CN1249432A - Golden marking test strip for genetic quick diagnosis and its preparing process - Google Patents
Golden marking test strip for genetic quick diagnosis and its preparing process Download PDFInfo
- Publication number
- CN1249432A CN1249432A CN 99114403 CN99114403A CN1249432A CN 1249432 A CN1249432 A CN 1249432A CN 99114403 CN99114403 CN 99114403 CN 99114403 A CN99114403 A CN 99114403A CN 1249432 A CN1249432 A CN 1249432A
- Authority
- CN
- China
- Prior art keywords
- oligonucleotide probe
- streptavidin
- mouse
- water
- genetic
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
A golden marking test strip for quick genetic diagnosis is composed of water-absorbing paper, water-absorbing fibre, nitrocellulose membrane, water-absorbing filter paper and base board. Said water-absorbing fibre is coated by golden marked mouse anti-digoxin antibody-digoxin marked oligonucleotide probe. Said nitrocellulose membrane is coated by streptavidin-biotin marked oligonucleotide probe, as well as sheep anti-mouse polyclonal antibody and streptavidin-biotin marked oligonucleotide probe. Its advantages are high specificity and sensitivity, short operation time and simplified operation steps.
Description
The present invention relates to a kind of golden marking test strip for genetic quick diagnosis and preparation method thereof.
Technique of gene detection is one of the most basic technology in the molecular biology research, also be one of state-of-the-art technology (technology is decided in gene diagnosis) in current medical diagnosis on disease and the auxiliary diagnosis, the positive important effect of play more and more in the diagnosis of genetic disease, communicable disease, tumour and method medical circles and research of gene diagnosis technology.Current technique of gene detection comprises making nucleic acid molecular hybridization, polymerase chain reaction (being PCR)-electrophoretic techniques, polymerase chain reaction-enzyme-linked immunoassay technology, polymerase chain reaction-making nucleic acid molecular hybridization technology etc., wherein than faster, easy technology has PCR hybridization comb (Hybri-Comb
TM), its susceptibility of these technology or specificity be all than higher, but operation is very complicated, also very time-consuming (ten hours at least, ten days) at most, restricted the popularization of genetic test or gene diagnosis technology widely or popularize.Though PCR hybridization comb is quicker and much easy than technique of gene detection in the past, but because PCR hybridization comb can only be measured the target gene of pcr amplification, and needing in advance the PCR product to be carried out mark also needs strip is carried out special dyeing, so this technology is still quite complicated and time-consuming, can not be used for the target gene detection that the non-PCR amplification method is originated.
The object of the present invention is to provide a kind of quick, easy, responsive and special genetic test strip and preparation method thereof.
The present invention is made up of thieving paper, water-absorption fiber, nitrocellulose filter, absorbent filter and base plate.Thieving paper, water-absorption fiber, nitrocellulose filter, absorbent filter are bonded on the base plate successively; Be coated with the bond of gold mark mouse-anti DigiTAb-digoxigenin labeled oligonucleotide probe 1 on the water-absorption fiber, be coated with Streptavidin-biotin labeling oligonucleotide probe 2 bonds on the nitrocellulose filter, and sheep anti mouse polyclonal antibody and Streptavidin-biotin labeling oligonucleotide probe 3.
Its preparation method is:
1. preparation oligonucleotide probe
Directly with dna synthesizer synthetic oligonucleotide probe 1,2,3, the size of oligonucleotide probe 1,2,3 is the 17-40 base-pair.Oligonucleotide probe 1 and oligonucleotide probe 2 combine with the different piece of target gene respectively, and can not complementary combination between these two kinds of probes.Oligonucleotide probe 3 can not combine with target-gene sequence is complementary, can not with oligonucleotide probe 1 or oligonucleotide probe 2 complementary combinations.The target gene difference that detects, used probe 1,2,3 are also different, generally use probe to detect known gene at present.
2. preparation digoxin oligonucleotide probe 1-gold is marked mouse-anti DigiTAb bond
Use commercially available corresponding labelling kit that digoxin or biotin labeling oligonucleotide probe are directly carried out mark, digoxin (digixigenin-11-dUTP) or biotin are connected in the 3`-end or the 5`-end of oligonucleotides.
Prepare collaurum-mouse-anti DigiTAb bond according to a conventional method, the collaurum size is that 10-30nm presses final concentration 0.05-0.5 μ M with digoxin-oligonucleotide probe 1 and mixes with collaurum-mouse-anti DigiTAb bond, hatched 10-30 minute for 37 ℃, the bag quilt is in gold mark mouse-anti DigiTAb place is arranged, hatched 0.5-1 hour for 37 ℃, then with this solution 5-10 μ L point on water-absorption fiber.
