then can be misled to be used for the dissolved solution density, thereby its sedimentation is very slow.This situation is able to illustration in following examples, wherein the dissolving step of only announcing according to this standard illustrates and can not obtain the isolating substantially DAGAT of cytoplasmic membrane.Second kind of standard, wherein slower than original membrane through the lytic activity migration of size-exclusion column, if film self combines with post is faint after being exposed to stain remover, so, can be misled like this through migration is very slow at that time.The third standard, but wherein dissolved protein is chromatographic separation, is the most difficult by illusion or the interference of unexpected situation.But film may partly dissociate through dissolving step, thereby discharges the range protein aggregate.This aggregate is dissociated mutually by chromatography then.Therefore need satisfy all three kinds of standards to guarantee to reach the DAGAT dissolving.

From jojoba, obtained dissolved wax synthase protein matter as can be seen, can further test by substrate specificity, cofactor requirement and possible activity inhibitor at present and identify enzyme.For example, found that jojoba Wax synthase of the present invention has the wide spectrum acyl group substrate that comprises acyl group ACP and acyl-CoA molecule.In addition, acyl group and Fatty Alcohol(C12-C14 and C12-C18) substrate can have the wide region size relevant with carbon chain lengths.For example, all show with the activity of the substrate test that C12～C24 carbon chain lengths is arranged and utilize by enzyme.In addition, having the acyl of various degrees of unsaturation and the activity of Fatty Alcohol(C12-C14 and C12-C18) is shown.

Astoundingly, the jojoba Wax synthase of purifying also illustrates at this has diacylglycerol (DAG) and aliphatic alcohol substrate activity to produce triacylglycerol (TAG), is not present in the jojoba plant tissue although report TAG.Like this, Wax synthase has two kinds of acyltransferase activities at least, and the receptor substrate of one acyl-CoA molecule is an alcohol (Fatty Alcohol(C12-C14 and C12-C18) acyltransferase), and another kind of receptor substrate is diacylglycerol (a DAG acyltransferase, or DAGAT).DAGAT albumen is closely related in the active existence prompting wax synthase protein of Wax synthase DAGAT and other plant species.

Being dissolved in following examples of mortierella DAGAT set forth.The dissolving of DAGAT confirms through above-mentioned every kind of dissolving standard.

The dissolving prepared product of mortierella DAGAT is used for various chromatography experiments to differentiate and partial purification DAGAT albumen.In this mode, the protein with about 40kDa molecular weight is accredited as active relevant with DAGAT.As elaboration more detailed in following examples, the protein of 40kDa is through yellow 86-agarose and hydroxylapatite column chromatography and partial purification.Obtain the protein of purified form basically through gel electrophoresis and with partially purified DAGAT prepared product trace to nitrocellulose then.On the cutting nitrocellulose filter, contain the partially recycled 40kDa protein of differentiating band.

Then the protein of purifying is used for determining the peptide of aminoacid sequence with generation with various enzymic digestions.

Like this, the proteinic pancreatin peptide of 40kDa described herein is represented the part of mortierella ramanniana DAGAT.Other mortierella DAGAT peptide can similar acquisition and aminoacid sequence determined.

Using the aminoacid sequence of DAGAT peptide sets forth at this with the nucleotide sequence that obtains encoding D AGAT.For example, preparation is corresponding to the synthetic oligonucleotide of DAGAT peptide sequence, and this oligonucleotide is used as primer to obtain the partial dna sequence of DAGAT gene in round pcr.The partial sequence that will so obtain is cloned to obtain DAGAT from preparation from the gene library of mortierella ramanniana tissue as probe then.Perhaps, the oligonucleotide of low degeneracy can prepare from specific DAGAT peptide, and this probe can be used for the DAGAT gene order in the direct screening-gene library.Distinguishingly, so because the lower cDNA library screening that in this method, can use in phage vector of background hybridization level.

The nucleotide sequence of DAGAT of the present invention can be derived from genomic dna, cDNA, the DNA of mRNA or RNA sequence, or all or part of synthetic.This gene order can be cloned, as through isolation of genomic DNA from appropriate sources, and with pcr amplification and clone interested sequence.Perhaps, gene order can be synthesized, and whole or partial synthesis is especially in the time need providing the sequence of plant optimization.Like this, all or part of desired structure gene (the proteic that part of gene of encoding D AGAT) the preferred codon of available selected host is synthetic.The preferred codon of host can be by determining as codon the most frequently used from expressed protein required host species.

Those skilled in the art will be easy to recognize that antibody preparations, nucleic acid probe (DNA and RNA) can be produced, and be used for from various plant origin screenings and recovery " homologous " or " being correlated with " DAGAT.Can find homologous sequence when consensus sequence, it can be detected at contrast sequence information (nucleic acid or amino acid) or on by the hybridization basis between known DAGAT and candidate source.As Glu/Asp, Val/Ile, Ser/Thr, the conservative variation of Arg/Lys and Gln/Asn also is considered in detecting sequence homology.The aminoacid sequence that at least 25% sequence is identical between two complete mature proteins is considered to homologous.(see Doolittle, R/F., OFURFS and ORFS (University Science Books.CA.1986.)

Like this, from the mortierella protein prepared product of concrete illustration provided herein and sequence, can obtain other DAGAT.Further, clearly can obtain natural and synthetic DAGAT, comprise DAGAT and the aminoacid sequence of the modification of the DAGAT mimic through getting and the parent material of synthetic proteins with this illustration sequence by illustration.The aminoacid sequence of modifying comprises by sudden change, brachymemma, the sequence that increases etc., no matter whether this sequence is part or all of synthetic.Real purifying is from the plant prepared product or be equal to it or the sequence of coding same protein, no matter the method that is used to obtain protein or sequence how, all thinks natural deutero-.

Typically, derive from the DAGAT sequence of using nucleic acid probe and be illustrated in target DAGAT sequence with identical as 60-70% sequence between the encoding sequence of probe.But also can obtain few long sequence to 50-60% sequence homogeny.Nucleic acid probe can be the long segment of nucleotide sequence, maybe can be short oligonucleotide probe.When the nucleic acid fragment than length, can screen under the severity to obtain to have with the sequence that is used as probe the sequence (being the 50-80% sequence homology) of 20-50% deviation from the target sample than hanging down when (surpassing about 100bp) as probe.The whole nucleotide sequence of the comparable encoding D AGAT enzyme of oligonucleotide probe is short a lot, but should there be about 10 at least, preferably at least 15, more preferably about 20 Nucleotide, when using the short zone opposite with long zone, the sequence homogeny of height is required.Need like this to differentiate that the zone of high conserved amino acid sequence is to be designed for the oligonucleotide probe that detects and reclaim other relevant DAGAT gene.Shorter probe is the specific PCR that is used for often, especially when high conserved sequence can be differentiated (seeing Gould, et al., PNAS USA (1989) 86:1934-1938).

Except that separating other DAGAT, the sequence information of the gene of the acyl transferase proteins that other is relevant through using DAGAT and associated nucleic acid sequences also can obtain.For example other comprises plastid DAGAT, plastosome DAGAT, lysolecithin acyltransferase (LPCAT), hemolytic phosphatidylserine acyltransferase (LPSAT), lysophosphatidyl ethanolamine acyltransferase (LPEAT).And in the acyltransferase involved in plant lipid biosynthesizing of hemolytic phosphatidyl inositol acyltransferase (LPIAT).These enzymes all catalysis relate to the acyltransferase reaction of the sn-2 position of lysophospholipid, and the gene of these sequences of encoding is also relevant with plant acyl-CoA DAGAT sequence of the present invention, and can therefrom obtain.As shown here like this, other relevant acyltransferase comprises the aliphatic alcohol from jojoba: Fatty Alcohol(C12-C14 and C12-C18) 0-acyltransferase (Wax synthase) may be relevant with Diacrylglycerol acyl transferase.

DAGAT and Wax synthase are the information that obtains via purifying DAGAT from oil-containing fungi mortierella ramanniana species of this fact of member of homologous protein family and support (seeing embodiment).At first, as the jojoba Wax synthase, fungi DAGAT activity is membrane-bound, and only can be dissolved by using stain remover.Secondly, equally with the jojoba Wax synthase phosphatide (as phosphatidic acid) need comprised in analysis of mixtures after the dissolving, to recover the enzymic activity of fungi DAGAT.The 3rd, fungi DAGAT shows during the purifying chromatography and is very similar to the jojoba Wax synthase.Particularly, these two kinds of enzymes are through the only slight retardance of hydroxyapatite column washing, and other protein in the membrane prepare thing of great majority combines (seeing embodiment) with base for post matter.In fact, the advance notice of the experience of jojoba enzyme, hydroxyapatite is the committed step of purifying DAGAT from mortierella ramanniana.It is essential that the increase of this step turns out to be fungi DAGAT success purifying institute, and infer that the scheme of Kamisaka etc. (1997) is not enough to differentiate the active relevant correct protein with DAGAT.At last, identical (the seeing embodiment) of the apparent molecular weight (33kDa) of the fungi DAGAT polypeptide that detects by SDS-PAGE and the jojoba Wax synthase that observes by SDS-PAGE.

Whether genes involved can separate with hybridizing with given sequence in order to detect, and flag sequence is typically to detect also available other method with radioactivity.The probe of mark is added in the hybridization solution, and with the filter membrane that contains required nucleic acid such as Northern or Southern trace, or with the filter membrane incubation that contains cDNA to be screened or genomic clone.Hybridization and washing condition can change to optimize the hybridization of probe and corresponding sequence.Lesser temps and higher salt concentrations make the relevant sequence hybridization of farther edge (low severity).If background hybridization is a problem under low stringency, can improves temperature and/or reduce salt concn in hybridization or rinse step to improve the detection of specific hybridization sequence.Hybridization and flushing temperature can be based on being adjusted as the estimation melting temperature(Tm) of (Methods in Enzymology (1983) 100:266-285) described probes such as Beltz.Useful probe and suitable hybridization and washing condition are used flag sequence screening cDNA or genomic library as above-mentioned the evaluation, and optimal conditions.

Be immunoscreening, the proteinic antibody of anti-coconut DAGAT can prepare through give rabbit or mouse injection with protein purification, and the method that so prepares antibody is well-known in the art.No matter mono-clonal or polyclonal antibody all can produce, although typically polyclonal antibody is more effective to gene isolation.Can carry out Western and analyze determining that associated protein is present in the crude extract of required plant species, by determining with the cross reaction of the antibody of anti-coconut DAGAT.When observing cross reactivity, the gene of coding related protein is through the expression library of the required plant species of screening representative and separated.Expression library can be implemented in various commercially available carriers and comprise as (Moleaular cloning:A Laboratory Manual among the described λ gtll such as Maniatis, SecondEdition (1989) Cold Spring Harbor Laboratory, Cold Spring Harbor, NewYork).

All plants all utilize DAGAT to produce membrane phospholipid, and any like this plant species all can be considered to the additional proteic source of DAGAT.The plant optimization that has significant medium chain fatty acid in its seed oil is as the material standed for of the plant DAGAT of the sn-2 position that obtains medium chain fatty acid to be mixed TAG.Some species of sepal distance flower spp gather the triglyceride level that contains medium chain fatty acid in its seed, as putting down the calyx that crouches apart from flower, lutea, hookeriana, hyssopifolia, wrightii and inflata.The natural phant source of another kind of medium chain fatty acid is the seed of Lauraceae.Except that the California Bay (Umbellularia californica) of illustration, Pisa (Actinodophnehookeri), Sweet Bay (Laurus nobilis) and Cinnamomum camphora (camphor) also gather medium chain fatty acid.Other plant origin comprises Ulmaceae (elm), Palmae, Myristicaceae, Simarubaceae, Vochysiaceae, and salvadoraceae.