3. prepare Streptavidin-biotin labeling oligonucleotide probe 2 and Streptavidin-biotin labeling oligonucleotide probe 3 bonds.
The oligonucleotide probe 3 of the oligonucleotide probe 2 of 50 μ l Streptavidins (10-30 μ g/ml) and 50 μ l biotins (10-30 μ g/ml) mark or 50 μ l biotins (10-30 μ g/ml) mark mixes 22 ℃--and 42 ℃ were reacted 30 minutes.
4. conventional method prepares Streptavidin-sheep anti mouse polyclonal antibody (IgG)
5. prepare the genetic test gold-marking test strip
Thieving paper, water-absorption fiber, nitrocellulose filter, absorbent filter are bonded on the base plate successively, and water-absorption fiber is partly put bag by gold mark mouse-anti DigiTAb-digoxigenin labeled oligonucleotide probe 1 bond; Become the wide lines of four treaty 0.3cm with Streptavidin-biotin labeling oligonucleotide probe 2 bonds (detection line), sheep anti mouse polyclonal antibody (positive control) and Streptavidin-biotin-oligonucleotide probe 3 bonds (negative control line) bag on the nitrocellulose filter, drying the back is bonded on the white plastic sheet after containing the albuminous phosphate buffer sealing of 10% NBCS drying successively, be cut into the bar of 0.3cm * 8cm, add the drying agent sealing and preserve.
Adopt this method also can make genetic quick diagnosis gold mark examination card or genetic quick diagnosis gold mark test plate (panel).
6. preparation hybridization buffer
Contain the 5g ficoll in 50 times of hybridization buffers, the 5g polyvinylpyrrolidone, bovine serum albumin(BSA) adds distilled water to 500ml.
Principle of the present invention: target gene combines with golden mark-mouse-anti DigiTAb-oligonucleotides gene probe 1 bond on the strip and then moves along nitrocellulose filter in the sample, be coated with Streptavidin-biotin (SA-Biotin) labeled oligonucleotide gene probe 2 bond places (detection line), form Streptavidin-biotin labeling oligonucleotide probe 2---target gene-gold mark anti-digoxin oligonucleotide probe 1 " centre-fills " and occur red line (probe 1 and probe 2 combine with the different parts of target gene respectively, and between the probe 1 and 2 not can in conjunction with).
The employed sandwich anti-phase film nucleic acid hybridization technique of product of the present invention, owing to adopted the two kinds of probes (probe 1 and probe 2) that combine with the target gene different parts, to compare its specificity higher with currently used nucleic acid hybridization technique; Product of the present invention has adopted Streptavidin-biotin amplification system, and is so its susceptibility is higher than common nucleic acid hybridization technique, suitable with PCR hybridization comb.Because product of the present invention does not need prior labels targets gene, the gold-marking immunity chromatographic technique of employing has saved staining procedure again; The anti-phase hybridization technique that adopts can make crossover process directly carry out on strip, so compare with PCR hybridization comb with common nucleic acid hybridization technique, operation steps is simpler, and the running time is shorter; Also do not need prior labels targets gene owing to product of the present invention, so it both had been applicable to that the target gene of PCR product detected the target gene detection that also is applicable to other source, and PCR hybridization comb can only be used for the target gene detection of PCR product; Product of the present invention is not only applicable to the genetic test of dna sample, is applicable to the genetic test of RNA sample yet.
Fig. 1 is a structural representation of the present invention
Introduce golden marking test strip for genetic quick diagnosis and basic preparation method below in detail.
As shown in Figure 1, the present invention is made up of thieving paper 1, water-absorption fiber 2, nitrocellulose filter 3, absorbent filter 4 and base plate 5.Thieving paper 1, water-absorption fiber 2, nitrocellulose filter 3, absorbent filter 4 are bonded on the base plate 5 successively.
Preparation method of the present invention is an example with the detection of hepatitis type B virus (HBV) cAg gene
Technological process:
1. the preparation of oligonucleotide probe
Directly with dna synthesizer synthetic oligonucleotide probe 1,2,3, the size of oligonucleotide probe 1,2,3 is the 17-40 base-pair.Oligonucleotide probe 1 and oligonucleotide probe 2 combine with the different piece of target gene respectively, and oligonucleotide probe 3 neither combines with the cAg gene order is complementary, also not with probe 1 or probe 2 complementary combinations.Detection with hepatitis type B virus (HBV) cAg gene is an example.The cAg gene of HBV is grown 552 base-pairs between gene order 482-1033 base.The sequence that designs its oligonucleotide probe 1 is CCTGTAACTGGGCATCTGGG; The sequence of oligonucleotide probe 2 is TAACAAGTGGAGTGGTATGT.Oligonucleotide probe 1 and oligonucleotide probe 2 respectively with the cAg gene in 485 to 505 base and 621 to 40 base complementrity combine, probe 1 and probe 2 can not complementary combinations.The sequence of oligonucleotide probe 3 is ATTCGCGGTTAGCCTATCTG, it neither with the cAg gene order also not with oligonucleotide probe 1 or oligonucleotide probe 2 complementary combinations.