Also interested especially is the DAGAT that mixes the plant species of very long longer chain fatty acid in storage TAG.For example, Nasturtium officinale platymiscium and meadowfoam contain 22: 1 acyl groups in seed TAG, and meadowfoam has illustrated and contains and 22: 1 (sinapinic acid) fatty acyl groups can be mixed the DAGAT of sn-2 position.Have this active DAGAT and find to can be used in the production that " three-sinapinic acid " mustard belongs to oil, its at present undiscovered be owing to belong to as the mustard of 18: 1 and 18: 2 towards unsaturated fatty acids due to the selectivity of seed DAGAT.

The plant DAGAT that also should point out various sources can be used to research in various bodies, use in the biosynthetic TAG biosynthesizing of vegetable lipid incident.Because all plants all are through the synthetic lipid of common pathways metabolism, to a kind of plant DAGAT to the research of allos plant host and/or be applied in the various species and can be reached easily.In other was used, plant DAGAT can be used to outside the natural phant source of DAGAT, to increase output and/or to modify external generation or the composition of synthetic TAG.

The nucleotide sequence relevant with plant DAGAT albumen has many use with discovery.For example, can prepare the recombination to construct thing as probe, or be provided at the proteic expression of DAGAT in the host cell with stable source that produces enzyme and/or the composition of modifying the triglyceride level of wherein finding.When host cell is plant host cell, no matter in the body or externally all can find other effective application.For example, be applicable to by raising and the amount of the preferred DAGAT of corresponding medium chain of plant TAG biosynthetic pathway can in TAG, obtain the medium chain fatty acid that percentage increases.In a similar fashion, measure through the DAGAT that antisense technology is reduced in endogenous expression in the vegetable cell for some application need.For example, provide more multimachine meeting, can need natural mustard to belong to the low expression of the preferred DAGAT of long-chain for the external source DAGAT that makes insertion is transferred to the sn-2 position with medium chain or very long long-chain fatty acyl group.

According to the application of planning, construct can contain the complete DAGAT albumen of coding or its a part of sequence like this.For example, when the proteic Antisense Suppression of needs DAGAT, do not need complete DAGAT sequence.Further, when plan was used as probe with the DAGAT construct, advantageously preparation only contained DAGAT encoding sequence one specific part, guarded the construct of the sequence in DAGAT district as finding the coding height.

As mentioned above, the nucleotide sequence of code book invention plant DAGAT can comprise genome, cDNA or mRNA sequence." coding " is no matter mean in justice or antisense orientation are arranged all sequence corresponding to the specific amino acids sequence." karyomit(e) is outer " is meant that sequence is outside natural relevant Plant Genome." reorganization " is meant that sequence contains through genetically engineered modifications of operation such as mutagenesis, Restriction Enzymes.

The cDNA sequence can contain or not contain the sequence before the processing, send certain position of passing organoid or film as transit peptides or targeting sequence to promote DAGAT albumen (as plastosome DAGAT).So the application of precursor DAGAT dna sequence dna is preferred in the vegetable cell expression, genome DAGAT sequence can contain transcribing of plant DAGAT and translation initiation district, intron, and/or transcription termination region, these sequences can with or be not used from the various DNA construct with DAGAT structure gene one.Like this, also provide corresponding to the nucleotide sequence of plant DAGAT of the present invention and to be used to instructing protein to send and to pass the signal sequence at certain position of specific cells device or film, non-coding and regulating district, 5 ' upstream (promotor) with effective tissue and timing distribution plan, as transcribing and translate 3 ' the non-coding and regulating district of regulatory region, and can be the further feature of seeing clearly this gene and offer help.

In case obtain required plant DAGAT nucleotide sequence, it can applicable in various ways.When sequence comprised non-coding flanking region, its flanking region can excise, mutagenesis etc.Can change the sequence of natural generation like this, transversion, disappearance and insertion.In addition, can synthesize all or part sequence.In structure gene, can modify one or more codons so that the aminoacid sequence of modification to be provided, import one or more codon mutations with provide suitable restriction site or with make up or express other relevant purpose.Structure gene can be through using synthetic adapter, importing the joint of one or more restriction sites easily and further modify.

Nucleotide sequence or the aminoacid sequence of code book invention plant DAGAT can make up in every way with other non-natural or " allos " sequence." allos " sequence means some non-naturals and finds the sequence that is connected with plant DAGAT, comprises the combination as not being the nucleotide sequence of the identical plant that links together of natural discovery.

The dna sequence dna of code book invention plant DAGAT can with the normal relevant all or part of gene order combined utilization of DAGAT.In its integral part, the dna sequence dna of encoding D AGAT is combined in the DNA construct, it has at 5 ' to 3 ' transcriptional orientation can start the transcription initiation control region of transcribing in the host cell and translating, the dna sequence dna of coded plant DAGAT and transcribing and the translation termination district.

The potential host cell comprise protokaryon and eukaryotic cell the two.According to application target, host cell can be single celled or find at many cells differentiation or the intravital cell of undifferentiated biology.Cell of the present invention can be through having the plant DAGAT of wild-type cell external source, as the recombinant nucleic acid construct with coded plant DAGAT is distinguished.

According to the host, comprise that the regulatory region from the zone of virus, plasmid or chromogene can change.For at eucaryon or prokaryotic micro-organisms, especially express in the unicellular host, various composing types can be used and maybe promotor can be regulated.In microorganism, express the facility source that plant enzyme can be provided.Be to comprise as beta-galactosidase enzymes in the transcription initiation region of having described, T7 polysaccharase, tryptophane E be isogenic to come E.coli freely, subtilis, the zone of bacterium such as Saccharomyces cerevisiae and yeast host.

Most of construct is included in the regulatory region that function is arranged in the plant and produces with the modification that plant DAGAT is provided, and may the modified fatty acid composition.The open reading frame of coded plant DAGAT or its function fragment will be connected with the transcription initiation regulatory region at its 5 ' end.In plant host, express in the proteinic embodiment of DAGAT at needs, need to use all or part of complete plant DAGAT gene; Coding region, just all or part of 5 ' upstream (promotor) and structural gene sequence and 3 ' downstream non-coding region are used together.

Different if desired promotors, as corresponding to the natural promoter of plant host interested or the promotor of modification, promptly have derived from the transcription initiation region of a gene source with derived from the translation initiation district in another different genes source, can obtain manyly provides various composing types maybe can regulate the transcription initiation region of transcribing as derivable structure gene function.Find to be close to 5 ' upstream of initiator codon separately corresponding to the transcribing of structure gene like this/translation initiation district.The transcription initiation region that is used for plant is the zone relevant with T-DNA structure gene, as for nopaline and mannopine synthase, and the 19S of CaMV and 35S promoter, and other plant gene such as napin, ACP, SSU, PG, Zein, the 5 ' upstream of phaseolin E etc.The promotor of strengthening such as two 35S also can be the DAGAT sequence and express used.Deriving from the application of other gene of during seed maturity, regulating when 5 ' upstream non-coding region, needing those in the plant embryos tissue, preferentially to express, as ACP and napin deutero-transcription initiation control region.According to U. S. application 07/147,781, the applying date 1/25/88 (existing U. S. application 07/550,804, the applying date 7/9/90), and U. S. application 07/494,722, the applying date is or about 1990.3.16 that denomination of invention is the instruction in " preferential new sequence and methods involving thereof of expressing in the seed development in early days ", can obtain and use this " seed specific promoters ".The transcription initiation region of preferred expression in seed tissue, promptly in the plant other parts undetected transcription initiation region be considered to into TAG modify required so that the destruction of gene product or disadvantageous effect are reduced to is minimum.

In DNA construct of the present invention, can provide the adjusting transcription termination region equally.Transcription termination region can encoded plant DAGAT dna sequence dna or derived from the suitable transcription termination region in different genes source as providing with the natural relevant transcription termination region of transcription initiation region.Derive from the transcription termination region in different genes source, it contains at least approximately 0.5kb, and preferred 1-3kb stops 3 ' sequence derived from wherein structure gene.

Have plant DAGAT as corresponding dna sequence dna to improve or to reduce the expression of plants of its expression or transcribe construct and can use with the plant that each kind of plant especially participates in the edible or industrial vegetable oil production.Particularly preferably temperate zone oil grain crop.Corresponding plant includes but not limited to Semen Brassicae campestris (Canola and high sinapinic acid mutation), Sunflower Receptacle, safflower, cotton, soybean, peanut, coconut and oil palm and corn.Method according to recombinant precursor being imported host cell can need other dna sequence dna.Importantly, the present invention can be applicable to dicotyledonous and the unifacial leaf species, and will be easy for new and/or improved conversion and regulation technology.

Particularly interested be the application of plant DAGAT construct in genetically engineered plant in plant seed oils, to produce special fatty acid, the not natural special fatty acid that contains among the TAG of the not through engineering approaches plant seed of through engineering approaches species wherein.Like this, the fatty acyl group that the expression of new DAGAT can conform with uniqueness in the plant mixes the required of sn-3 position.

The further genetically engineered plant application of DAGAT albumen of the present invention comprises that it contains application in the structure plant lipid of the TAG molecule with the needed fatty acyl group that mixes specific position on the TAG molecule in preparation.

The method for transformation that obtains transgenic plant like this is not the present invention's a key, and various methods for plant transformation is blanket.Further, owing to be suitable for by transforming crop than novel method, they also can directly be used later.For example, many plant species to the natural susceptible of agroinfection can effectively transform through the ternary or the binary vector method of agriculture bacillus mediated conversion.In many cases, need make construct be positioned at its one or both sides, especially have a left side and right margin, more preferably right margin by T-DNA.This when construct particularly effective during as transform mode with agrobacterium tumefaciens or Agrobacterium rhizogenes, although the T-DNA border can be found to use with other transform mode.In addition, developed the microinjection that can transform various unifacial leaves and dicotyledons species, dna particle bombardment and electroporation technology.

Usually DNA construct comprises having the essential regulatory region of in host expression and optionally structure gene of transformant is provided.This gene can provide the resistance to cytotoxic agents such as microbiotic, heavy metal, toxin etc., and the prototrophy that provides the auxotroph host, virus immunity etc. are provided.According to the different host species that expression construct or its component are imported into, can use one or more marks, wherein different hosts use different selection conditions.

When Agrobacterium is used for vegetable cell and transforms, can use carrier, its can be imported into the Agrobacterium host with the Agrobacterium host in the T-DNA or Ti-or the Ri-plasmid homologous recombination that exist.The Ti-or the Ri-plasmid that contain the T-DNA that is useful on reorganization can be (can not form mycoceicidum) that (can form mycoceicidum) of tumorigenicity is arranged or do not have tumorigenicity, as long as the vir gene exists the latter to allow in the Agrobacterium host who transforms.There is the plasmid of tumorigenicity that the mixture of normal plants cell and mycoceicidum can be provided.

Be used as in the situation of the carrier that transforms host plant cell some Agrobacteriums, the expression of being defined by the T-DNA frontier district or transcribe construct and will be inserted in the broad range host's that can duplicate in E.coli and Agrobacterium the carrier, this broad range host's carrier sees that document is described.What use usually is the pRK2 or derivatives thereof.As see the Ditta that incorporates reference into, et.al., (Proc.Nat.Acad.Sci., U.S.A (1980) 77:7347-7351) and EPA0120515.Perhaps the sequence insertion of desiring to express in vegetable cell can be contained in the carrier of isolating replication sequence, one makes carrier stable in E.coli, and another makes carrier stable in Agrobacterium.Referring to McBride andSummerfelt (Plant Mol.Biol. (1990) 14:269-276), wherein the stability that provides plant expression vector to increase in host's agrobatcerium cell is provided pRiHRI replication orgin (Jouanin et al., Mol.Gen.Genet. (1985) 201:370-374).

Being contained in expression construct and the T-DNA is one or more marks, the selection of Agrobacterium that it is used to transform and plant transformed cell.Many marks have been developed and have been used for vegetable cell, as to paraxin, kantlex, aminoglycoside G418, the resistance of Totomycin etc.The non-key of using of the present invention of specific markers, can preferred one or another mark according to specific host and building mode.