2. preparation digoxin oligonucleotide probe 1-gold is marked mouse-anti DigiTAb bond
Use commercially available corresponding labelling kit that oligonucleotide probe is directly carried out digoxin or biotin labeling, digoxin (digixigenin-11-dUTP) or biotin are connected in the 3`-end or the 5`-end of oligonucleotides.Prepare collaurum-mouse-anti DigiTAb bond according to a conventional method, the collaurum size is 10-30nm, and concrete grammar is summarized as follows: with super tri-distilled water dissolved chlorine auric acid, making its ultimate density is 0.005-0.02%.Boil the every 100ml in back and add 0.5-1.5% trisodium citrate aqueous solution 1.5ml, continue to boil and rise 5 minutes.Use 0.1-0.3mol/L K after cooling
2CO
3Transfer to PH8.2.Stir mouse-anti DigiTAb (IgG) 1-3mg that adds purifying down fast, and continue to stir 15 minutes.Add bovine serum albumin(BSA) 200-280mg, stirred again 5 minutes, add the 10%NaCL aqueous solution at last and make that to contain NaCL concentration be 0.5-3%, behind the mixing centrifugal 10 minutes with 1000-3000r/min, abandon precipitation, supernatant was with the centrifugal 5-10 of 8000-15000r/min minute.The careful gold that goes supernatant, sediment to be preliminary purification of inhaling is marked anti-digoxin bond, is dissolved in (0.02mol/L in the stock solution, among the PH7.4 Tris-HCL, contain the PEG (polyglycols) of 20-60mg/100ml molecular weight 20000,40-70% glycerine, 0.01-0.03%NaN3) ,-20 ℃ preservation.
The oligonucleotide probe 1 of digoxigenin labeled is pressed final concentration 0.05-0.5 μ M to be mixed with gold mark mouse-anti DigiTAb, hatched 10-30 minute for 37 ℃, bag was hatched 0.5-1 hour for 37 ℃ by in gold mark mouse-anti DigiTAb place is arranged, then with this solution 5-10 μ L point on water-absorption fiber.
3. prepare Streptavidin-biotin labeling oligonucleotide probe 2 bonds and Streptavidin-biotin labeling oligonucleotide probe 3 bonds.
The oligonucleotide probe 3 of the oligonucleotide probe 2 of 50 μ l Streptavidins (10-30 μ g/ml) and 50 μ l biotins (10-30 μ g/ml) mark or 50 μ l biotins (10-30 μ g/ml) mark mixes, and 22 ℃ were reacted 30 minutes.
4. the preparation of Streptavidin-sheep anti mouse polyclonal antibody (IgG) bond
Carry out according to a conventional method.
5. prepare the genetic test gold-marking test strip
Test-strips is made up of thieving paper, water-absorption fiber, nitrocellulose filter and absorbent filter and base plate five parts thereof.Strip size 0.3cm * 8cm.Water-absorption fiber partly wraps by gold mark mouse-anti DigiTAb-digoxigenin labeled oligonucleotide probe 1 bond.Become the wide lines of four treaty 0.3cm with anti-Streptavidin-biotin labeling oligonucleotide probe 2 bonds (detection line), sheep anti mouse polyclonal antibody (positive control) and Streptavidin-biotin-oligonucleotide probe 3 bonds (negative control line) bag on the nitrocellulose membrane, dry the back and seal with the albuminous phosphate buffer of 10% NBCS.Be bonded at successively after the drying on the base plate (as the white plastic sheet etc.), be cut into the bar of 0.3cm * 8cm, add the drying agent sealing and preserve.
Adopt this method also can make genetic quick diagnosis gold mark examination card or genetic quick diagnosis gold mark test plate (panel).
6. preparation hybridization buffer
Contain the 5g ficoll in 50 times of hybridization buffers, 5g polyvinylpyrrolidone and bovine serum albumin(BSA) add distilled water to 500ml.
7. using method of the present invention
A. the preparation of target gene sample.DNA or RNA sample prepare according to a conventional method, also can further carry out polymerase chain reaction (PCR) to target gene.
B. make the target gene sex change according to a conventional method.
C. hybridization.20-40 μ l hybridization buffer adds 5-20 μ l target gene sample liquid and forms the hybridization mixed liquor, and gold-marking test strip gold mark end is inserted in this mixed liquor, hatches 5-15 minute for 37 ℃.
D. the result judges: red positive (the negative control line does not develop the color) appears in p-wire, positive control line simultaneously; It is false positive that p-wire and negative control line all show redness; Positive control line does not develop the color and is the strip inefficacy.
Claims (3)
1, a kind of golden marking test strip for genetic quick diagnosis, by thieving paper (1), water-absorption fiber (2), nitrocellulose filter (3), absorbent filter (4) and base plate (5) are formed, thieving paper (1), water-absorption fiber (2), nitrocellulose filter (3), absorbent filter (4) is bonded on the base plate (5) successively, it is characterized in that, be coated with gold mark mouse-anti DigiTAb-digoxigenin labeled oligonucleotide probe 1 bond on the water-absorption fiber (2), be coated with Streptavidin-biotin labeling oligonucleotide probe 2 bonds on the nitrocellulose filter (3), and sheep anti mouse polyclonal antibody and Streptavidin-biotin labeling oligonucleotide probe 3 bonds.
2, a kind of golden marking test strip for genetic quick diagnosis according to claim 1, it is characterized in that oligonucleotide probe 1 and oligonucleotide probe 2 can combine with the different parts of survey target-gene sequence is complementary, and oligonucleotide probe 3 does not combine with the survey target-gene sequence is complementary, oligonucleotide probe 3 also not with oligonucleotide probe 1 or 2 complementary combinations.
3, a kind of golden marking test strip for genetic quick diagnosis according to claim 1, its preparation method is:
3.1 preparation oligonucleotide probe
Directly carry out the synthetic of oligonucleotide probe 1,2,3 with the DNA instrument, the size of oligonucleotide probe 1,2,3 is the 17-40 base-pair, oligonucleotide probe 1 and oligonucleotide probe 2 combine with the different piece of target gene respectively, and can not complementary combination between these two kinds of probes, oligonucleotide probe 3 can not combine with target-gene sequence is complementary, can not with oligonucleotide probe 1 or oligonucleotide probe 2 complementary combinations;
3.2 preparation digoxin oligonucleotide probe 1-gold mark mouse-anti DigiTAb bond
Use commercially available corresponding labelling kit that oligonucleotide probe is directly carried out digoxin or biotin labeling, digoxin or biotin are connected in the 3`-end or the 5`-end of oligonucleotides, prepare collaurum-mouse-anti DigiTAb bond according to a conventional method, the collaurum size is 10-30nm, digoxin-oligonucleotide probe 1 is pressed final concentration 0.05-0.5 μ M to be mixed with collaurum-mouse-anti DigiTAb bond, hatched 10-30 minute for 37 ℃, the bag quilt is in gold mark mouse-anti DigiTAb place is arranged, hatched 0.5-1 hour for 37 ℃, then with this solution 5-10 μ L point on water-absorption fiber;
3.3 preparation Streptavidin-biotin labeling oligonucleotide probe 2 and Streptavidin-biotin labeling oligonucleotide probe 3 bonds
The oligonucleotide probe 3 of the oligonucleotide probe 2 of 50 μ l Streptavidins (10-30 μ g/ml) and 50 μ l biotins (10-30 μ g/ml) mark or 50 μ l biotins (10-30 μ g/ml) mark mixes 22 ℃--and 42 ℃ were reacted 30 minutes;
3.4 conventional method prepares Streptavidin-sheep anti mouse polyclonal antibody (IgG)
3.5 preparation genetic test gold-marking test strip
Thieving paper, water-absorption fiber, nitrocellulose filter, absorbent filter are bonded on the base plate successively, and water-absorption fiber partly wraps by gold mark mouse-anti DigiTAb-digoxigenin labeled oligonucleotide probe 1 bond; On nitrocellulose filter, Streptavidin-biotin labeling oligonucleotide probe 2 bonds (detection line), sheep anti mouse polyclonal antibody (positive control) and Streptavidin-biotin-oligonucleotide probe 3 bonds (negative control line) bag is become the wide lines of four treaty 0.3cm, dry the back with containing the albuminous phosphate buffer sealing of 10% NBCS, be bonded at successively after the drying on the base plate (as the white plastic sheet), be cut into the bar of 0.3cm * 8cm, add the drying agent sealing and preserve.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB991144031A CN1136319C (en) | 1999-08-23 | 1999-08-23 | Golden marking test strip for genetic quick diagnosis and its preparing process |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB991144031A CN1136319C (en) | 1999-08-23 | 1999-08-23 | Golden marking test strip for genetic quick diagnosis and its preparing process |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1249432A true CN1249432A (en) | 2000-04-05 |