For using the Agrobacterium-mediated Transformation vegetable cell, explant can merge the enough time of incubation to transform with the Agrobacterium that transforms, and bacterium is killed, and vegetable cell is cultivated in the appropriate selection substratum.In case the formation callus promotes branch to form according to currently known methods by using suitable plant hormone, and branch is transferred to root media with aftergrowth.Then this plant culturing knot is planted, and seed is used to duplicate offspring and and separating plant oil.

So far the present invention has been done general elaboration, will be easier to understand the present invention through following examples, embodiment just illustrates and unrestricted the present invention.

Embodiment 1-Wax synthase is analyzed

The following stated is for analyzing the active method of Wax synthase in microsomal membrane prepared product or dissolved protein prepared product.

A. radio-labeled material

Be generally used for the substrate [1-that Wax synthase is analyzed ¹⁴C] palmitoyl coenzyme A available from Amersham (Arlington Heights, IL).Other chain length substrate is that synthetic is to carry out the chain length The specificity.By [ ¹⁴C] reaction of potassium cyanide and correspondent alcohol methylsulfonyl ester, with after pure nitrile basic hydrolysis becomes free fatty acids to prepare long-chain [1- ¹⁴C] lipid acid (specific activity 51-56 Ci/mole), promptly 11-is along eicosenoic acid, and 13-is suitable-and Decosahedaenoic acid and 15-be suitable-tetracosenoic acid.Change free fatty acids into its methyl esters with ether diazomethane, and through preparation Silver Nitrate thin-layer chromatography (TLC) purifying.Be hydrolyzed to free fatty acids behind this fatty acid methyl ester.Radiological chemistry product purity is estimated through three kinds of TLC methods: standard aerosil TLC, Silver Nitrate TLC, and the anti-phase TLC of C18.The radiological chemistry product purity of being measured by these methods is 92-98%.With the method (J.Bio.Chem (1969) 244:377) of Young and Lynen from corresponding [1- ¹⁴C] free fatty acids prepares the long-chain [1-that specific activity is 10Ci/mole ¹⁴C] acyl-CoA.Trace according to Pletcher and Tate method is modified method (Tet.Lett. (1978) 1601-1602), through [1- ¹⁴C] the dichromate oxidation preparation [1-of 16-1-alcohol ¹⁴C] strawberry aldehyde.Through preparation silicon-dioxide TLC purified product, and store to using with hexane solution at-70 ℃.

B. Wax synthase activation analysis in the microsomal membrane prepared product

The Wax synthase activity is through with 40 μ M[1-in the microsomal membrane prepared product ¹⁴C] acyl-CoA (being generally palmitoyl coenzyme A, than 5.1-5.6mCi/mmol alive) and 200mM oleyl alcohol and sample to be analyzed measure with cumulative volume 0.25ml incubation.This incubation mixture also contains 25mM HEPES (4-[2-hydroxyethyl]-1-piperazine ethane sulfonic acid), pH7.5, with 20%w/v glycerine, 1mMDTT, 0.5M NaCl is as buffer reagent, or contain 25mM Tricine-NaOH, and pH7.8 and 0.28M NaCl, 10% glycerine and 2mM beta-mercaptoethanol are as buffer reagent.When pH selected to adapt to adjusting acyl-CoA reductase enzyme, initial research was carried out with first buffer system.After a while with the membrane prepare thing with second kind of buffer system conversion to be fit to the higher pH of Wax synthase.

In vial, prepare substrate mixture, before being about to use, add oleyl alcohol, and add in the sample.Carried out incubation nearly one hour at 30 ℃.Analyzer tube placed on ice and add the 0.25ml Virahol immediately: acetate (4: 1v/v) and termination analysis.Add unlabelled wax ester (0.1mg) and oleyl alcohol (0.1mg) as carrier.Through the reduction scheme (Anal.Biochem. (1978) 90:420) of Hara and Radin extract [ ¹⁴C] fat.With the 2ml hexane/isopropyl alcohol (3: 2, v/v) add during terminated analyzes.With the sample vortex, and add 1ml aqueous sodium persulfate solution (6.6%w/v), and with sample vortex again.

C. dissolved Wax synthase activation analysis

The analysis of dissolved Wax synthase is to use nearly 50 μ l samples to contain 40 μ M 1-at 250 μ l ¹⁴C-16:0 coenzyme A (5Ci/mol), 200 μ M 18:1-OH, 0.07% soybean phospholipid (Sigma, P-3644), 0.2%CHAPS, 280mM NaCl, 25mM Tricine-NaOH, pH7.8 carries out in the analytic liquid of 2mM β-ME and 5.6% glycerine.Phosphatide (50mg/ml is in 0.5%CHAPS) directly is added in the sample among the 1%CHAPS, then through containing the mixture diluted of residual analysis component.Mix at Wax synthase infer on the basis of phospholipid carrier rebuild active.Wax synthase is to the stain remover sensitivity, and (CHAPS/PL is W/W) so that active maximum to require the amount of phosphatide (PL) and stain remover (CHAPS) to be equilibrated at 2.8/1 in analysis.The Wax synthase activation analysis is owing to the concentration of CHAPS needs the volume of correction analysis sample again in the sample of ultrafiltration and concentration.In analysis, import too many CHAPS and cause active inhibition.If sample concentrates through ultrafiltration, the optimal volume of analyzed sample can be through carrying out the concentration curve of %CHAPS in analysis with small amount of sample, and analyze and establish at the phosphatide and the NaCl of fixed concentration.Wax synthase is low to the susceptibility of PL change in concentration comparison CHAPS change in concentration.

D. the analysis of assay products

For analyzing the product that microsomal membrane prepared product Wax synthase is analyzed or the dissolved Wax synthase is analyzed, two kinds of schemes have been developed.One, following is more time-consuming for " in-depth analysis ", but produces more quantitative results.Another is following also to provide Wax synthase active mensuration for " real-time analysis ", but rapider, more convenient but quantitatively property is relatively poor.

1. analyse in depth:, shift out upper organic phase also with 4ml hexane/isopropyl alcohol (7: 2v/v) wash a layer water at adding sodium sulfate and after with the sample vortex.Organic phase is merged and under nitrogen, be evaporated to drying.With lipid resistates resuspending in the small volume hexane, and analyze the radioactivity of equal portions through liquid flashing counting.The TLC that remaining sample can be used for marking class analyzes, thereby the measured value of total wax of generation is provided.

Be lipid analysis, sample administration in silicon-dioxide TLC flat board, and is launched this flat board in hexane/diethyl ether/formic acid (80: 20: 1 or 70: 30: 2 v/v/v).(AMBIS Systems Inc., San Diego CA) measure lipid, mainly are wax esters, free fatty acids, radioactive distribution between Fatty Alcohol(C12-C14 and C12-C18) and the polarity fat with AMBIS radiometric analysis visualization system.If desired, can reclaim independent lipid from the TLC flat board further analyzes.Use anti-phase TLC system of unfolded C18 flat board in methyl alcohol also has been used for this analysis.

2, real-time analysis: at adding sodium sulfate and after, shift out the organic phase of known percentage, and count through liquid scintillation counter with the sample vortex.This calculation result is used for estimating the organic phase grand total.Shift out organic phase another part then, drying in nitrogen is dissolved in hexane again and point drops on the TLC flat board, launches, and analyzes as previously discussed and scans.In this mode, can detect the percentage that mixes the grand total in the wax.

Embodiment 2: the further research of Wax synthase activity identification

A. seed development and Wax synthase activity curve

At Davis, CA, fetal development in tracking investigation 5 plants in two summers.Fresh weight and the dry weight of finding the embryo improve from about 80 days to 130 days with the quite stable ratio.When embryo's fresh weight reaches about 300mg (about 80 days), extract lipid and present that fat is heavy to reach 50% highest level with ratio dry weight.

As described in embodiment 1B, in the embryo who grows, measure the Wax synthase activity.Because jojoba seed tunicle determined it is the source of supressor, thus in liquid nitrogen frozen embryo before-70 ℃ of storages, to remove the seed tunicle.

The active growth curve of Wax synthase is measured in acellular homogenate or membrane component, shows at about 110～115 days induced activitys in back of blooming the highest.The embryo who carries out enzymology gathers in the crops between about 90～110 days after blooming, and this stage Wax synthase activity is higher, and lipid deposition does not reach highest level, and the seed tunicle is easy to remove.Visible Wax synthase activity increases between the back 80～90 days of blooming rapid rate.The embryo who is used for the cDNA library construction is results between the back 80～80 days of blooming when the synthase speed of wax synthase protein matter may be the fastest.Correspondingly, the phase may be the highest at this moment for the level of the mRNA of coding Wax synthase.

B. microsomal membrane prepared product

Back about 90～110 days results jojoba embryo of blooming, survey embryo's water-content (45～70%).Remove decapsidate and seed tunicle, in liquid nitrogen rapid freezing cotyledon and-70 ℃ of storages to further using.For the initiation protein preparation, freezing cotyledon is smashed to pieces and powdered in liquid nitrogen temperature in Steel Mortar and pestle.In a model experiment, processing 70g embryo.

The ratio of powder with every 70g embryo 280ml solution added in the following high level salt solution: 3MNaCl, 0.3M sucrose, 100mM HEPES, 2mM DTT, and proteinase inhibitor, 1mMEDTA, 0.7mg/ml leupeptin, 0.5mg/ml pepstatin and 17mg/mlPMSF.The powder embryo is used tissue refiner (Kinematica, Switzerland; Model PT 10/35) in damping fluid, disperseed about 30 seconds and form acellular homogenate (CFH), then through the Miracloth three layer filtration (CalBioChem, La Jolla, CA.).With filtrate with 100, centrifugal 1 hour of 000xg.

The gained sample is made up of granular precipitation, supernatant liquor and floating lipid layer.Remove lipid layer and collect the supernatant liquor component, with containing 1M NaCl, 100mM HEPES, the damping fluid of 2mM DTT and 0.5MEDTA dialyse a night (changing damping fluid three times).With 200, centrifugal 1.5 hours of 000xg is to produce granular sludge, DP2 with dialyzate.This granular precipitation is suspended in 25mM HEPES and 10% glycerine with 1/20 initial CFH volume, to produce the microsomal membrane prepared product.

As described in embodiment 1, analyze activity.The Wax synthase activity returns to 34% of initial activity in acellular homogenate.The Wax synthase activity is stable when storing with-70 ℃ in this prepared product.

C. substrate specificity

The acyl-CoA and the pure substrate that will have different carbon chain lengths and degree of unsaturation add in the microsomal membrane prepared product of preparation as mentioned above; to detect substrate scope by the identification of jojoba Wax synthase; as survey Wax synthase activity as described in the embodiment 1B, survey the acyl group specificity with 80mM acyl-CoA substrate and the radiolabeled oleyl alcohol of 100mM.Survey pure specificity with 100mM alcohol substrate and the radiolabeled eicosylene acyl coenzyme of 40mM A.These experimental results are shown in following table 1.

Table 1

Acyl group and pure substrate specificity

Substrate Wax synthase activity (pmoles/min)

Structure carboxyl groups alcohol radical

12：0?????????????????????12??????????????????????100

14：0?????????????????????95??????????????????????145

16：0?????????????????????81??????????????????????107

18：0?????????????????????51??????????????????????56

20：0?????????????????????49??????????????????????21

22：0?????????????????????46??????????????????????17

18：1?????????????????????22??????????????????????110

18：2?????????????????????7???????????????????????123

20：1?????????????????????122?????????????????????72

22：1?????????????????????39??????????????????????41

24：1?????????????????????35??????????????????????24

The above results shows that the jojoba Wax synthase can utilize numerous aliphatic alcohols and Fatty Alcohol(C12-C14 and C12-C18) substrate.

In addition, the Wax synthase activity of various acyl group thioesters substrates is used as the palmitoyl coenzyme A of acyl group substrate, palmityl ACP and N-acetyl-S-palmityl cysteamine test observes maximum activity with the acyl-CoA substrate.With acyl group ACP observe tangible activity (for acyl-CoA 10%), and do not detect activity with N-acetyl-S-palmityl cysteamine substrate.

D. active effector

According to Wax synthase active influence screen various sulfydryl preparations.It is active that organomercury compound illustrates obvious inhibition.Iodo-acid amide and N-ethyl maleinamide effect are relatively poor.Observe inhibition, but this inhibition can reverse through adding DTT subsequently to hydroxyl mercury benzoic ether.These results show that the inhibition to hydroxyl mercury benzoic ether relates to the sealing to the mercapto groups of key.

The purifying of embodiment 3:jojoba Wax synthase

The following stated be the active dissolving of separation, Wax synthase that is used to have the active jojoba membrane prepare of Wax synthase thing, and the method that is further purified of wax synthase protein matter.

A. microsomal membrane prepared product

Application Example 2 described methods are through the method for the following modification improvement membrane component with the Wax synthase that is provided for purifying from the dissolved film.

Typically, 100g jojoba embryo is added 400ml extract in the damping fluid (40mMTricine-NaOH, pH7.8,200mM KCl, 10mM EDTA, 5mM beta-mercaptoethanol), in stamp mill, grind, and with the machine homogenate of Polytron disorganization.Carry out all following steps at 4 ℃.Stamping is filtered through Miracloth (CalBioChem).With 20,000xg, the 20min centrifugal filtrate produces floating wax layer, muddy supernatant liquor and the granular precipitation of blackish green.Collect supernatant component and centrifugal (100,000xg, 2h) to obtain peplomer shape precipitation, then with its resuspending in the 40ml buffer A (25mM Tricine-NaOH, the pH7.8 that contain 50% (w/v) sucrose, 200mM KCl, 5mM EDTA, the 5mM beta-mercaptoethanol) in, this homogenate divides to 4 SW28 centrifuge tubes (Beckman), each effective 10ml contains the buffer A of 20% sucrose, covers with the 13ml buffer A then.Centrifugal back (28,000rpm, 2h), collection membrane component from 20%/50% sucrose interface, with 4 volume buffer A dilutions, and through centrifugal (200,000xg, 1h) collect, then film is preserved damping fluid [25mMTricine-NaOH, pH7.8,1M NaCl at 10ml, 10% (w/v) glycerine, the 5mM beta-mercaptoethanol)] middle homogenate.Through the protein concn of the film of this scheme preparation typically between 7-9mg/ml.As Bradford, 1976 describedly make the protein standard with BSA and estimate protein concn.

B. the dissolving of wax synthase protein

With storage damping fluid (25mM Tricine-NaOH, pH7.8,1M NaCl, 10% glycerine, 5mM beta-mercaptoethanol) dilution, film suspension is adjusted to about 0.83mg protein/ml.Adding solid 3-([3-courage acyl aminopropyl]-dimethylammonium)-1-propanesulfonic acid (CHAPS), to make final concentration be that 2% (w/v) and stain remover and protein rate are 24: 1.At incubation on ice after 1 hour, centrifugal (200,000xg 1h), and collects the supernatant liquor component with sample.

C. the active purifying of Wax synthase

With this 200,000g supernatant liquor component dilution (using 0.57%CHAPS, 25mMTricine-NaOH, pH7.8,20% glycerine) is so that NaCl and CHAPS final concentration are respectively 0.3M and 1%.(Beverly MA) goes up sample in the post for Amicon, Ine. using buffer B (25mM Tricine-NaOH, pH7.8,1%CHAPS, 20% glycerine) the equilibrated BlueA-agarose that contains 0.3M NaCl with sample.After washing, close the vinegar activity with the buffer B wash-out wax that contains 2M NaCl with level pad.The active ingredient of wash-out from the BlueA post merged (BluePool) and be used for further chromatography.

The band that has two kinds of purification scheme to be used for wax synthase protein is differentiated and is further purified.In scheme 1 (Fig. 1), with Blue Pool be furnished with the YM30 film (Amicon, Inc., Beverly, in pressurized vessel MA) through 5.4 times of ultrafiltration and concentration.Half of enriched material added to equilibrated pottery hydroxylapatite (CHT) post (Bio-Scale CHT-2 in the buffer B that contains 2M NaCl; Bio-Rad, Hercules, CA).Level pad with 6 column volumes is washed post, and with the buffer B elution of bound albumen that contains 0.1M dipotassium hydrogen phosphate and 2M NaCl.After the reequilibrate of CHT post, with second half Blue Pool enriched material chromatography in the same manner.Be detection of active, according to the program analysis Wax synthase of the sample that is used for ultrafiltration and concentration.The Wax synthase activity of measuring in CHT-Run1 is found in flowing through liquid and washings.The proteinic curve of two CHT is identical, thereby CHT-Run2 no longer analyzes.The active ingredient of two CHT-Run is merged and concentrated 10 times, and add to equilibrated SephacrylS100HR post (2.5 * 90cm) in containing the buffer B of 1.0MNaCl.Carry out protein and active the detection, and from the chromatography retained part, select the minimum active ingredient of active maximum protein.S100 pool (group branch 64-70) is added to equilibrated xln hydroxylapatite (HA) post (Bio-Gel HT in the buffer B that contains 1M NaCl; Bio-Rad, Hercules, CA, 1 * 19.3cm).The same active major portion of Wax synthase is in flow through liquid and washing fluid.With the buffer B elution of bound albumen that contains 0.1M potassium primary phosphate and 1M NaCl.Check the component of whole HA post through SDS-DAGE.On SDS-PAGE with the single protein of 33kD migration and Wax synthase active exist relevant.

(scheme 2 Fig. 2), directly adds to equilibrated crystallization hydroxylapatite (HA) post (1 * 11.7cm) in containing 1M NaCl damping fluid with Blue Pool without concentrating in second kind prepares.Select two kinds of components to use 25mM Tricine-NaOH, pH7.8,1M NaCl, 1%CHAPS, 20% glycerine, 1M NaCl equilibrated Superdex 75HR 10/30 post (B-Rad, Hercles, CA; Magnitude range: 5000～75000D) upward are further purified through size exclusion chromatography.Survey the Wax synthase activity according to the described scheme that is used for the dissolved sample of embodiment 1C.Than wash-out (component 31) morning, another kind is wash-out (component 67) when flushing when flowing through the HA post for a kind of component.Analyze the protein curve difference of two kinds of components based on SDS-PAGE.Check this two Superdex75 through gradient SDS-PAGE, approximately the protein of 33kD is differentiated that chromatography has activity.The molecular weight standard that is used in chromatography under same buffer and the column condition produces calibration curve.Contrast peak value Wax synthase active elution volume typical curve therewith draws the 48kDa molecular weight of dissolved enzyme.

The table (table 2) of representative scheme 1 Wax synthase purifying illustrates 150 times of purifying of enzyme from the dissolved protein component.

The purifying of table 2 jojoba Wax synthase

Purification step	Enzymic activity (nmol/ branch)	Productive rate %	Protein (mg)	Specific activity (the nmol/ branch/mg)	Purifying (doubly)
						The dissolved component	???274.4	?100	?415	??0.7	??1
Blue A agarose	???214.7	?78.2	?15	??14.3	??22
						The pottery hydroxylapatite	???176.6	?64.3	?6.4	??27.6	??42
Sephacryl S-100	???41.3	?15.1	?1.2	??33.1	??50
						Hydroxylapatite (crystallization)	???18.8	?6.9	?0.2	??99.2	??150

D.SDS-DAGE analyzes

To take from sample dilution in SDS-PAGE sample buffer (1 * damping fluid=2%SDS, the ashamed pure 0.0025% bromine phenol Blue of 250mM β-sulfydryl) of post component, and through electrophoretic analysis.Make some as Delepelaire (Proc.Nat.Acad.Sci. (1979) 76:111-115) according to the method (Nature (1970) 227:680-685) of Laemmli revises and carries out polyacrylamide gradient gel electrophoresis (10-13%) in addition.Sodium lauryl sulphate is used for upper strata liquid bath damping fluid with 0.1%, but in lower floor's liquid bath damping fluid need not, pile up and separating gel.This spacer gel contain 5% 30% acrylamide stock solution (29.2% acrylamide, 0.8%N, N '-dimethylene acrylamide, w/v), 0.06% ammonium persulphate (w/v) and 0.1%TEMED (v/v).Separation gel contains the 10-13% linear gradient by the stable acrylamide stock solution of 0-10% sucrose linear gradient.Carried out electrophoresis 9-10 hour in room temperature 150V constant voltage.According to (method of Electrophoresis (1987) 8:93-99 dyes with silver or with CoomassieBlue (0.1%Coomassie Blue R-250,50% methyl alcohol, 10% formic acid) protein is developed the color as Blum etc.The 33kDa protein that is accredited as Wax synthase does not manifest until through the hydroxylapatite column purification as the main component of active ingredient.Behind scheme 1 purifying (embodiment 3C), with the protein that only is 33kDa of active proteins associated matter on the terminal cylinder.

Embodiment 4, and preparation jojoba wax synthase protein is used for digestion in the gel

A, warp concentrate preparation SDS-PAGE sample

(Beverly concentrates 3 times through ultrafiltration in pressure tank MA) for Amicon, Inc. with the odd number group of flowing through/the washing branch merging of whole HA post (scheme 1) and at equipment YM30 film.With sample with 2 Centricon-30 elements (Amicon, Inc., Beverly, MA) further about 50 μ l volumes of simmer down to.Each sample is handled with 6 μ lSDS mixtures (4 μ l 20%SDS, 1 μ l 14.3M beta-mercaptoethanol, 1 μ l, 0.1% tetrabromophenol sulfonphthalein).Placing room temperature after 15 minutes, sample added to (embodiment 3D) in the 10-13% acrylamide gradient gel (16 * 16cm * 1mm thickness), and with protein at 150v, constant voltage electrophoresis 9.5 hours.Gel at 50% methyl alcohol, with 0.1%Coomassie Blue dyeing 15 minutes, was decoloured 2 * 20 minutes in 50% methyl alcohol, 10% acetate in 10% acetate then.33kDa Wax synthase band is downcut from gel, and in 50% ethanol, decoloured 3 * 20 minutes.A swimming lane contains a series of protein, and is not used in whole digestion.

B. through precipitation preparation SDS-PAGE sample

The equal portions (0.8ml) of the even number component of whole HA post (scheme 1) are merged into 3 groups.To merge equal portions divides equally in 3 1.5ml bottles.Add 0.2ml 40%TCA with protein precipitation.Place on ice after 30 minutes, with sample centrifugal (12,000 * g, 15 minutes, 4 ℃) with precipitating proteins.Remove supernatant liquor, and granular precipitation is washed secondary with the ice-cold acetone of 0.6ml.With each the set sample final 3 parts of granular precipitations with same 50 μ l SDS sample buffers through damping fluid is transferred to another bottle and resuspension from a bottle.The bottle of the sky of resuspension is washed with 10 μ l sample buffers, and making the gross weight suspension volume of each set sample is 60 μ l.Sample is added to (Novex, SanDiego, cA, 1.5mm * 10 holes) in the little glue of 12% acrylamide Tris/ glycine, at 150V, constant voltage electrophoresis 20 minutes until dyestuff from gel bottom wash-out, thereby isolated protein.(Novex, San Diego's this gel CA) decolour with Coomassie Blue dyeing and with Gel-Clear.With Wax synthase from represent post peak value and the hangover component gel on three non-equivalence swimming lanes in downcut.Gel slice is placed the 1.5ml bottle and uses 1ml 50% methyl alcohol, 10% acetate decolouring 2 hours.Remove de-inking solution, and gel slice is freezing in liquid nitrogen, place a night on the dry ice, to carry out digesting in the gel at the W.MKeck of Yale University Foundation Biotechnology Resouce Laboratory.The gel slice of the sample of the ultrafiltration and concentration of must hanging oneself and the gel slices of 3 spissated samples of precipitation of must hanging oneself are merged, to carry out trysinization in the gel.

The mensuration of embodiment 5 aminoacid sequences

W.M Keck Foundation Biotechnology ResourceLaboratory carries out protein sequencing in Yale University.Its program comprises the analysis that a part (10-15%) gel slice is quantitatively reached aminoacid component, with a kind of proteolytic enzyme (trypsinase or lysyl endopeptidase) digesting protein, and through reversed-phase HPLC fractional separation product.Select absorption peak from HPLC, and carry out the laser desorption mass spectrum before protein sequencing, to determine the existing of peptide, quantity and quality.Select the longest peptide to carry out microsequencing.

Through tryptic digestion and the aminoacid sequence of jojoba Wax synthase peptide in following table 3, represent with the single-letter code.

The aminoacid sequence of table 3 Jojoba Wax synthase pancreatin peptide

WSpep?29??????????????????????????FVPAVApHGGALR

WSpep?33??????????????????????????TIDEYPVMFNYTQK

Below set forth from the cDNA library or separation Wax synthase nucleotide sequence from genomic dna.

The structure in A Jojoba cDNA library

Use initially described by Jackson and Larkins (Plant Physiol. (1976) 57:5-10), and more than (Developmental Biol. (1981) 83:201-217) corrects such as Goldberg the rrna partition method, isolation of RNA in the jojoba embryo that collected in 80-90 days the back of blooming.This program institute in steps in, carry out at 4 ℃ unless illustrate especially all.10gm is organized in the Waring mortar to grind under liquid nitrogen becomes refined powder until tissue.After liquid nitrogen vaporization, add 170ml and extract damping fluid (200mM Tris pH9.0,160mM KCl, 25mM EGTA, 70mM MgCl ₂, 1%Triton X-100,0.5% Sodium desoxycholate, 1M spermidine, 10mM beta-mercaptoethanol and 500mM sucrose), and with about 2 minutes of tissue homogenate.Homogenate is filtered and with 12,000 * g centrifugal 20 minutes through aseptic miracloth.With supernatant liquor impouring 500ml sterile flask, and add 20% detergent solution (20%Brij35,20%Tween40,20%Noidet p-40w/v) of 1/19 volume in room temperature.This solution was stirred 30 minutes at 4 ℃ with the moderate speed, then with supernatant liquor centrifugal 30 minutes with 12,000 * g.

About 30ml supernatant liquor five equilibrium is gone in the aseptic Ti60 centrifuge tube, and with containing 40mM TrispH9.0,5mM EGTA, 200mM KCl, 30mM MgCl ₂, 1.8M sucrose, the solution of the 7ml of 5mM beta-mercaptoethanol is rebasing.With extracting damping fluid pipe is filled up, and in the Ti60 rotor with 60,000rpm was 4 ℃ of rotations 4 hours.After centrifugal, the sucking-off supernatant liquor also adds 0.5ml resuspension damping fluid (40mM Tris pH9.0,5mM EGTA, 200mM KCl, 30mM MgCl in each pipe ₂, the 5mM beta-mercaptoethanol).After pipe placed on ice 10 minutes, with abundant resuspension of granular precipitation and set.Then with supernatant liquor with centrifugal 10 minutes of 120 * g to remove insolubles.In supernatant liquor, add 1 volume at 20mM Tris pH7.6,200mM EDTA, the 1mg/ml in 2%N-dodecyl-sarcosinate be from the Proteinase K of digestion, and with mixture room temperature incubation 30 minutes.

The sodium acetate and the 2 volume of ethanol precipitated rnas that add 1/10 volume.After 20 ℃ of several hrs, RNA is at 12,000 * g, 4 ℃ of centrifugal 30 minutes and granular precipitations.With this granular pellet resuspended (10mM Tris, 1mM EDTA) in the 10mlTE damping fluid, and with the saturated phenol extraction of equal-volume Tris pH7.5.10,000 * g4 ℃ centrifugal 20 minutes to separate each phase.Take out water, and with organic phase with 1 volume TE damping fluid extracting again.Merge water then also with 1 volume chloroform extraction.Each uses ethanol sedimentation to obtain polysome RNA water mutually and as above-mentioned through centrifugal separation again.

Polysaccharide impurity in the polysome RNA prepared product through with RNA through high-salt buffer (0.5M NaCl, 20mM Tris pH7.5,1mM EDTA, 0.1%SDS) cellulose column in (Sigma-cell 50) is removed.Impurity combines with post, collects RNA in elutriant.With the eluant component merging and with the RNA ethanol sedimentation.Then with sedimentary total RNA with the smaller size smaller resuspension and be applied to few deoxythymidine cellulose column to separate poly+RNA.

Poly+RNA is used for derived from being purchased cloning vector Bluescribe M13-(Stratagene Cloning Systems; San Diego, CA) and be prepared as follows plasmid cloning vector pCGN1703 in the construction cDNA library.The polylinker of Bluescribe M13-is digested through using Bam HI, and mung-bean nuclease is handled and flush end connects and change the plasmid that lacks with generation Bam HI, pCGN1700.With pCGN1700 with EcoRI and SstI (adjacent limits site) digestion, and with have BamHI, PstI, XbaI, ApaI and SmaI restriction site, the synthetic linker annealing of the 5 ' overhang of AATT and the 3 ' overhang of TCGA.Joint inserts pCGN1700 can eliminate the EcoRI site, produces SstI (also referring to do " SacI " at this paper sometimes) site that is found in the Bluescribe again, and is added in new restriction site contained on the joint.With gained plasmid pCGN1702 with HindIII digestion and with Klenow enzyme flush endization; Linear DNA is partly digested with PvuII and in diluent, be connected with the T4DNA Wax synthase.Selection has the transformant of Lac promoter region disappearance and is used as plasmid cloning vector.

Following draw outlines of is used for cDNA synthetic cloning.Plasmid cloning vector is digested with SstI, and produce with aggressiveness T-tailing at gained 3 ' overhang cohesive end, the tailing plasmid is never digested or do not separate in the tailing plasmid through few (dA)-Mierocrystalline cellulose chromatography with terminal deoxynucleotidyl transferase.The gained carrier is as the arbitrary terminal covalent attachment of the synthetic cDNA article one chain of primer itself and vector plasmid.The cDNA-mRNA-carrier complexes is handled with terminal enzyme (DNA) in the presence of deoxyguanosine triphosphate, produced the G-tailing at the cDNA chain end.Extra cDNA-mRNA mixture that will be adjacent with the BamHI site is removed through BamHI digestion, obtains having the cDNA-mRNA-carrier complexes that BamHI cohesive end and another end have the G-tailing at an end.With this mixture with having 5 ' BamHI cohesive end, Restriction Enzyme NotI, EcoRI and SstI recognition sequence, and the synthetic cyclisation joint cyclisation of the annealed of 3 ' C-tailing end.After connecting and repairing, with the annular compound thing be transformed into E.coli bacterial strain DH5a (BRL, Gaithersburg, MD) in to produce the cDNA library.Jojoba embryo cDNA storehouse is contained the average cDNA with about 500 base pairs and is inserted about 1.5 * 10 of size ⁶Individual clone.

In addition, the jojoba poly+RNA also is used in cloning vector 1ZAPII/EcoRI (Stratagene, San Diego, CA) middle construction cDNA library.With the scheme that manufacturer provides, DNA and bacterial isolates make up the library.Recommend to pack the clone according to manufacturer with Gigapack Gold packaging extract (Stratagene).The cDNA library of Gou Jianing is contained the average cDNA with about 400 base pairs and is inserted about 1 * 10 of size in this way ⁶The clone.

B. synthetic oligonucleotide

Usually, in order to be used as from the PCR primer of the single stranded DNA template of mRNA reverse transcription, preparation contains the oligonucleotide that justice orientation sequence is arranged corresponding to the Wax synthase peptide-coding sequence.These oligonucleotide are used as " forward " amplification primer to produce sense strand DNA.

For " oppositely " amplified reaction of noncoding DNA chain amplification, oligonucleotide can be designed to be equal to the part of the primer that is used to prepare the dna profiling that is used for PCR.Perhaps, contain the sequence that is complementary to the Wax synthase peptide-coding sequence oligonucleotide can with above-mentioned " forward " Wax synthase Oligonucleolide primers applied in any combination.

When the Wax synthase peptide sequence contains can be by various different codon amino acids coding the time, primer can be " degeneracy " oligonucleotide forward or backwards, promptly contains the mixture at all or some possible encoding sequence in particular peptide zone.For in this mixture, reducing various oligonucleotide amounts, when being used for the synthetic oligonucleotide of PCR primer, preparation preferably selects to have the peptide zone of minimum possibility encoding sequence.Similarly, when synthetic oligonucleotide is directly used in screening Wax synthase sequence library, preferably hang down the oligonucleotide of degeneracy.

Below be sequence and the forward (up) of codified WSpep29 peptide and the example of reverse (descending) dna sequence dna of peptide WSpep29 (middle row).

5’TTY?GTN?CCN?GCN?GTN?GCN?CCN?CAY?GGN?GGN?GCN?YTN?MGN?3’

F???V???P???A???V???A???P???H???G???G???A???L???R

3’AAR?CAN?GGN?CGN?CAN?CGN?GGN?GTR?CCN?CCN?CGN?RAN?KCN?5’

Below be sequence and the forward (up) of codified peptide WSpep33 and the example of reverse (descending) dna sequence dna of peptide WSpep33 (middle row).5’ACN?ATH?GAY?GAR?TAY?CCN?GTN?ATG?TTY?AAY?TAY?CAN?CAR?AAR?3′

T???I???D???E???Y???P???V???M???F???N???Y???T???Q???K3’TGN?TAD?CTR?CTY?ATR?GGN?CAN?TAC?AAR?TTR?ATR?TGN?GTY?TTY?5’

It below is the sequence that can be used for obtaining the synthetic oligonucleotide of Wax synthase sequence.The oligonucleotide title has reflected the specific Wax synthase peptide fragment number of listing in embodiment 6.Letter " F " expression PCR forward reaction primer in the oligonucleotide title.Letter " R " expression PCR back reaction primer.

WSpep29-F1?????5’TTYGTNCCNGCNGTNGC3’

WSpep29-F2?????5’GCNCCNCAYGGNGGNGC3’

WSpep29-R1?????5’GCNCCNCCRTGNGGNGC3’

WSpep29-R2?????5’GCNACNGCNGGNACRAA3’

WSpep33-F1?????5’ACNATHGAYGARTAYCCNGT3’

WSpep33-F2?????5’CCNGTNATGTTYAAYTAYAC3’

WSpep33-R1?????5’TTYTGNGTRTARTTRAACAT3’

WSpep33-R2?????5’AACATNACNGGRTAYTCRTC3’

Oligonucleotide TSYN be used for from poly-(A)+or total RNA reverse transcription with the single stranded DNA of preparation as pcr template.Except being used for gathering (T) district with poly-(A) tail bonded of mRNA, this oligonucleotide also contains HindIII, the restrictive diges-tion sequence of PstI and SstI.The sequence of TSYN is as follows:

TSYN5’CCAAGCTTCTGCAGGAGCTCTTTTTTTTTTTTTTT3’

Oligonucleotide TAMP is used for the back reaction of pcr amplification of the antisense strand of Wax synthase encoding sequence.Should notice that back reaction will not take place to finish until first forward reaction when pcr template when being reverse transcription from the single stranded DNA of mRNA.First chain reaction causes the generation of sense strand template, and it is used to then from reverse primer amplification antisense DNA chain.The sequence of TAMP is as follows:

TAMP????5’CCAAGCTTCTGCAGGAGCTC?3’

Below be according to the IUPAC standard, the nucleotide base code of above-mentioned oligonucleotide.

The A=VITAMIN B4, T=thymus pyrimidine Y=cytosine(Cyt) or thymus pyrimidine

The C=cytosine(Cyt), U=uridylic R=VITAMIN B4 or guanine

The G=guanine, I=inosine, O=inosine or cytosine(Cyt)

H=VITAMIN B4, cytosine(Cyt) or thymus pyrimidine

D=VITAMIN B4, guanine or thymus pyrimidine

N=VITAMIN B4, cytosine(Cyt), guanine or thymus pyrimidine

W=VITAMIN B4 or thymus pyrimidine

S=guanine or cytosine(Cyt)

B=guanine, cytosine(Cyt) or thymus pyrimidine

K=guanine or thymus pyrimidine

M=VITAMIN B4 or cytosine(Cyt)

The C.PCR reaction

Poly-(A)+RNA separates total RNA of above-mentioned freely preparation from the jojoba tissue.With Superscript reversed transcriptive enzyme (BRL) and with TSYN as Oligonucleolide primers through reverse transcription from poly-(A)+or total RNA preparation strand cDNA.According to manufacturer indication, remove react be 45 ℃ rather than 37 ℃ carry out, react.Jojoba strand cDNA is used for following PCR reaction 1-12.

Do template with the strand cDNA of reverse transcription and in Perkin Elmer Cetus GeneAmp PCRSystem 9600PCR instrument, carry out PCR.Use commercially available PCR reaction and optimize reagent according to producer's specification sheets.The cDNA part that is arranged in 3 ' of primer can increase in following reaction:

Reaction forward primer reverse primer

1???????????WSpep29-F1???????????????TAMP

2???????????WSpep29-F2???????????????TAMP

3???????????WSpep33-F1???????????????TAMP

4???????????WSpep33-F2???????????????TAMP

5???????????WSpep29-F1???????????????WSpep33-R1

6???????????WSpep29-F2???????????????WSpep33-R1

7???????????WSpep33-F1???????????????WSpep29-R1

8???????????WSpep33-F2???????????????WSpep29-R2

9??????????WSpep29-F1???????????WSpep33-R2

10?????????WSpep29-F2???????????WSpep33-R2

11?????????WSpep33-F1???????????WSpep29-R2

12?????????WSpep33-F2???????????WSpep33-R2

Amplification in addition if desired, the PCR product that contains the reaction that is designated as the F1 primer can be used as template and carry out second of PCR reaction with the primer that is designated as F2 and take turns circulation.Similarly, the PCR product that contains the reaction of the primer that is designated as R1 can be used as template and carries out second of PCR reaction with the primer that is designated as R2 and take turns circulation.

Perhaps, whole cDNA can increase with 5 ' and 3 ' RACE (Frohman et al., 1988) to utilize Marathon cDNA amplification kit (Clontech Laboraties Inc.) according to the producer's indication.Primer WSpep29-F1, WSpep29-F1, WSpep33-F1 and WSpep33-F2 are used to 3 ' RACE reaction.Primer WSpep-R1, WSpep29-R1, WSpep33-R1 and WSpep33-R2 are used to 5 ' RACE reaction.

The dna fragmentation that produces in scheme (Invitrogen Corp.) the PCR reaction according to the producer is cloned into pCR2.1.The dna sequence dna of measuring cloned sequence is to confirm cloned sequence coding Wax synthase peptide.

D. the screening library of Wax synthase sequence

The Wax synthase dna fragmentation that is obtained by PCR is labeled, and is used as probe with screening and cloning from above-mentioned cDNA library.DNA library screening technology known in the art, and as (Molecular Cloning:A Laboratory Manual, SecondEdition (1989) Cold Spring Harbor Laboratory Press) as described in Maniatis etc.In this mode, can obtain the Wax synthase nucleotide sequence, it can be analyzed and be used for expressing Wax synthase the host of various protokaryons and eucaryon.

Embodiment 6-is used for the Wax synthase and the reductase enzyme construct of expression of plants

The construct that provides Wax synthase and reductase enzyme to express in vegetable cell can be provided.

The expression cassette that contains 5 ' and 3 ' regulatory region in the gene that comes comfortable seed tissue preferred expression can prepare in Bce4 and the ACP gene from as the described napin of WO92/03564.

For example, Kridl etc. (Seed Science Research (1991) 1:209-219) have set forth the napin expression cassette that is used for Wax synthase and the expression of reductase gene construct, pCGN1808.Another napin expression cassette pCGN3223 contains the amicillin resistance background, and is equal to 1.725napin5 ' and 1.265 3 ' the adjusting sequence of finding among the pCGN1808 substantially.There is HindIII these regulatory region both sides, NotI and KpnI restriction site, and single SalI, and BglII, PstI and XhoI cloning site are positioned between 5 ' and the 3 ' non-coding region.

Also can be applicable to sequence clone box from the transcriptional regulatory under the control in oleosin gene 5 ' and 3 ' district.The sequence of Brassica napus oleosin gene is by Lee and Huang (PlantPhys. (1991) 96:1395-1397) report.The sequence of oleosin box pCGN7636 is seen USPN5, Fig. 4 of 445,947.Oleosin box flank is BssHII, KpnI and XbaI restriction site, and contain to be useful between 5 ' and 3 ' oleosin district and insert Wax synthase, reductase enzyme, or the SalI of other corresponding dna sequence dna, BamHI and PstI site.

Wax synthase and reductase gene sequence can be inserted in the box like this to be provided for the expression construct of Plant Transformation method.For example, USPN, 5,445,947 have set forth and utilize 5 ' and 3 ' regulatory region in the napin gene to express the construct of reductase enzyme in vegetable cell.

The method of (Mol.Gen.Genet (1978) 163:181-187) such as application Holsters reaches as the following method that is used for Plant Transformation, the binary vector construct is transformed into agrobatcerium cell, as EHA101 bacterial strain (Hood etal., J.Bacteriol (1986) 168:1291-1301).

Embodiment 7: Diacrylglycerol acyl transferase (DAGAT) is analyzed

With the mortierella ramanniana is that example has been set forth the active method of DAGAT in non-dissolved or dissolved protein prepared product of analyzing.

A. non-sample dissolution

It is described to be similar to (1993,1994) such as Kamisaka, is used in to contain 10mM potassiumphosphate (pH7.0), 3.67 μ M 1-in the damping fluid of 100-150mMKCl and 0.1%TX-100 (w/v) ¹⁴C-18:1 CoA (53.5～54.5 Ci/mole, New EnglandNuclear, Boston, MA) and 1.5mM 1,2-18:1 diacylglycerol (DAG) (Sigma D-0138, the 150mM liquid storage in the 2-methoxyethanol is made in preparation) is analyzed the DAGAT activity with cumulative volume 100 μ l.Analyze 5 minutes at 30 ℃, and add the 1.5ml heptane: Virahol: 0.5M H ₂SO ₄(10: 40: 1, v/v/v) to stop.If desired, the linear velocity that before analysis, sample can be produced with maintenance product during analyzing with the damping fluid dilution.

B. dissolved sample

As described in to non-sample dissolution in addition following variation analyze: 1,2-18:1 DAG amount is reduced to 0.5mM, Triton X-100 amount increases to 0.2%, KCl concentration remains between 100～125mM.After the scheme of the described in addition slight modifications as (1996,1997) such as Kamisaka is with the stain remover dissolving, also need add L-α-phosphatidic acid (Sigma P-9511, the 50mM liquid storage among the 1%Triton X-100 (w/v) is made in preparation) to reclaim activity.We find handling back application 300 μ M phosphatidic acids with Triton X-100 than providing the higher active stimulation of DAGAT with 500 μ M.We find that also the DAGAT activity is responsive to the KCl amount that imports in analyzing, and optimum level is between 100-125mM.Analyze 5～30 minutes at 30 ℃, and as termination as described in the non-sample dissolution.

C. the processing of sample analysis

After analyze stopping, with them 4 ℃ of storages handling after a while, or add 0.1ml 1MNaHCO ₃, add heptane processing immediately that 1ml contains the 15nmoles/ml triolein subsequently as extracting carrier.With the content vortex and after water phase separated and organic phase, upper organic phase is moved in the new glass bottle and wash with 1ml 1M NaCl.Shift out 40% organic phase and carry out liquid scintillation counting(LSC), and will remain organic phase and be transferred in the clean vial evaporate to dryness under nitrogen.Resistates is resuspended to 45 μ l hexanes, and the point drop in silica gel G with preadsorption sample application zone, glass, on thin-layer chromatography (TLC) flat board (Analtech #31011, Newark, Delaware).With the TLC flat board at hexane: diethyl ester: acetate (50: 50: 1, be expanded to the top in v/v/v), dry then and with radiation developing analyser (AMBIS 3000, San Diego, CA) scanning is to determine to mix the radioactivity part in the triacylglycerol.Active is the unit report with pmole/min.

The growth and the results of embodiment 8. mortierella ramanniana cultures

With mortierella ramanniana 1.5～3 * 10 ⁶1 liter of Defined GlucoseMedia of individual spore inoculating (30g glucose, 1.5g (NH ₄) ₂SO ₄, 3g K ₂HPO ₄, 0.3g MgSO ₄7H ₂O, 0.1g NaCl, 5gCH ₃COONa3H ₂O, 10mg FeSO ₄7H ₂O, 1.2mgCaCl ₂2H ₂O, 0.2mg CuSO ₄5H ₂O, 1.0mg ZnSO ₄7H ₂O, 1.0mgMnCl ₂4H ₂O, 2mg VitB1-HCl and 0.02mg vitamin H are at 1L (pH5.7) in the water of inverse osmosis purifying), and at 30 ℃ with 200rpm 9～11 days incubations of vibration and cultivate.(Calbiochem, La Jolla CA) filter the results culture by one deck Miracloth.Handle extruding and remove excess liq.The mean yield of the packing cell of every liter of results is 22.5g.

Embodiment 9: gradient gel sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE)

The sample of taking from the post component dilutes (1 * damping fluid=2%SDS, 250mM beta-mercaptoethanol, 0.0025% bromine phenol Blue) and through electrophoretic analysis in the SDS-PAGE sample buffer.Method according to Laemmli (1970) is also carried out polyacrylamide gradient gel electrophoresis (10-13%) as the modification of Delepelaire.Sodium lauryl sulphate is used for upper strata liquid bath damping fluid with 0.1%, but is not used in lower floor liquid bath damping fluid, lamination and separating gel.Stacking gel contain 5% 30% acrylamide stoste (acrylamide: N, N '-methylene radical acrylamide, 37.5:1, Bio-Rad, Hercules, CA), 0.06% ammonium persulphate and 0.1%TEMED (v/v).Separating gel contains by the stable 10-13% acrylamide stoste linear gradient of 0-10% sucrose linear gradient.In room temperature, 150V, constant voltage was carried out electrophoresis 7-9 hour.With protein according to the method for (1987) such as Blum with silver or with Coomassie Blue (0.1% ComassieBlue R-250,50% methyl alcohol (v/v)), 10% acetate (v/v) dyeing is to develop the color.

Embodiment 10 uses the evaluation as the chromatography of (1997) such as Kamisaka in purifying DAGAT from mortierella ramanniana

A. the preparation of liposome component

Following steps are carried out at 4 ℃.

Typically, the wet packing cell (being stored in-70 ℃) of 70～75g is used for each liposome prepared product.Before be about to using, cell is thawed on ice and be resuspended to (10mM potassiumphosphate (pH7.0), 0.15M KCl, 0.5M sucrose and 1mMEDTA) in the 150ml buffer A.Add following proteinase inhibitor to reduce proteolysis: 0.1 μ M aprotinin, 1 μ M leupeptin, (all are all from BoehringerMannheim, Germany) to reach 100 μ M Pefabloc.Cell is divided into 5 50ml test tubes, and (Kinematic GmbH, Brinkman Instruments Switzerland) have directly cracking 7 * 1 minutes on the #7 of probe seat of 1cm with Polytron tissue refiner.With gained homogenate be transferred to centrifuge tube (29 * 104mm) and through 4 ℃ with 1500 * g (Beckman Instruments, J2-21, JA-20rotor, 3500rpm) rotation made the solid disintegrating slag precipitation that granulates in 10 minutes.Remove supernatant liquor and wash granular precipitation with other 5ml buffer A.After centrifugal, the supernatant liquor volume is made up.This component refers to do " S1 ".This S1 divided (Fullerton CA), and covers two effective 5ml buffer B (10mM potassiumphosphate pH7.0,0.15M KCl, 0.3M sucrose and 1mM EDTA) for 25 * 89mm, BeckmanInstruments into 6 super centrifuge tubes.With sample with 100,000xg (Beckman Instruments, L8-M, SW-28 rotor, 21000rpm) centrifugal 3 hours at 4 ℃.Be recovered in coverture top buoyant liposome component (LBF) with spatula, and go to (Potter-Elyehjem) in the glass refiner.Remain in that a small amount of LBF in the centrifuge tube reclaims through shifting out 4ml buffer B coverture with transfer pipet and LBF in itself and the refiner is merged.With whole LBF homogenate in the 40ml buffer B.Following collection remaining ingredient: interface composition (interface between 0.3-0.5M sucrose damping fluid), dissolved constituent (liquid volume under the interface), and membrane component (the granular precipitation of brown/brown at the bottom of every pipe).All components all is frozen, and store to wait for dissolving and be further purified at-70 ℃.

B. from the liposome component, dissolve the DAGAT activity

LBF is thawed on ice, and (Boehringer Mannheim, Mannheim are that 1.3% (w/v) reaches dissolving from 10% (w/v) stoste to final concentration Germany) through adding Triton X-100.(Mallinckrodt, Paris is Kentucky) so that final concentration is 0.5M to add solid sucrose.To divide to go into 6 super centrifuge tubes (25 * 89mm, Beckman Instruments) then with the sample of detergent-treatment 4 ℃ of jogs 1 hour.Each effective 5ml buffer B covers.With sample with 100,000 * g (Beckman Instruments, L8-M, SW-28rotor, 21000rpm) centrifugal 3 hours at 4 ℃.To refer to that the solute of making " Triton X-100 extract " inserts apart from each 1cm at the bottom of the super centrifuge tube through a tubule being seen through coverture, and the light 0.5M of sucking-off lower floor sucrose layer, make simultaneously upper strata 0.3M sucrose coverture (comprising floating lipid layer) and under granular precipitation motionless and reclaim.

In as (1979) described schemes such as Kamisaka, the liposome component is dissolved with 0.1%TritonX-100, and 100, and 000xg is further centrifugal or filter through 0.2 μ m filter.They find that needing to improve Triton X-100 concentration to 1.5% makes the DAGAT activity combine with first post.

C. be used for from the chromatography of mortierella ramanniana purifying DAGAT

The damping fluid C that is used for chromatography contains 10mM potassiumphosphate (pH7.0), 0.1%TritonX-100 (w/v) (Boehringer Mannheim, Mannheim, Germany), 10% glycerine (w/v), 0.1 μ M aprotinin, 1 μ M leupeptin, 100 μ M Pefabloc (all available from Boehringer Mannheim, Mannheim, Germany) and the Repone K of various amounts (75～500mM).This damping fluid is different from by used respective post damping fluid part such as Kamisaka (1997) and is: wherein glycerine has replaced ethylene glycol, does not add EDTA, and DTT and PMSF have added aprotinin simultaneously, leupeptin and Pefabloc.According to the scheme of (1997) such as Kamisaka, prepare a Yellow86-agarose column (Sigma R-8504 St.Louis, MO) (1.5cm * 5.8cm), and with damping fluid C balance with 150mM KCl.We attempt under these conditions the DAGAT activity that exists in the Trrtoin X-100 extract to be combined with the Yellow86-agarose column, but find that most of DAGAT can not combine with post.We can be incorporated into post by the KCl concentration dilution that will apply sample with equal-volume damping fluid C (not having KCl) with the DAGAT activity of obvious part to 75mM.In view of the above, the Yellow86-agarose column is also with having 75mM KCl damping fluid C balance.Give with 0.56ml/ and to add after the sample, with the level pad flushing of post with 4 column volumes.With the damping fluid C wash-out that contains 500mM KCl and post bonded DAGAT activity and protein (Fig. 4).

Is 1: 3.33 from the DAGAT of Yellow86-agarose column activity (17-20 component) with damping fluid C dilution with wash-out, so that KCl concentration is reduced to 150mM.The set (103ml) of this dilution divided with 0.2ml/ add to containing 150mM KCl damping fluid C equilibrated heparin-Sepharose CL-6B post (Pharmacia, Uppasla, Sweden, 0.5cm * 4.8cm).This post is washed with 5 volumetric balance damping fluids, and contain the damping fluid C wash-out DAGAT activity and the protein of 150-500mM KCl linear gradient with 15ml.The DAGAT activity is with 2 overlapping peaks wash-outs, first peak wash-out in gradient of finding by (1997) such as Kamisaka, and second peak being found by Kanisaka etc. be not at gradient end wash-out, and it contains more a spot of protein (Fig. 5 A).

The part of heparin column two peak value components (250 μ l) is divided (1 * 30cm in the damping fluid C equilibrated Superdex-200 post that contains 150mMKCl with 0.2ml/, Bio-Rad, Heraules, CA) be further purified through size exclusion chromatography, only for proofreading and correct, with the damping fluid C balance of post with the modification that contains 150mM KCl, Triton X-100R (Calbiochem wherein, LaJolla, CA) replaced Triton X-100, with post with Bio-Rad gel-filtration standard correction, with the estimation molecular weight of 99kDa with DAGAT wash-out in each of two peaks from heparin Sepharose CL-6B.

At its chromatography of the enterprising Xingqi of elution peak after a while of the heparin column that contains higher DAGAT specific activity.In the case, second peak (component 36-41) with heparin column dilutes 1: 6.6 to 46.7ml with damping fluid C.This sample divided with 0.5ml/ add to the damping fluid C equilibrated Yellow86 agarose column that contains 75mM KCl (1.0cm * 6.4cm).After level pad flushing, contain damping fluid C elution of bound protein and all DAGAT activity of 75～500mM KCl linear gradient with 40ml with 5 column volumes.The DAGAT activity is with a unimodal wash-out (Fig. 6 A).

Contain from the protein composition of the active component of DAGAT of heparin and second Yellow86 post and analyzed through gradient SDS-DAGE according to the scheme of embodiment 3, protein band is detected through silver dyeing.Wash-out is compared component and DAGAT activity curve separately with component from the histogram of these posts.Exist and the relevant numerous protein material standed for of the active existence of DAGAT.We think that purification scheme is not enough to differentiate the active relevant specified protein material standed for (Fig. 5 B, 6B) with DAGAT.

Embodiment 11: differentiate the new purification scheme of purifying from the DAGAT of mortierella ramanniana protein material standed for

A. prepare the liposome component

Following steps are carried out at 4 ℃.

Typically, the wet packing cell (being stored in-70 ℃) of 70-75g is used for each liposome prepared product.Before use, cell thawed on ice and be resuspended to (10mM potassiumphosphate (pH7.0), 0.15M KCl, 0.5M steam sugar, 1mM EDTA) in the 150ml buffer A.Add following proteinase inhibitor to reduce proteolysis: 0.1 μ M aprotinin, 1 μ M leupeptin and 100 μ M Pefabloc (all deriving from Boehringer MannheimGermany).With sample through cytoclasis instrument (Bead-Beater, Biospec Products, Bartlesville OK) with the cracking of 0.5mm bead.With 180ml bead filling sample chamber.The packing cell that will wet thaw on ice and the overlapping 150ml of floating on buffer A in.The ripple pearl was covered in the cell homogenates impouring.Usually need to add other 40～50ml buffer A filling sample chamber to work.This volume is used for residual cells homogenate is flushed out from its original container, so its can with all the other sample combination.Viscosity is per sample ground cell 45～90 seconds.The cell homogenates branch that will contain bead go in the pipe (29 * 104mm), and 4 ℃ with 500 * g centrifugal (BeckmanInstruments, GP Centrifuge, GH 3.7 horizontal rotors, 1500rpm).Take out supernatant liquor, and wash granular precipitation with other 5ml buffer A.Centrifugal back combination supernatant liquor volume.This component refers to do " S1 ".This S1 is divided into 6 super centrifuge tubes (25 * 89mm BeckmanInstruments), and each all covers with the buffer B (10mM potassiumphosphate pH7.0,0.15M KCl, 0.3M sucrose) that 5ml revises.EDTA disturbs hydroxyapatite owing to it and it is removed from buffer B (seeing embodiment 4).4 ℃ with 100,000 * g with centrifugal 3 hours of sample (Beckman, Instruments, L8-M, SW-28 rotor, 21000rpm).Reclaim with spatula and to swim in the liposome component (LBF) of coverture top layer, and go in the glass refiner, with suction pipe sucking-off 4ml buffer B coverture and with its with refiner in the LBF combination and the LBF of recovery small portion of residual in centrifuge tube.With whole LBF homogenate in the 40ml buffer B.Collect following remaining ingredient, interface composition (0.3 and between 0.5M sucrose damping fluid interface), soluble constituent (in the liquid volume under the interface) and membrane component (the granular precipitation of the brown/brown at the bottom of every pipe), all components is all freezing and store to wait for dissolving and be further purified at-70 ℃.

B. from the liposome component, dissolve the DAGAT activity

Before dissolving, (method CA) is carried out protein determination with bovine serum albumin as standard for Bio-Rad Reagent, Hercules through Bradford with equal portions liposome component.LBF is thawed on ice, and being diluted to concentration then is that 1mg protein/ml is to handle 15: 1 (w/w is equivalent to 1.3%Triton X-100) with Triton X-100 with stain remover and protein rate also.(Mallinckrodt, Paris is Kentucky) so that final concentration is 0.5M to add solid sucrose.To divide to go into 6 super centrifuge tubes (25 * 89mm, Beckman Instruments) then with the sample of detergent-treatment 4 ℃ of jogs 1 hour.The buffer B that each effective 5ml revises covers.With sample with 100,000 * g (Beckman Instruments, L8-M, SW-28rotor, 21000rpm) centrifugal 3 hours at 4 ℃.To refer to that the solute of making " Triton X-100 extract " inserts apart from each 1cm at the bottom of the super centrifuge tube through a tubule being seen through coverture, and the light 0.5M of sucking-off lower floor sucrose layer, make simultaneously upper strata 0.3M sucrose coverture (comprising floating lipid layer) and under granular precipitation motionless and reclaim.

The C.DAGAT column chromatography.

Our the past experience of purifying acyl transferase proteins matter from plant species is used for from mortierella ramanniana purifying DAGAT.We use hydroxyapatite purifying Wax synthase (Simnondsia chinensis from jojoba; WO Publication 95/15387; all incorporate reference into); reach purifying lysophosphatidate acyltransferase (LPAAT) (U.S. Patent application 08/231 from coconut (Cocos nucifera); 196; all incorporate reference into) to succeed, this purification step is introduced after the Yellow86 agarose column.Carry out Yellow 86-agarose and hydroxylapatite purification scheme in two ways, in option A, activity combines with first post, and at wash-out post analysis composition activity.Then second post is gathered and be used for to active ingredient.We refer to do sequential chromatography with this.In option b, activity combines with first post, and wash-out is not gathered second post on the direct stream then, analyzes between this.We refer to do the series connection chromatography with it.

In option A, with the 2ml/ branch Triton X-100 extract is added to damping fluid C equilibrated Yellow86-agarose column (2.5cm * 6.4cm) (the embodiment 4.C) that contains 75mM KCl, level pad flushing post with 5 column volumes divides wash-out (Fig. 7) with the damping fluid C that contains 500mM KCl with 0.5ml/ then.To contain active two the maximum activity components of 93% wash-out (64 and 65) set, and use application of sample on the damping fluid C equilibrated hydroxyapatite column that contains 500mM KCl with the 0.5ml/ branch.The DAGAT activity post of flowing through, and most protein combines with post.Level pad flushing post with 3 column volumes.With the 100mM dipotassium hydrogen phosphate and contain 500mM KCl damping fluid C and divide conjugated protein wash-out (Fig. 8 A) with 0.5ml/.As described in embodiment 3, a part contains the component at the active peak of DAGAT and carries out gradient gel SDS-DAGE.Protein is compared (Fig. 8 B) with silver dyeing and with the banding pattern component to component and activity curve.Some DAGAT protein material standed fors are with active relevant.Especially note corresponding to 43kD 36.5kD, 33kD, 29kD, the band of 28kD and the migration of 27kD position.Do not show and active relevant candidate albumen matter in the 53kD district.

In option b, divide with 1ml/ Triton X-100 extract is added to the 75mM of containing KCl damping fluid C equilibrated Yellow86-agarose column (1.5cm * 5.8cm) is arranged.Level pad flushing post with 5 column volumes exports the Yellow86-agarose column with (inlet CA) joins for 1.0cm * 26.2cm Bio-Rad, Hercules with containing 500mMKCl damping fluid C equilibrated hydroxyapatite column then.Contain damping fluid C wash-out and the Yellow86 post bonded DAGAT activity of 500mM KCl with 110ml, and divide with 0.2ml/ and directly to pass through hydroxyapatite column.At last, hydroxyapatite column and Yellow86-agarose column are dissociated, and with the 100mM dipotassium hydrogen phosphate and contain damping fluid C wash-out and the hydroxyapatite column bonded protein of 500mM KCl.Find in the component that the DAGAT activity is collected from hydroxyapatite column between the damping fluid flush period that contains 500mM KCl with 110ml.

Most protein in the Triton x-100 extract do not combine and are discarded with the Yellow86 agarose column.The sub-fraction protein that comprises DAGAT combines with the Yellow86-agarose, and with the damping fluid C wash-out that contains 500mM KCl, when this eluate is applied to hydroxyapatite column, the DAGAT activity flow through this post simultaneously most of remaining proteins combine with post, and with the damping fluid C wash-out that contains 500mM KCL, when this eluate is applied to hydroxyapatite column, the DAGAT activity flow through this post simultaneously most of remaining proteins combine and separated (Fig. 9 A) with post.A part that contains the component at the active peak of DAGAT is carried out gradient gel SDS-PAGE, and dyes with silver.With wash-out from the banding pattern of these posts and DAGAT activity curve separately in addition component component is contrasted.The protein of the test shows 33kDa of painted protein band the most relevant with the DAGAT activity (Fig. 9 B).

Embodiment 12: preparation is used for the protein of digestion in the gel

A. through concentrating preparation SDS-PAGE sample

The odd number group of the flowing through of whole HA post (scheme 1)/washing fluid divided merge and (Beverly concentrates 3 times through ultrafiltration in pressure tank MA) for Amicon, Inc. at equipment YM30 film.With sample with 2 Centricon-30 elements (Amicon, Inc., Beverly, MA) further about 50 μ l volumes of simmer down to.Each sample is handled with 6 μ l SDS mixtures (4 μ l 20%SDS, 1 μ l 14.3M beta-mercaptoethanol, 1 μ l, 0.1% tetrabromophenol sulfonphthalein).Placing room temperature after 15 minutes, sample added to (embodiment 3D) in the 10-13% acrylamide gradient gel (16 * 16cm * 1mm thickness), and with protein at 150v, constant voltage electrophoresis 9.5 hours.Gel at 50% methyl alcohol, with 0.1%Coomassie Blue dyeing 15 minutes, was decoloured 2 * 20 minutes in 50% methyl alcohol, 10% acetate in 10% acetate then.33kDa Wax synthase band is downcut from gel, and in 50% ethanol, decoloured 3 * 20 minutes.A swimming lane contains a series of protein, and is not used in whole digestion.

B. through precipitation preparation SDS-PAGE sample

The equal portions (0.8ml) of the even number component of whole HA post (scheme 1) are merged into 3 groups.To merge equal portions divides equally in 3 1.5ml bottles.Add 0.2ml 40%TCA with protein precipitation.Place on ice after 30 minutes, with sample centrifugal (12,000 * g, 15 minutes, 4 ℃) with precipitating proteins.Remove supernatant liquor, and granular precipitation is washed secondary with the ice-cold acetone of 0.6ml.With each the set sample final 3 parts of granular precipitations with same 50 μ l SDS sample buffers through damping fluid is transferred to another bottle and resuspension from a bottle.The bottle of the sky of resuspension is washed with 10 μ l sample buffers, and making the gross weight suspension volume of each set sample is 60 μ l.Sample is added to (Novex, SanDiego, cA, 1.5mm * 10 holes) in the little glue of 12% acrylamide Tris/ glycine, at 150V, constant voltage electrophoresis 20 minutes until dyestuff from gel bottom wash-out, thereby isolated protein.(Novex, San Diego's this gel CA) decolour with Coomassie Blue dyeing and with Gel-Clear.With Wax synthase from represent post peak value and the hangover component gel on three non-equivalence swimming lanes in downcut.Gel slice is placed the 1.5ml bottle and uses 1ml 50% methyl alcohol, 10% acetate decolouring 2 hours.Remove de-inking solution, and gel slice is freezing in liquid nitrogen, place a night on the dry ice, to carry out digesting in the gel at the W.MKeck of Yale University Foundation Biotechnology Resouce Laboratory.The gel slice of the sample of the ultrafiltration and concentration of must hanging oneself and the gel slices of 3 spissated samples of precipitation of must hanging oneself are merged, to carry out trysinization in the gel.

Embodiment 13: the mensuration of aminoacid sequence

W.M Keck Foundation Biotechnology ResourceLaboratory carries out protein sequencing in Yale University.Its program comprises the analysis that a part (10-15%) gel slice is quantitatively reached aminoacid component, with a kind of proteolytic enzyme (trypsinase or lysyl endopeptidase) digesting protein, and through reversed-phase HPLC fractional separation product.Select absorption peak from HPLC, and carry out the laser desorption mass spectrum before protein sequencing, to determine the existing of peptide, quantity and quality.Select the longest peptide to carry out microsequencing.

Embodiment 14: the separation of mortierella ramanniana DAGAT nucleotide sequence

Usually, in order to be used as from the PCR primer of the single stranded DNA template of mRNA reverse transcription, preparation contains the oligonucleotide that justice orientation sequence is arranged corresponding to the DAGAT peptide-coding sequence.These oligonucleotide are used as " forward " amplification primer to produce sense strand DNA.

For " oppositely " amplified reaction of noncoding DNA chain amplification, oligonucleotide can be designed to be equal to the part of the primer that is used to prepare the dna profiling that is used for PCR.Perhaps, contain the sequence that is complementary to the DAGAT peptide-coding sequence oligonucleotide can with above-mentioned " forward " DAGAT Oligonucleolide primers applied in any combination.

When the DAGAT peptide sequence contains can be by various different codon amino acids coding the time, primer can be " degeneracy " oligonucleotide forward or backwards, promptly contains the mixture at all or some possible encoding sequence in particular peptide zone.For in this mixture, reducing various oligonucleotide amounts, when being used for the synthetic oligonucleotide of PCR primer, preparation preferably selects to have the peptide zone of minimum possibility encoding sequence.Similarly, when synthetic oligonucleotide is directly used in screening DAGAT sequence library, preferably hang down the oligonucleotide of degeneracy.

The DAGAT dna fragmentation mark that will obtain through PCR, and as the probe of screening and cloning from the cDNA library.Complementary DNA known in the art and DNA make up and the library screening technology, of (Molecular Cloming:A Laboratory Manual, SecondEdition (1989) Cold Spring Harbor Laboratory Press) such as for example Maniatis.In this mode, the DAGAT nucleotide sequence of acquisition can carry out nucleic acid sequence analysis, and is used for expressing DAGAT various hosts (eucaryon and prokaryotic cell prokaryocyte).

Embodiment 15: the mortierella ramanniana DAGAT construct that is used for expression of plants

The construct that provides the DAGAT sequence to express in vegetable cell can be provided.

The expression cassette that contains 5 ' and 3 ' regulatory region in the gene that comes comfortable seed tissue preferred expression can prepare in Bce4 and the ACP gene from as the described napin of WO92/03564.

For example, Kridl etc. (Seed Science Research (1991) 1:209-219) have set forth the napin expression cassette that is used for Wax synthase or the expression of reductase gene construct, pCGN1808.Another napin expression cassette pCGN3223 contains the amicillin resistance background, and is equal to 1.725napin5 ' and 1.265 3 ' the adjusting sequence of finding among the pCGN1808 substantially.There is HindIII these regulatory region both sides, NotI and KpnI restriction site, and single SalI, and BglII, PstI and XhoI cloning site are positioned between 5 ' and the 3 ' non-coding region.

Also can be applicable to sequence clone box from the transcriptional regulatory under the control in oleosin gene 5 ' and 3 ' district.The sequence of Brassica napus oleosin gene is by Lee and Huang (PlantPhys. (1991) 96:1395-1397) report.The sequence of oleosin box pCGN7636 is seen USPN5, Fig. 4 of 445,947.Oleosin box flank is BssHII, KpnI and XbaI restriction site, and contain to be useful between 5 ' and 3 ' oleosin district and insert Wax synthase, reductase enzyme, or the SalI of other corresponding dna sequence dna, BamHI and PstI site.

The DAGAT gene order can be inserted in the box like this to be provided for the expression construct of Plant Transformation method.For example, USPN, 5,445,947 have set forth and utilize 5 ' and 3 ' regulatory region in the napin gene to express the construct of reductase enzyme in vegetable cell.

The method of (Mol.Gen.Genet (1978) 163:181-187) such as application Holsters reaches as the following method that is used for Plant Transformation, the binary vector construct is transformed into agrobatcerium cell, as EHA101 bacterial strain (Hood etal., J.Bacteriol (1986) 168:1291-1301).

Embodiment 16: Plant Transformation method and analysis

Existing many methods are inserted corresponding DNA sequence in the genome of plant host, with the sequence that obtains to transcribe or transcribe and translate to realize phenotypic alternation.

The cultivar Reston of high sinapinic acid mutation such as Brassica napus or the mutation of Canola type can be used as (Theor.Appl.Genet. (1988) 75:685-694 such as Radke; Plant CellReports (1992) 11:499-505) described agriculture bacillus mediated conversion method transforms.Through obtaining genetically modified Arabidopsis thaliana plant as (Proc.Nat.Acad.Sci. (1988) 85:5536-5540) described agriculture bacillus mediated conversions such as Valverkens.Can similarly transform other plant species with correlation technique.

Perhaps, can use as (Bio/Technology 10:286-291) described microprojectile bombardment methods such as Klein to obtain to contain the plant transformed of reductase enzyme as herein described and Wax synthase expression construct.

Transform the seed of plant or the DAGAT activity at other position with embodiment 1 described DAGAT analytical method analysis.

Above result shows that acquisition is forming the proteic ability of activated partially purified DAGAT the triacylglycerol from acyl and diacylglycerol substrate.And provide the method that obtains DAGAT albumen and aminoacid sequence thereof.In addition, from aminoacid sequence, also can obtain the DAGAT nucleotide sequence with PCR and the library screening method that this paper provided.This nucleotide sequence can be operated with provide sequence transcribe and/or in host cell the DAGAT protein expression, this albumen can be used in the various application.So use the modification that comprises host cell triacylglycerol level and composition.

Reference is all incorporated in publication that all the application quoted and patent application into, and reference is all incorporated in each the special publication mentioned or patent application into.

Although aforementioned invention elaborates in the mode of illustration or embodiment, those skilled in the art's being taught in according to the present invention do not departed under the spirit and scope of claim, can make some change and modification.

Claims (5)

1, a kind of acyltransferase of basic purifying, wherein said acyltransferase is being activated from diacylglycerol and aliphatic alcohol substrate formation TAG.

2, the acyltransferase of claim 1, its activity is towards 10/10-DAG.

3, a kind of acyl transferase proteins; wherein said protein has the apparent molecular weight of about 33kD on SDS-PAGE; described protein is basic purifying from the film of n cell or other protein, and can catalysis from 1,2-diacylglycerol and acyl-CoA produce triglyceride level.

4, the Diacrylglycerol acyl transferase of claim 3 has the activity towards 18:1 aliphatic alcohol substrate.

5, the Diacrylglycerol acyl transferase of claim 4 derives from mortierella ramanniana.

Images