| CN1136319C CN1136319C (en) | 2004-01-28 |
Family
ID=5277494
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB991144031A Expired - Fee Related CN1136319C (en) | 1999-08-23 | 1999-08-23 | Golden marking test strip for genetic quick diagnosis and its preparing process |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1136319C (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101717827B (en) * | 2009-12-09 | 2012-02-15 | 首都医科大学 | Method for detecting biotin-labeled DNA by utilizing mutual aggregation of colloidal gold |
| CN103389382A (en) * | 2013-08-07 | 2013-11-13 | 中国科学院广州生物医药与健康研究院 | Signal-enhanced test strip biosensor for detecting histone methylation |
| CN107922908A (en) * | 2015-08-26 | 2018-04-17 | 株式会社钟化 | Detection of nucleic acids equipment and nucleic acid detection method |
-
1999
- 1999-08-23 CN CNB991144031A patent/CN1136319C/en not_active Expired - Fee Related
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101717827B (en) * | 2009-12-09 | 2012-02-15 | 首都医科大学 | Method for detecting biotin-labeled DNA by utilizing mutual aggregation of colloidal gold |
| CN103389382A (en) * | 2013-08-07 | 2013-11-13 | 中国科学院广州生物医药与健康研究院 | Signal-enhanced test strip biosensor for detecting histone methylation |
| CN103389382B (en) * | 2013-08-07 | 2015-02-25 | 中国科学院广州生物医药与健康研究院 | Signal-enhanced test strip biosensor for detecting histone methylation |
| CN107922908A (en) * | 2015-08-26 | 2018-04-17 | 株式会社钟化 | Detection of nucleic acids equipment and nucleic acid detection method |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1136319C (en) | 2004-01-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP0779934B1 (en) | Compositions and methods for use in detection of analytes | |
| US20100167293A1 (en) | Digital Assay | |
| AU3860189A (en) | Method and reagents for detecting nucleic acid sequences | |
| US7517646B2 (en) | Functional molecule and process for producing the same | |
| CN113684317B (en) | Ultra-sensitive rapid detection and identification system for B type and C type hepatitis B virus based on CRISPR-Cas12B | |
| CN110607270A (en) | Method for jointly characterizing exosome membrane marker and RNA (ribonucleic acid) based on aptamer immune PCR (polymerase chain reaction) | |
| CN1472339A (en) | High-flux cell biological chip testing technology and reagent case | |
| DE69811614T2 (en) | METHOD FOR DETECTING A BIOLOGICAL MATERIAL, INPUT PHASE, DETECTION PHASE AND THESE REAGENTS CONTAINING IT | |
| CA2349810C (en) | Isometric primer extension method and kit for detection and quantification of specific nucleic acid | |
| CN113702641A (en) | One-pot nucleic acid-antibody co-detection method and application | |
| CN1136319C (en) | Golden marking test strip for genetic quick diagnosis and its preparing process | |
| US20010039012A1 (en) | Methods for diagnostic screening | |
| CN111235243A (en) | Quantitative method of tumor specific exosome/extracellular vesicle | |
| CN101403016A (en) | HBV viral antigen, ligand pipe PCR detection kit, preparation and uses thereof | |
| CN110387401A (en) | A kind of detection method of miRNA-21 | |
| Vary | Triple-helical capture assay for quantification of polymerase chain reaction products | |
| CN111334511B (en) | Aptamer for specifically recognizing bovine pregnancy-associated glycoprotein and application thereof | |
| CN113943776A (en) | Nucleic acid instant detection method based on personal blood glucose meter reading and kit thereof | |
| CN110643682A (en) | Signal amplification system, kit and method for DNA detection | |
| CN1285737C (en) | Process for testing SARS virus genome segment by silicon shell nano particle | |
| CN110749582B (en) | Preparation method and application of silicon carbide @ BSA-antibacterial peptide nanoprobe | |
| CN1435492A (en) | Chip for non-label detecting DNA bindin, preparation and use method thereof | |
| CN117904260B (en) | Liquid drop detection method based on CRISPR/Cas microfluidic chip for co-detection of single exosome protein and RNA | |
| CN115058426B (en) | Nucleic acid molecular probe for specifically recognizing SARS-CoV-19, screening method, detection product and application thereof | |
| CN100467612C (en) | Method for the simultaneous detection of hybridization and vaccination reactions and diagnostic uses thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C19 | Lapse of patent right due to non-payment of the annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |