CN1247786C - Methods for producing polypeptides in surfaction mutants of bacillus cells - Google Patents

Abstract

The present invention relates to methods of producing a polypeptide, comprising: (a) cultivating a mutant of a Baccillus cell, wherein the mutant (i) comprises a first nucleic acid sequence encoding the polypeptide and a second nucleic acid sequence comprising a modification of at least one of the genes responsible for the biosynthesis or secretion of a surfactin or isoform thereof under conditions conducive for the production of the polypeptide and (ii) the mutant produces less of the surfactin or isoform thereof than the Bacillus cell when cultured under the same conditions; and (b) isolating the polypeptide from the cultivation medium. The present invention also relates to mutants of Bacillus cells and methods for producing the mutants.

Description

In the surfaction mutants of bacillus cell, produce the method for polypeptide

Background of invention

Invention field

The present invention relates in a kind of bacillus cell mutant, produce the method for polypeptide, obtain the method and the bacillus cell mutant of bacillus cell mutant.

The explanation of correlation technique

Surfaction is a kind of cyclic lipopeptide, the good surfactant properties of tool.This material mainly produces (Carswell etc., 1994, applied microbiology and biotechnology 41:281-285 by good multiple genus bacillus in the stationary phase of growing; Lin etc., 1994, use and environmental microbiology 60:31-38; Morikawa etc., 1992, fermentation and biotechnology magazine 74:255-261; Arima etc., 1968, the research of biological chemistry biophysics exchanges 31:488-494).This lipopeptid contains seven amino acid, L-Glu-L-Leu-D-Leu-L-Val-L-Asp-D-Leu-L-Leu, it is connected by an amido linkage (carboxyl of lipid acid with the amino of L-glutamic acid between) and ester bond (between the hydroxyl of terminal leucic carboxyl and lipid acid) with 3-hydroxyl-13-methyl-TETRADECONIC ACID.Known that the fat chain length is homologous series (Hosono and Suzuki, 1983, the microbiotic magazine 36:667-673 of 13,14 and 15 carbon atoms; Razafindralambo etc., 1993, chromatography magazine 639:81-85), and different being called respectively of the 7th or the 4th amino acids [Val7]-, [Ile7]-and isotype (Peypoux etc., 1994, the European biochemical magazine 224:89-96 of [Ala4]-surfaction; Baugmart etc., 1991, the research of biological chemistry biophysics exchanges 177:998-1005).

It is reported, be responsible for the non-ribosomal biosynthesizing of passing through so-called sulphur template mechanism of surfaction by a kind of multienzyme complex of srf operon coding.This operon contains at least four genes: srfA, srfB, srfC and srfD.These four genes were called respectively in the past: srfAA, srfAB, srfAC and srfAD.SrfA, the synthetase subunit unit of srfB and srfC coding surfaction, each subunit all includes one or more amino acid activation structural domains, these structural domains are essential (Van Sinderen etc. for the substrate amino acid that activates surfaction to produce surfaction, 1993, molecular microbiology 8:833-841; Nakano and Zuber, 1989, bacteriology magazine 8:821-831:Cosmina etc., 1993, molecular microbiology 8:821-831).This multienzyme complex is combined into seven big structural domains, and they are clustered in (Menkhaus etc., 1993, journal of biological chemistry 268:7678-7684 on three protein that separate; Gulli etc., Biochimica et Biophysica Acta 1205:19-28).These seven structural domains are responsible for activating and in conjunction with the seven amino acid of surfaction.According to sulphur template mechanism, the adenosineization of specific amino acids and combination occur in corresponding amino acid activation district, and this process needs cofactor 4-phosphopantetheine.Trans thioester reaction subsequently progressively prolongs peptide chain, and sequence order is determined by the spatial disposition of all multienzyme subunit.It is not immediately clear fatty acid part is when to reach how to be connected on the peptide chain, does not know ester bond is how to form yet, and then makes what molecular change circularized.And gene sfp also is considered to participate in the expression (secretion) (Nakano etc., 1992, molecule General Genetics 232:313-323) of surfaction.

Genus bacillus is a host cell systems well that set up, that be used to produce natural and recombinant protein.But the genus bacillus host with desired protein expression and secretion increasing characteristic might not just possess the characteristic that successfully fermentation is expected.Particularly, owing to be accompanied by the increase of biomass, the corresponding increase of foam meeting, thereby fermentation may not be best.Bubbling increases the productivity that has limited fermentation.

Thereby one object of the present invention just provides improved genus bacillus host, and it had both had the proteinic ability of the commercial quantities of expression, and fermentation character as one wishes is arranged again, and is very fast long and bubble lessly such as growth, thereby strengthened fermentative production power.

Summary of the invention

The present invention relates to produce the method for polypeptide, this method comprises: (a) helping producing the mutant of cultivating bacillus cell under the condition of polypeptide, wherein, (i) this mutant comprises two kinds of nucleotide sequences, first kind of nucleic acid sequence encoding polypeptide wherein, second kind of nucleotide sequence comprises is responsible for surfaction or the biosynthesizing of its isotype or the modification of at least one gene of excretory, when (ii) under equal conditions cultivating, surfaction or its isotype that this mutant is produced are lower than bacillus cell; (b) isolated polypeptide from nutrient solution.

The present invention also relates to the mutant of bacillus cell and the method for producing the bacillus cell mutant.

The accompanying drawing summary

Fig. 1 represents the restriction endonuclease map of pShv2.

Fig. 2 represents the restriction endonuclease map of pSJ3200.

Fig. 3 represents the restriction endonuclease map of pSJ2662.

Fig. 4 represents the structure of amyQ promotor-amyM genetic fusant among the pSJ2882-MCS.

Fig. 5 represents the restriction endonuclease map of pPL2419.

Fig. 6 represents the restriction endonuclease map of pCAsub2.

Fig. 7 represents the restriction endonuclease map of pBAN-NOV.

Fig. 8 represents the restriction endonuclease map of pPL2541-tet.

Detailed Description Of The Invention

The present invention relates to produce the method for polypeptide, the method comprises: (a) be conducive to produce polypeptide Cultivate the mutant of bacillus cell under the condition, wherein, (i) this mutant relates to responsible withered grass bacterium At least one gene of the biosynthesis of lipopeptid or its isotype or secretion is modified (as destroying) Bacillus cell, when (ii) under equal conditions cultivating, the surfaction that this mutant is produced or Its isotype lacks than bacillus cell; (b) isolated polypeptide from nutrient solution.

Term " surfaction " is defined as a kind of annular lipopeptid, wherein amino acid sequence herein L-Glu-L-Leu-D-Leu-L-Val-L-Asp-D-Leu-L-Leu and chain length are 13 to 15 carbon The straight or branched b-hydroxy fatty acid of atom links to each other. Term " isotype " is defined as withered herein The variant of grass bacterium lipopeptid, one or more amino acid residues are by different amino acid residue institutes in it Replace, for example [Val7]-, [Ile7]-and [Ala4]-surfaction.

In the inventive method, bacillus cell can be wild-type bacillus cell or its mutant.The available bacillus cell is including, but not limited to Alkaliphilic bacillus, bacillus amyloliquefaciens, bacillus brevis in the embodiment of the present invention, Bacillus circulans, Bacillus coagulans, bacillus firmus, bacillus lautus, bacillus lentus, Bacillus licheniformis, bacillus megaterium, bacillus pumilus, bacstearothermophilus, the cell of subtilis and bacillus thuringiensis.In preferred embodiments, this bacillus cell is a bacillus amyloliquefaciens, bacillus lentus, Bacillus licheniformis, bacstearothermophilus or bacillus subtilis mycetocyte.In a more preferred embodiment, this bacillus cell is subtilis ATCC 6051 or 6051A, perhaps subtilis NCFB736 (being NCDO736 originally).

Can use insertion well known in the art or deletion method, be responsible for surfaction or its isotype biosynthesizing or the one or more genes of excretory, be built into the bacillus cell mutant by reducing or eliminating.For example, in one of them gene, insert the integrated plasmid contain with the nucleic acid fragment of this dna homolog, this homology zone is produced repeat, and carrier DNA is inserted between the iteron, like this, can destroy this gene.If the carrier DNA that inserts separates gene promoter and coding region or has interrupted the coding region, cause producing the non-functional gene product, then can eliminate genetic expression.In addition, also can modify biosynthesizing or the favourable or essential one or more control sequences (as promotor) of the one or more genetic expressions of excretory of being responsible for surfaction or its isotype.Perhaps, reducing or eliminating also of genetic expression can be by genetic modification method (referring to, as Iglesias and Trautner, 1983, molecule General Genetics 189:73-76) or by the gene substitution method.In one method of back, the mutant form of this gene is incorporated in the plasmid that do not duplicate or temperature sensitive, this plasmid is connected with selective marker.Not allowing under the condition of plasmid replication, by can finish selection to the selection of mark to plasmid integration.The forfeiture by checking selective marker in the bacterium colony and the acquisition of mutator gene can select the reorganization second time that produces gene substitution (referring to, as Perego, 1993, A.L.Sonneshein, J.A., Hoch and R.Losick write, subtilis and other gram positive bacterium, 42 chapters, American Academy Of Microbiology, Washington, D.C., 1993).Have again, reduce or eliminate to be responsible for the surfaction biosynthesizing or the one or more expression of gene of excretory also can use method well known to those skilled in the art to realize that by random mutagenesis these methods include, but are not limited to swivel base and chemomorphosis.

Also can make up the bacillus cell mutant, to produce the variant or the isotype of surfaction.Variant or isotype and from natural origin the difference between isolating this peptide be that variant is non-foaming, or have the tensio-active agent characteristics of attenuating.Modification to the nucleotide sequence of being responsible for the biosynthetic one or more genes of surfaction can realize by method well known in the art, for example, replace the heterozygous genes of structural domain coding region with the peptide synthetase that makes up the coded amino acid specificity and change to some extent, and the peptide of the aminoacid sequence of generation tool modified (referring to, as Stachelhaus etc., 1995, science 269:60-72).In the present invention further, amino acid whose replacement can produce the negative phenotype of surfaction, as replace with L-Ala Serine (D ' Souza etc., 1993, bacteriology magazine, 175:3502-3510; Vollenbroich etc., 1993, FEBS Letter325:220-224; Stachelhaus etc., 1995, the same).Can be based on the nucleotide sequence of being responsible for the biosynthetic all genes of surfaction, can produce the different aminoacids sequence and the Nucleotide of non-natural surfaction molecule aminoacid sequence is replaced and made up similar nucleotide sequence by introducing.The general elaboration that nucleic acid is replaced is referring to as Ford etc., and 1991, protein expression and purifying 2:95-107.

Those skilled in the art know obviously that all this replacement can occur in the very important zone of molecular function or outside the zone.Can confirm the amino-acid residue that those are very important to the surfactant properties of this peptide according to method well-known to those skilled in the art, this method for example be site-directed mutagenesis or alanine scanning mutagenesis (referring to, as Cunningham and Wells, 1989, science 244:1081-1085).In one technology of back, introduce sudden change at each residue place of this molecule, detect the surfactant activity of gained mutating molecule, to confirm the amino-acid residue very important to the activity of this molecule.

In method of the present invention, can modify being responsible for surfaction or its isotype biosynthesizing or any gene of excretory in the bacillus cell.For example, the gene of modification can be any gene in the srf operon, as srfA, and srfB, srfC and srfD.Perhaps, can modifying factor sfp.

Further, can modify among the present invention and be responsible for fatty acid part is connected on this peptide, or be responsible for forming ester bond to generate the gene of ring molecule, not had the genus bacillus mutant cells of bubbling character.

Again further, among the present invention, the mutant of bacillus cell can also contain and may reclaim or use the disappearance or the insertion of deleterious other gene to the production of polypeptide.For example, in preferred embodiments, this bacillus cell can be the cell of protein enzyme disappearance.In another embodiment preferred, this bacillus cell does not produce gemma, as the disappearance owing to spoIIAC.Also can lack production, recovery or use deleterious other gene, as the amyE gene polypeptide.

In the method for the invention, when mutant of the present invention is cultivated under the condition that helps polypeptide production, have non-foaming or lower blistered characteristic.The available method well known to those skilled in the art of the amount of the surfaction of bacillus cell mutant of the present invention production determine (referring to, as Ohno etc., 1995, biotechnology and physiotechnology 47:209-214 and Grossman etc., 1993, bacteriology magazine 175:6203-6211).Under equal working condition, the preferred mutant cell is low at least more about 25% than the surfaction output of corresponding parent's bacillus cell, and is more preferably low at least about 50%, also will be more preferably low at least about 75%, and most preferably at least low about 95%.Under equal working condition, compared with corresponding parent's bacillus cell, the polypeptide output of preferred mutant cell is many at least about 25%, and is more preferably many at least about 50%, also will be more preferably many at least about 75%, and most preferably at least many about 95%.

Use method well known in the art, culturing cell in the nutritional medium that is fit to polypeptide production.For example, can be at suitable expression of polypeptides or/and under the isolating condition, in suitable medium, through shake-flask culture, a small amount of or bulk fermentation in laboratory or the industrial fermentation jar (comprises and continuously fermenting, batch fermentation, fed-batch fermentation, or solid state fermentation) culturing cell.Cultivation is to contain carbon source, in the suitable culture medium of nitrogenous source and inorganic salt, is undertaken by method well known in the art.Suitable culture medium can also can be prepared (as the catalogue of American type culture collection) according to the composition of having delivered available from commercial supplier.The excretory polypeptide can directly reclaim from substratum.

Use the method for special detection polypeptide well known in the art can detect polypeptide.These detection methods can comprise the antibody that utilization is special, form the enzyme product, the disappearance of enzyme substrates, or SDS-polyacrylamide gel electrophoresis.For example, available enzyme measures to determine polypeptide active.The activity determination method of many enzymes is known in the art.

The polypeptide that produces can separate with method well known in the art.As, available ordinary method isolated polypeptide from nutritional medium, these methods including, but not limited to: centrifugal, filter, extract, the spraying blackberry lily is dry, evaporation, or precipitation.Use various chromatography methods can the polypeptide that separation obtains be further purified, as ion exchange chromatography, gel permeation chromatography, affinity chromatography etc.

Available many method purified polypeptides well known in the art, these methods including, but not limited to: chromatography method (as ion exchange chromatography, affinity chromatography, hydrophobic chromatography, chromatofocusing, and size exclusion chromatography), electrophoresis method (as the isoelectrofocusing (IEF) of preparation property), difference solvability (as ammonium sulfate precipitation), perhaps extract (referring to, as " protein purification ", J.-C.Janson and LarsRyden write, VCH Publishers, New York, 1989).

Described polypeptide can be any polypeptide.In addition, this polypeptide can be the natural or heterologous polypeptide of bacillus cell.Term " polypeptide " is not meant the coded product of length-specific here, thereby comprises peptide, oligopeptides and protein.Term " polypeptide " also comprises combines two or more polypeptide that form coded product.Term " polypeptide " also comprises hybrid polypeptide, and it comprises and derives from least two kinds of not combinations of the part or all of peptide sequence of homopolypeptide, described at least two kinds not one or more in the homopolypeptide may be the heterologous polypeptide of bacillus cell.Polypeptide also comprises the natural allele variant or the through engineering approaches variant of aforementioned polypeptide and hybrid polypeptide.

Preferably, this polypeptide is a hormone, hormone variant, enzyme, acceptor or its part, antibody or its part, or reporter molecule.In a more preferred embodiment, this polypeptide is an oxydo-reductase, transferring enzyme, lytic enzyme, lyase, isomerase, or ligase enzyme.In a more preferred embodiment, this polypeptide is an aminopeptidase, amylase, carbohydrase, carboxypeptidase, catalase, cellulase, chitinase, keratinization enzyme, cyclodextrin glycosyltransferase, deoxyribonuclease, esterase, alpha-galactosidase, beta-galactosidase enzymes, glucoamylase, alpha-glucosidase, beta-glucosidase enzyme, saccharase, laccase, lipase, mannosidase, MUTANASE (mutanase), oxydase, pectin decomposing enzyme, peroxidase, phytase, polyphenoloxidase, proteolytic enzyme, rnase, trans-glutaminases (transglutaminase) or zytase.

In the methods of the invention, described bacillus cell mutant can be a reconstitution cell, wherein comprises the nucleotide sequence of the heterologous polypeptide of encoding, and this cell can be advantageously used in the recombinant production of polypeptide.Preferably, integrate this carrier then in karyomit(e) to transit cell go into to include the to encode carrier of nucleotide sequence of this heterologous polypeptide." conversion " means and introduce the carrier that contains second kind of nucleotide sequence in host cell, makes this carrier keep as carrier outside the karyomit(e) of chromosomal intasome or energy self-replacation.Integrate and be considered to more favourable usually, because in this case, this nucleotide sequence is more likely kept at cell inner stablity.By homologous recombination, non-homogeneous reorganization or swivel base, vector integration is in karyomit(e).

The nucleotide sequence of coding heterologous polypeptide can derive from protokaryon, and eucaryon or other source are as archeobacteria.Among the present invention, specify the used term in source " to derive from " with regard to one and be meant that this polypeptide is produced by this source, or by having inserted from the cell generation of the gene in this source.

In the methods of the invention, the bacillus cell mutant also can be used in the recombinant production of bacillus cell natural polypeptides.Natural polypeptides is recombinant production by the following method, gene as this polypeptide of will encoding places different promotor control down, to increase this polypeptide expression, utilize signal sequence to make the purpose natural polypeptides output to the extracellular, and increase the copy number of the gene of peptide more than the coding genus bacillus ordinary production.In the scope of application of term " heterologous polypeptide ", the present invention also comprises the recombinant production of homeopeptide, wherein this expression relates to the natural genic use of non-this genus bacillus, or the use of natural element processed and that play a role with very square formula in the host cell.

Be used to separate or the technology of the nucleotide sequence of clones coding heterologous polypeptide is known in the art, comprise the separation in genomic dna, the preparation in cDNA, or its combination.Cloning nucleic acid sequences can use the polymerase chain reaction of knowing (PCR) to finish from this genomic dna.Referring to, as Innis etc., 1990, PCR scheme: methods and applications Guide Book, AcademicPress, New York.The cutting that cloning process can relate to the required nucleic acid fragment that comprises the nucleic acid encoding sequence with separate, this fragment is inserted in the carrier molecule, with this recombinant vectors is incorporated in the bacillus cell, wherein the multiple copied of this nucleotide sequence or clone will be duplicated.This nucleotide sequence can be a genome, cDNA, and RNA, semisynthetic, synthetic, or its arbitrary combination.

In the method for the present invention, heterologous polypeptide also can comprise fusion polypeptide, and wherein another polypeptide merges at N-end or C-end mutually with described polypeptide or its fragment.Can produce fusion polypeptide by the nucleotide sequence (or its part) of the peptide species of will encoding and nucleotide sequence (or its part) fusion of another polypeptide of coding.The technology that produces fusion polypeptide is known in the art, comprises the encoding sequence that connects all polypeptide of coding, so that their frame unanimities, and the expression of fusion polypeptide is controlled by identical promoters or terminator.

" nucleic acid construct " is defined as a kind of strand or double-stranded nucleic acid molecule herein, and it separates from naturally occurring gene, or has been contained several nucleic acid fragments by modification, and these fragments make up and combine in natural and non-existent mode.When nucleic acid construct comprises encoding sequence of the present invention and expresses all required control sequences, term " nucleic acid construct " may with term expression cassette synonym.Ding Yi " encoding sequence " is meant the sequence that can be transcribed into mRNA under the control that places aforementioned control sequence and be translated as polypeptide of the present invention here.The border of encoding sequence generally by 5 '-translation stop codon of translation initiation codon ATG and the 3 '-end of end is sub to be determined.Encoding sequence can be including, but not limited to DNA, cDNA and recombinant nucleic acid sequence.

Separating the nucleic acid encoding sequence that obtains can process with several different methods, so that its express polypeptide.According to the difference of expression vector, it may be that expect or necessary operating on it before being inserted into nucleotide sequence in the carrier.The technology of utilization cloning process modification of nucleic acids sequence is known in the art.

The nucleic acid construct that comprises the nucleotide sequence of coded polypeptide can be connected with one or more control sequences effectively, and described control sequence can instruct the expression of encoding sequence in the bacillus cell mutant under the condition compatible with it.

Essential or the favourable all components of the expression of encoding sequence in the term " control sequence " of this definition comprises nucleotide sequence.Each control sequence can be the natural or exogenous array of the nucleotide sequence of coded polypeptide.These control sequences are including, but not limited to leader sequence, promotor, signal sequence and transcription terminator.The bottom line control sequence comprises promotor, transcribes and the translation termination signal.Also can add joint in the control sequence,, be convenient to being connected between the coding region of control sequence and the nucleotide sequence of coded polypeptide to introduce the specific limited restriction enzyme site.

Control sequence can be suitable promoter sequence, can be discerned to express a kind of nucleotide sequence of described nucleotide sequence by bacillus cell.Promoter sequence contains transcriptional control sequence, can mediate expression of polypeptides.Promotor can be the arbitrary nucleotide sequence that shows transcriptional activity in selected bacillus cell, can get in own coding and bacillus cell homology or the allogenic cell or the gene of extracellular polypeptide.The example that can instruct nucleic acid construct of the present invention to transcribe the suitable promotor of (particularly in bacillus cell) is to derive from following promotor: intestinal bacteria lac operon, streptomyces coelicolor gelase gene (dagA), subtilis left side ficoll enzyme (levansucrase) gene (sacB), bacillus licheniformis alpha-amylase gene (amyL), bacstearothermophilus maltose source amylase gene (amyM), bacillus amyloliquefaciens alpha-amylase gene (amyQ), Bacillus licheniformis penicillinase gene (penP), subtilis xylA and xylB gene, with protokaryon β-Nei Xiananmei gene (Villa-Kamaroff etc., 1978, the journal 75:3727-3731 of NAS), and tac promotor (DeBoer etc., 1983, the journal 80:21-25 of NAS).More promoter region has description below in the article: " deriving from the useful proteins matter of recombinant bacteria ", Scientific Beauty compatriots, 1980,242:74-94; With Sambrook etc., 1989, the source is the same.

Control sequence also can be one section suitable Transcription Termination subsequence, can be discerned the sequence of transcribing to stop by bacillus cell.The terminator sequence is connected to 3 ' end of nucleic acid encoding sequence effectively.In selected bacillus cell, there is any terminator of function all to can be used among the present invention.

Control sequence also can be one section suitable leader sequence, promptly among the mRNA bacillus cell is translated very important non-translational region.Leader sequence is connected to 5 ' end of nucleic acid encoding sequence effectively.In selected bacillus cell, there is any leader sequence of function all to can be used among the present invention.

Control sequence also can be a segment signal peptide-coding region, and the aminoacid sequence that its coding is connected with the aminoterminal of polypeptide can instruct express polypeptide to enter the Secretory Pathway of cell.Signal peptide coding region can be the natural zone of polypeptide of the present invention, also can derive from external source.5 ' the terminal segment signal peptide-coding region that self can contain of nucleic acid sequence encoding sequence, frame is as one man natural links to each other in the coding region part translation of this coding region and coding secrete polypeptide.Perhaps, 5 ' of the encoding sequence terminal signal peptide coding region that self can contain allos in the encoding sequence part of coding secrete polypeptide.Encoding sequence may not need the external source signal peptide coding region when normally not containing signal peptide coding region.Perhaps, the external source signal peptide coding region can replace the natural signals peptide-coding region simply, and purpose is to compare with the common relevant natural signals peptide-coding region of encoding sequence, can strengthen the secretion of polypeptide more.Signal peptide coding region can derive from amylase or the proteinase gene of genus bacillus.But any signal peptide coding region that can instruct express polypeptide to enter selected bacillus cell Secretory Pathway all can be used for the present invention.

Effectively signal peptide coding region is the signal peptide coding region that derives from following gene in bacillus cell: the maltose source amylase gene of genus bacillus NCIB 11837, the bacstearothermophilus alpha-amylase gene, Bacillus licheniformis subtilisin gene, Bacillus licheniformis β-Nei Xiananmei gene, bacstearothermophilus neutral protease gene (nprT, nprS, nprM) and subtilis prsA gene.More signal peptide is described visible Simonen and Palva, and 1993, microbiology comment 57:109-137.

In the method for the invention, comprise nucleotide sequence, promotor and transcribe and the recombinant expression vector of translation termination signal can be used for the recombinant production of polypeptide.Various nucleotide sequence recited above and control sequence can be used in combination to produce recombinant expression vector, and this carrier can contain one or more restriction sites easily, make to insert or to replace the nucleic acid encoding sequence in these sites.Perhaps, nucleotide sequence or the nucleic acid construct that contains this sequence can be inserted into and express this nucleotide sequence in the suitable expression vector.During construction of expression vector, encoding sequence is placed carrier, encoding sequence is connected with the suitable control sequence that is used for expressing with secretion (if possible) effectively.

Recombinant expression vector can be any carrier that can carry out the recombinant DNA operation easily and nucleotide sequence is expressed.The selection of carrier is depended on carrier usually and will be imported consistency between the bacillus cell of carrier.Carrier can be linear or the closed loop plasmid.Carrier can be an autonomously replicationg vector, just can exist, it duplicates the carrier that does not rely on chromosome duplication as the outer entity of karyomit(e), and as plasmid, extra-chromosomal element, minichromosome, or artificial chromosome.Carrier can contain any composition of guaranteeing self-replacation.Perhaps, carrier can be can be incorporated in the genome when introducing bacillus cell, and the carrier that together duplicates of the karyomit(e) that is integrated into it.Carrier system can be single carrier or plasmid, also can be to lump together to contain two or more carriers of global DNA or the plasmid that is introduced in the bacillus cell genome, or transposon.

When being incorporated into bacillus cell, carrier may be incorporated in the bacillus cell genome.In order to integrate, carrier may depend on other element of nucleic acid encoding sequence or carrier, so that carrier stably is incorporated in the genome by homologous recombination.Perhaps, carrier may contain extra nucleotide sequence, is incorporated in the genome of bacillus cell by homologous recombination to instruct it.Extra nucleotide sequence makes carrier to be incorporated in the bacillus cell genome in chromosomal accurate position.Be to improve the possibility of integrating in accurate position, integrate the nucleic acid that composition preferably should contain enough numbers, as 100 to 1500bp, preferably 400 to 1500bp, most preferably be 800 to 1500bp, and with corresponding target sequence height homology, to increase the probability of homologous recombination.Integrate composition and can be with the bacillus cell genome in any sequence of target sequence homologous.In addition, integrating composition can be the nucleotide sequence of encoding or not encoding.

In order to carry out self-replicating, carrier can also comprise a replication orgin so that carrier can research bacillus cell in self-replicating.The example of bacterium replication orgin is the plasmid pBR322 that can duplicate in intestinal bacteria, pUC19, the replication orgin of pACYC177 and pACYC184 and the pUB110 that can duplicate in genus bacillus, pE194, the replication orgin of pTA1060 and pAM β 1.Replication orgin can contain the sudden change that can make its function become responsive to temperature type in bacillus cell (referring to, as Ehrlich, 1978, the journal 75:1433 of NAS).

The nucleotide sequence that surpasses the code book invention polypeptide of a copy can be inserted in the bacillus cell, to increase the expression of this nucleotide sequence.Stably amplifying nucleic acid sequence can make things convenient for method to be described in WO94/14968 by using method well known in the art that at least one extra copy of this sequence is incorporated in the bacillus cell genome and selecting transformant to reach of amplifying genom DNA sequence.

Carrier preferably contains one or more alternative marks, so that select transformant easily.Alternative mark is a gene, and its product has the biocide resistance, heavy metal resistance, and for auxotroph provides prototroph, or the like.The example of the alternative mark of bacterium is the dal gene of subtilis or Bacillus licheniformis, or gives antibiotics resistance, as penicillin resistance, and kalamycin resistance, erythromycin resistance, chlorampenicol resistant, or the mark of tetracyclin resistance.In addition, can use cotransformation to reach the selection purpose, like in WO91/09129, set forth the same, wherein alternative mark is positioned on another carrier that separates.

Each composition of foregoing connection with the method that makes up recombinant expression vector of the present invention be well known to those skilled in the art (referring to, as Sambrook etc., 1989, the same).

The conversion of bacillus cell can be undertaken by several different methods, for example, protoplast transformation (referring to, as Chang and Cohen, 1979, molecule General Genetics 168:111-115), utilize competent cell (referring to, as Young and Spizizin, 1961, bacteriology magazine 81:823-829, or Dubnau and Davidoff-Abelson, 1971, molecular biology magazine 56:209-221), electroporation (referring to, as Shigekawa and Dower, 1988, biotechnology 6:742-751), perhaps engage (referring to, as Shigekawa and Thorne, 1987, bacteriology magazine 169:5271-5278).

The present invention is by further setting forth in the following examples, but these embodiment should not be interpreted into and limit the scope of the present invention.

Embodiment

All (AppliedBiosystems Inc.Foster City C.A.), synthesizes according to the explanation of manufacturer at applying biological system model 394 synthesizers for all primers and oligomer.

Embodiment 1: the structure of subtilis F+strain BW154

All there are several genes (spoIIAC, aprE, nprE, amyE, and srfC) to be lacked among subtilis host strain A164 described here (ATCC6051A) and 1630 (NCFB736).In order to finish this task, utilize the mating system (Koehler and Thorn, 1987, see before) of pLS20 mediation, in these bacterial strains, imported the plasmid of the disappearance form that contains these genes.In brief, this system comprises subtilis " donor " bacterial strain that contains big plasmid pLS20.The pLS20 coding migrates to the necessary function of subtilis F-strain with pLS20.In addition, known plasmid such as pUB110 and pBC16 also can be moved by this mating system (in the presence of pLS20).These plasmids contain cis acting district (oriT) and coding acts on the oriT site and promotes the gene (orf-beta) of these plasmids to the transactivation function of F-strain transfer.If F+strain contains in the two any of pLS20 and pUB110 and pBC16, the plasmid that then only contains oriT also can be by migration (at this moment, the orf-beta function is provided by trans).

Effectively F+strain must contain plasmid pLS20 or its derive plasmid such as pXO503 (Koehler and Thorne, 1987, see before).In addition, also wish after joint is finished, to have the method for anti-screening F+strain.A kind of very " totally " (no background) and anti-screening scheme easy to implement have been developed.This relates in the dal of F+strain gene (encoding cell wall synthesizes required D-alanine racemase) and to import disappearance and will engage experiment back gained cell mixture coated plate on the solid medium that L-Ala lacks and F+strain is screened (subtilis dal-bacterial strain can only could be grown) in the substratum that has added the external source L-Ala.

For the gene of being mentioned above lacking, pE194 replicon (erythromycin the resistance) (Gryczan etc. that must will contain the disappearance form of these genes, 1982, " bacteriology magazine " 152:722-735) and the oriT sequence transfer in bacillus subtilis A 16 4 and the A1630 bacterial strain.Suitable F+strain should have following feature: 1) the dal gene lacks (screening for counter), with 2) it also must contain plasmid pLS20 (this moment pXO503 inapplicable, because the pE194 replicon must keep by the erythromycin screening, and pXO503 has given the resistance to erythromycin), and pUB110 or pBC16 provide orf-beta function with trans.How relevant subtilis BW154 is configured to being described below of F+strain.

(A) in subtilis, import the dal deletion mutantion, obtain subtilis BW96.

At first, select to have in the bac-1 gene bacillus subtilis strain (this transgenation makes bacterial strain lose the ability of synthetic two peptide antibiotic tetaines) of sudden change, because the front is stated, in engaging process, wild-type bacillus subtilis mycetocyte can kill other kinds genus bacillus, and this potential lethality then reduces greatly in the bac-1-cell.Therefore, all F+strains all make up under the bac-1 background.

The first step that makes up suitable F+strain is the part of the middle dal gene of bacillus subtilis strain 1A758 (Bacillus Stock Center, Colombia, Ohio) of bac-1 for the disappearance background.External structure can replace the dal genetically deficient form of wild-type dal gene on the bacterial chromosome.Utilize pcr amplification to obtain 5 ' and 3 ' part of dal gene, primer 1 and 2 is used for increasing 5 ' partly (the Nucleotide 19-419, the A of ATG codon are+1) of this gene, primer 3 and 4 be used for increasing 3 ' partly (Nucleotide 618-1037) of this gene.

Primer 1:5 '-GAGCTCACAGAGATACGTGGGC-3 ' (SEQ ID NO:1)

Primer 2: 5 '- GGATCCACACCAAGTCTGTTCAT-3 ' (SEQ IDNO:2) (the line part is the BamHI site)

Primer 3:5 '- GGATCCGCTGGACTCCGGCTG-3 ' (SEQ ID NO:3) (the line part is the BamHI site)

Primer 4:5 '- AAGCTTATCTCATCCATGGAAA-3 ' (SEQ ID NO:4) (the line part is the HindIII site)

Amplified reaction (100 μ l) contains following component: 200ng subtilis 168 chromosomal DNAs, each primer concentration is 0.5 μ M, dATP, dCTP, dGTP, dTTP concentration respectively are 200 μ M, 1 * Taq polymerase buffer, and 1U Taq archaeal dna polymerase.According to Pitcher etc., 1989, the described method of applied microbiology communication 8:151-156 obtains the chromosomal DNA of subtilis 168.Reaction conditions is as follows: 95 ℃ 3 minutes, and then carry out 30 circulations, each cycling program is 95 ℃ 1 minute, 50 ℃ 1 minute and 72 ℃ 1 minute, be at last 72 ℃ 5 minutes.Reaction product detects through agarose gel electrophoresis.According to manufacturer's operation indication, utilize TA clone's test kit (Invitrogen, San Diego, California) with 5 ' and 3 ' PCR product cloning to the pCRII carrier.Identify and contain dal gene 5 ' end half and the BamHI site that imports by the PCR primer pCRII clone adjacent (among the clone of other direction between the BamHI site at a distance of much far away) with the BamHI site of pCRII carrier polylinker.Contain dal gene 3 ' with BamHI and HindIII digestion then and hold the pCRII clone of half, again with this dal gene fragment clone to aforementioned half pCRII clone's the BamHI-HindIII site of dal gene 5 ' end of containing, the pCRII carrier that is produced like this contains the dal gene that the middle part has lacked about 200bp, 5 ' end at this gene has a NotI site (part of pCRII polylinker), and 3 ' end is the HindIII site.

For this dal disappearance is imported bacterial chromosome, this missing gene is cloned among the subtilis responsive to temperature type replicon pE194 (Gryczan etc., 1982, see before).Should lack in the dal gene importing karyomit(e) through two steps then: at first by homologous recombination with this plasmid integration to karyomit(e) dal site, then remove plasmid (still passing through homologous recombination) again, make the disappearance form of dal gene still be retained on the bacterial chromosome.This can finish through the following steps: should lack dal gene fragment (as above-mentioned) and be cloned into responsive to temperature type plasmid pSK ⁺The NotI-HindIII site of/pE194 (comes down to substitute pSK with dal Δ fragment ⁺The carrier sequence).Plasmid pSK ⁺The construction process of/pE194 is as follows: digest BluescriptSK with XbaI enzyme cutting ⁺(Stratagene, La Jolla CA) and pE194, handle pSK with calf intestine alkaline phosphatase then ⁺Carrier couples together two plasmids again.With connecting mixture transformed into escherichia coli bacterial strain DH5 α, transformant is at the enterprising row filter of LB substratum that contains penbritin (100 μ g/ml) and X-gal.From several " white " bacterium colonies, be purified into plasmid, utilize restriction digest and gel electrophoresis subsequently to identify and contain pE194 and pSK ⁺Mosaic.Digest this plasmid with HindIII and NotI.Gel-purified contains the fragment of pE194 replicon then, and is connected to same on the dal of gel-purified Δ gene fragment (HindIII-NotI).Connect product and be used to transform subtilis bac-1 bacterial strain 1A758 (Bacillus Stock Center, brother's human relations Columbus, OH), and in containing Tryptones blood agar alkali (TBAB) flat board of erythromycin (5mg/ml), select transformant, under 34 ℃ of permissive temperatures, cultivate.From 5 erythromycin resistance transformant, be purified into plasmid, and through restriction digest/gel electrophoresis analysis.Identify plasmid corresponding to the pE194 that contains the dal deletion fragment.The bacterial strain that has this plasmid is used to import the dal disappearance by homologous recombination in karyomit(e) subsequently.

In order to obtain to exchange first (in the dal gene of dal disappearance plasmid integration to the karyomit(e)), will transform bacterial strain and on the TBAB flat board that contains D-L-Ala (0.1mg/ml) and erythromycin (5 μ g/ml), rule, in 45 ℃ of following grow overnight of non-permissive temperature.Get a macrocolony and under the same terms, rule once more, obtain being integrated with in the dal gene on the karyomit(e) homogeneous colony of the cell of responsive to temperature type plasmid.Under non-permissive temperature, because therefore plasmid reproducible not only could grow on the erythromycin flat board at the cell that contains this plasmid on the karyomit(e).(cause plasmid to cut out in order to obtain the incident of exchange for the second time from karyomit(e), only stay the disappearance form of dal gene), one garland cells is transferred to 20ml to be contained in the Luria nutrient solution of D-L-Ala (0.1mg/ml), under 34 ℃ of permissive temperatures, do not have and select to grow to the logarithm later stage, so that replication orgin keeps function, and the incident of exchange for the second time takes place.Cell shifts (the each transfer diluted 100 times) again four times, so that plasmid excises and separates from colony from karyomit(e).At last, cell 34 ℃ of following coated plates on the TBAB flat board that is added with D-L-Ala (0.1mg/ml) to grow single bacterium colony, and the bacterium colony trace is transferred on the TBAB flat board of no D-L-Ala (0.1mg/ml) and has on the TBAB flat board of D-L-Ala (0.1mg/ml) and erythromycin (5 μ g/ml), so that to dal-and erm ^SEnumeration.There are 2 to have this phenotype in 50 bacterium colonies.With obtained strains called after subtilis BW96, this is a kind of bac-1, the dal-bacterial strain.

(B) pLS20 and pBC16 are imported subtilis bac-1, dal deletion mycopremna, obtain engaging effective F+strain subtilis BW154.

Select a kind of F+strain, be used for importing pLS20 and pBC16 plasmid to subtilis BW96, this F+strain should have following feature: this bacillus subtilis strain that contains pLS20 and pBC16 as the erythromycin-sensitive type (for the anti-screening of antagonism F+strain is provided).The dal disappearance bacillus subtilis strain of a kind of pLS20 of containing and pBC16 is chosen as suitable F+strain, its structure is as follows: with pHV1248 (Petit etc., 1990, " bacteriology magazine " 172:6736-6740) transforms subtilis DN1686 (U.S. Patent number 4,920,048), make cell obtain the erythromycin resistance.By with the conjugal transfer of subtilis (natto) 3335UM8 (Koehlr and Thorne, 1987, see before), joint element pLS20 and plasmid pBC16 are transferred in subtilis DN1686 (pHV1248) bacterial strain together.The transconjugant that screening obtains is tsiklomitsin and the erythromycin resistance bacterium colony that contains the dal deletion mutantion.They are marked to the ability of other bacillus subtilis strain by conjugal transfer pBC16 according to the bacterium colony that has pLS20.At last, by improving culture temperature to 50 ℃, make that engaging bacterial strain loses pHV1248, thereby obtain F+strain: the subtilis DN1686 that contains pLS20 and pBC16.

For these plasmids are imported among the subtilis BW96, must carry out appropriate anti-screening, therefore, with the responsive to temperature type plasmid pSK that invests the erythromycin resistance ⁺/ pE194 transforms subtilis BW96, and it can be removed under the temperature by growing in non-fair being permitted forever subsequently.According to following program, pLS20 and pBC16 are migrated to subtilis BW96 (have pSK from the subtilis DN1686 that contains pLS20 and pBC16 ⁺/ pE194) in.Every type of cell got the amount of a transfering loop, mixes to be coated on the TBAB flat board that has added D-L-Ala (50 μ g/ml) 33 ℃ of following incubations 5 hours.Scrape from flat board and to get cell, be transferred in the 1ml LB substratum.Multiple dilution cell is layered on added tsiklomitsin (10 μ g/ml), on the TBAB flat board of erythromycin (5 μ g/ml) and D-L-Ala (50 μ g/ml), 34 ℃ of growths have obtained also to have obtained under pBC16 and the many situations recipient cell of pLS20 with screening.Whether also be present in arbitrary transconjugant in order to detect pLS20, tested the ability of ten colony lift pBC16 to the subtilis PL1801.Subtilis PL1801 be the subtilis 168 that lacked apr and npr gene (genus bacillus storage center, Columbus, OH).Yet, also available subtilis 168.The donor that can move pBC16 necessarily also contains pLS20.(contain pLS20 and pBC16 and pSK in case identify the bacterial strain that can effectively engage ⁺The bac-1 of/pE194, the dal-subtilis), by in the LB substratum that has added tsiklomitsin (5 μ g/ml) and D-L-Ala (50 μ g/ml) in 45 ℃ of proliferative cells that spend the night, be plated on the TBAB flat board that has added D-L-Ala (50 μ g/ml) to obtain single bacterium colony at 33 ℃, and identify erythromycin-sensitive type bacterium colony, can from this bacterial strain, remove pSK ⁺/ pE194 plasmid.This program produces subtilis BW154, promptly contains the bac-1 of pLS20 and pBC16, the dal-subtilis.

Table 1 short summary each Bacillus strain and plasmid.

Table 1: Bacillus strain and plasmid

Bacillus subtilis strain:

Subtilis (natto) pLS20

DN1686 dal-

DN1280 dal-

MT101 DN1280(pXO503)

1A758 168bac-1 is (in the genus bacillus storage

The heart, Columbus, Ohio)

BW96 1A758dalΔ

BW97 1A758dalΔ∷cat(pXO503)

BW99 1A758dalΔ(pPL2541-tet)

BW100 1A758dalΔ(pXO503)，(pXL2541-tet)

PL1801 aprΔ，nprΔ

Plasmid:

pBC16 Mob ⁺，Tcr

The pE194 responsive to temperature type

pLS20 Tra ⁺

pXO503 Tra ⁺，MLS ^r(＝pLS20∷Tn917)

pPL2541-tet Mob ⁺，Tc ^?r(pE194ts?ori)

pCAsub2 Mob ⁺，Cm ^r，Ap ^r，(pE194 ^-ts?ori)

PSK ⁺/ pE194 Em ^r, Ap ^r, responsive to temperature type

PShv2 Tra ⁺, Em ^r, Cm ^r, responsive to temperature type

PHV1248 Em ^r, responsive to temperature type

Tra ⁺Represent that this plasmid invests the ability that arbitrary bacillus subtilis strain of carrying it engages, that is to say that this is plasmid-encoded to be transferred to the required repertoire of recipient cell with a mating type plasmid from donorcells.

Mob ⁺The expression plasmid can be contained Tra ⁺The bacterial strain of plasmid (pLS20 or pXO503) shifts by joint.This plasmid must contain cis acting sequence and the coding proteic gene of trans-acting (for example being respectively oriT and orf-beta in pBC16), or oriT sequence (pPL254-tet for example only arranged, the plasmid that at this moment the trans off-beta of providing function also must be provided in the cell is as pBC16).

Embodiment 2: the disappearance of spoIIAC gene in the bacillus subtilis A 16 4 (ATCC 6051A)

Utilize overlapping extension to shear (SOE) technology (Horton etc., 1989, " gene " 77:61-68), generate the disappearance form of spoIIAC gene, this genes encoding sigmaF makes cell by the sporulation II phase.Utilize the method for Pitcher etc. (1989, the source is the same) to obtain the chromosomal DNA of bacillus subtilis A 16 4 (ATCC6051A).The synthetic primer of listing below 5 and 6 is with the zone from 205 Nucleotide of spoIIAC gene A TG upstream from start codon to 209 Nucleotide in ATG starting point downstream on the chromosomal DNA that is used for pcr amplification bacillus subtilis A 16 4.The HindIII site of the underscore Nucleotide of upstream primer for adding.The underscore Nucleotide of downstream primer and 507 to the 524 bit base complementations of ATG translation initiation codon downstream.Synthetic primer 7 and 8 is to be used for pcr amplification ATG translation initiation codon downstream from 507 sequence area that extend to 884 Nucleotide.The underscore district of primer 7 is complementary fully with 3 ' end parts of the segmental primer 6 in upstream that is used to increase.

Primer 5:5 '- AAGCTTAGGCATTACAGATC-3 ' (SEQ ID NO:5)

Primer 6:5 '- CGGATCTCCGTCATTTTCCAGCCCGATGCAGCC-3 ' (SEQ ID NO:6)

Primer 7:5 '- GGCTGCATCGGGCTGGAAAATGACGGAGATCCG-3 ' (SEQ ID NO:7)

Primer 8:5 '-GATCACATCTTTCGGTGG-3 ' (SEQ ID NO:8)

In pcr amplification separately, use increase the respectively upstream and downstream fragment of spoIIAC gene of this two covers primer.Amplification reaction system (25 μ l) contains following component: 200ng bacillus subtilis A 16 4 chromosomal DNAs, every primer 0.5 μ M, dATP, dCTP, dGTP and dTTP respectively are 200 μ M, 1 * Taq dna polymerase buffer liquid, and the TaqDNA polysaccharase of 0.625U.Reaction conditions is as follows: 96 ℃ 3 minutes, then successively by 96 ℃ 1 minute, 50 ℃ of 1 minute and 72 ℃ were that 30 circulations are carried out in a circulation in 1 minute, at last again 72 ℃ 3 minutes to guarantee that the amplified fragments end adds VITAMIN B4 (Invitrogene, San Diego, the California).The amplification of target product is proved conclusively through 1.5% agarose gel electrophoresis.

Containing each 2.5 μ l of above-mentioned every kind of amplified reaction product then, and except only being added with primer 5 and 8, finish amplification in the same new PCR reaction system of other reaction conditions, obtain " shearing " fragment that length is 1089 Nucleotide, represent the inner spoIIAC gene that lacks 298 Nucleotide.Utilize Invitrogen TA clone test kit, the operation indication according to the manufacturer to the pCRII carrier, cuts out this fragment cloning as the HindIII-EcoRI fragment, be cloned among the pShv2 that digested with HindIII/EcoRI again.PShv2 is a shuttle vectors, by containing the pBCSK of pUB110 oriT ⁺(Stratagene, La Jolla, California) XbaI enzyme cutting fragment is connected with pE194 (Fig. 1) XbaI enzyme cutting fragment, is connected into from the oriT fragment that contains SstI consistency end that goes out through pcr amplification of pUB110 again and is built into.By the joint (Battisti etc., 1985, bacteriology magazine 162:543-550) of pLS20 mediation, the oriT fragment makes this plasmid migrate in the bacillus subtilis A 16 4.PShv2-Δ spoIIAC is changed over to F+strain subtilis BW154 (embodiment 1).Subtilis BW154 (pShv2-Δ spoIIAC) is used as F+strain, imports this and have the shuttle vectors of missing gene in bacillus subtilis A 16 4.

The subtilis BW154 of pShv2-Δ spoIIAC and engaging of bacillus subtilis A 16 4 are arranged by commentaries on classics, screening erythromycin resistance transconjugant, and, can realize the exchange between missing gene and complete chromogene in 45 ℃ of cultivations.Under 45 ℃, the pE194 replicon does not have activity, and cell can only be integrated by the Campbell of plasmid in the spoIIAC site that contains missing gene could keep the erythromycin resistance.By at 34 ℃, promptly allow under the temperature of pE194 replicon functionating, in the LB substratum that antibiotic-free is selected, cultivate the bacterial strain two-wheeled, finish reorganization for the second time, cause carrier DNA to come off (loopout), and missing gene has substituted complete spoIIAC gene.Go out producer alternate bacterium colony according to following Standard Selection: 1) erythromycin (erm) the resistance disappearance of shuttle vectors pShv2 coding, 2) the bacterium colony opaqueness reduces on the sporulation substratum, show and can not produce spore and 3) can obtain the fragment of 791 Nucleotide rather than 1089 Nucleotide that this gene does not lack form with primer 5 and 8 through pcr amplification.

The disappearance of nprE gene among the embodiment 3 bacillus subtilis A 16s 4 Δ spoIIAC

Prepare bacillus subtilis A 16 4 Δ spoIIAC chromosomal DNAs template according to embodiment 2 described methods, utilize following primer 9 and 10, pcr amplification goes out the upstream portion sequence (40-610 position, GTG initiator codon downstream Nucleotide) of neutral protease (nprE) gene.Utilize following primer 11 and 12, go out the downstream part (Nucleotide 1040-1560) of nprE gene through pcr amplification.Primer 10 and 11 is designed to have 15 base pairs overlapping (underscore part) in two fragments.Amplification reaction system (25 μ l) contains embodiment 2 described same composition, and finishes under the same conditions.

Primer 9:5 '-CGTTTATGAGTTTATCAATC-3 ' (SEQ ID NO:9)

Primer 10:5 '- AGACTTCCCAGTTTGCAGGT-3 ' (SEQ ID NO:10)

Primer 11:5 '- CAAACTGGGAAGTCTCGACGGTTCATTCTTCTCTC-3 ' (SEQ ID NO:11)

Primer 12:5 '-TCCAACAGCATTCCAGGCTG-3 ' (SEQ ID NO:12)

With reference to manufacturer's operation indication, the upstream and downstream fragment that is increased is carried out gel-purified with QiaexII test kit (Qiagen, Chatsworth, California).In containing the new PCR mixture of every kind of each about 20ng of purifying fragment (100 μ l), react.Following condition is used for carrying out the SOE reaction: press the condition of embodiment 2, do not add primer earlier and carry out 1-3 circulation, produce " montage " fragment, carry out 4-30 circulation again under the condition that adds primer 9 and 12.The SOE fragment that is increased is cloned into pCRII carrier, and carries out the restricted enzyme cutting analysis conclusive evidence.This fragment is advanced pShv2 as the BamHI-XhoI fragment cloning subsequently.This plasmid, pShv2-Δ nprE is transformed among the subtilis BW154, obtains the suitable F+strain that can be used for engaging.This plasmid is migrated among the bacillus subtilis A 16 4 Δ spoIIAC subsequently.Utilize embodiment 2 described temperature inversion methods, Δ nprE gene is introduced on the karyomit(e) of bacillus subtilis A 16 4 Δ spoIIAC.The ermS bacterium colony is coated on the TBAB agar plate that is added with 1% skim-milk, 37 ℃ of grow overnight, thus the nprE-phenotype is marked.(the limpid band of nprE-bacterial strain significantly weakens.) utilize primer 9 and 12 to carry out the pcr analysis of chromosomal DNA, confirming has 430 base pairs deleted.

Embodiment 4: the disappearance of aprE gene among the bacillus subtilis A 16 4 Δ spoIIAC Δ nprE

Utilize the SOE method to produce the disappearance form of the aprE gene of coding alkaline withered grass lysin (subtillisin) proteolytic enzyme in the subtilis.According to embodiment 2 described methods, utilize following primer 13 and 14, pcr amplification goes out the upstream portion sequence of aprE gene from bacillus subtilis A 16 4 chromosomal DNAs, obtains from the translation initiation codon upstream fragment of 189 Nucleotide to 328 Nucleotide in starting point downstream.The EcoRI site of Nucleotide for adding of band underscore in the primer 13.The Nucleotide place of band underscore is added with the SaII site in the primer 14, and provides complementary for the downstream PCR fragment.Select primer 15 and 16 for use, go out the downstream part sequence of aprE gene, obtain from a fragment of 789 Nucleotide to 1306 Nucleotide in aprE translation initiation codon downstream through pcr amplification.The zone of band underscore provides complementation in primer 14 and the primer 15 for upstream fragment and downstream sheet are intersegmental.The underscore Nucleotide of primer 16 has added the HindIII site.Amplification reaction system (25 μ l) contains the 2 described same composition as embodiment, and carries out under the same conditions.

Primer 13:5 '-GC GAATTCTACCTAAATAGAGATAAAATC-3 ' (SEQ ID NO:13)

Primer 14:5 '- GTTTACCGCACCTACGTCGACCCTGTGTAGCCTTGA-3 ' (SEQ ID NO:14)

Primer 15:5 '- TCAAGGCTACACAGGGTCGACGTAGGTGCGGTAAAC-3 ' (SEQ ID NO:15)

Primer 16:5 '-GC AAGCTTGACAGAGAACAGAGAAGCCAG-3 ' (SEQ ID NO:16)

Operation indication with reference to the manufacturer utilizes Qiaquick PCR purification kit (Qiagen, Chatsworth, California) to be purified into the upstream and downstream fragment that amplification obtains.Utilize primer 13 montage of two kinds of purifying fragments to be in the same place then with 16.Except chromosomal DNA substituted with upstream and each 2 μ l of downstream PCR product, amplification reaction system (50 μ l) contained component as hereinbefore.Reaction is carried out 30 circulations then earlier in 1 circulation of 96 ℃ of 3 minutes incubations (no dNTPs and Taq polysaccharase), each cycling program be 96 ℃ 1 minute again 72 ℃ 1 minute.Produced the disappearance form of 460 Nucleotide in disappearance coding region among the aprE like this.Reaction product is separated through agarose electrophoresis, is cloned among the pCRII, cuts out with the EcoRI-HindIII fragment, is cloned in the pShv2 carrier of EcoRI/HindIII digestion again, obtains pShv2-Δ aprE.This plasmid is imported in the above-described F+strain, is used for conjugal transfer to bacillus subtilis A 16 4 Δ spoIIAC Δ nprE.

According to the deletion method of the above spoIIAC and nprE, replace the aprE gene with missing gene.Utilize the erythromycin-sensitive type and, select the bacterium colony that the aprE gene has been lacked the weakening of the TBAB agar plate supernatant bright band that is added with 1% skim-milk upper strata.The disappearance of AprE is proved conclusively through PCR.

Bacillus subtilis A 16 4 Δ spoIIAC Δ nprE Δ aprE are called as bacillus subtilis A 16 4 Δs 3 here.

Embodiment 5: the disappearance of amyE gene among the bacillus subtilis A 16 4 Δ spoIIAC Δ nprE Δ aprE

Utilize the SOE method to produce the disappearance form of the amyE gene of coding subtilis α-Dian Fenmei.Utilize following primer 17 and 18 from bacillus subtilis A 16 4 chromosomal DNAs, to amplify the upstream portion sequence of amyE, obtain extending to the dna fragmentation of the 77th Nucleotide in amyE coding region from 421 Nucleotide in amyE translation initiation codon upstream, and be added with the SalI site at upstream termination, be added with SfiI and NotI site at downstream end.Select primer 19 and 20 for use, go out the downstream part sequence of amyE gene, obtain the fragment of the 445th Nucleotide to 953 Nucleotide, and be added with SfiI and NotI site, be added with the HindIII site at downstream end at upstream termination from the amyE coding region through pcr amplification.Restriction enzyme site marks with underscore.Amplification reaction system (25 μ l) contains the 2 described same composition with embodiment, and carries out under the same conditions.

Utilize primer 17 and 20 by PCR with two bar segment montages.Except chromosomal DNA wherein was replaced by each 2 μ l of upstream and downstream PCR product, amplification reaction system (25 μ l) contained component as hereinbefore.Reaction is carried out 30 circulations then earlier in 1 circulation of 96 ℃ of 3 minutes incubations (no dNTPs and Taq polysaccharase), each cycling program be 96 ℃ 1 minute again 72 ℃ 1 minute.This reaction is merged this two fragment the amyE fragment that obtains lacking 367 Nucleotide in coding region and imported SfiI and NotI site between two portions sequence of amyE by two fragments in overlapping (SfiI and the NotI site) in complementation district.Carry out 1% agarose gel electrophoresis according to standard method, isolate reaction product.With reference to manufacturer's operation indication, this fragment cloning to pCRII, is produced pCRII-Δ amyE.

Primer 17:5 '-C GTCGACGCCTTTGCGGTAGTGGTGCTT-3 ' (SEQ ID NO:17) (line place is the SalI site)

Primer 18:5 '-C GCGGCCGCA GGCCCTTAAGGCCAGAACCAAATGAA-3 ' (SEQ ID NO:18) (line place is NotI and SfiI site)

Primer 19:5 '-T GGCCTTAAGGGCCT GCGGCCGCGATTTCCAATG-3 ' (SEQ ID NO:19) (line place is SfiI and NotI site)

Primer 2 0:5 '-G AAGCTTCTTCATCATCATTGGCATACG-3 ' (SEQ ID NO:20) (line place is the HindIII site)

Digest pShv2 with NotI, mend flat sticky end with Klenow fragment and dNTP, and reconnect this plasmid, obtain pShv2.1.This step has been destroyed the NotI site of pShv2.Go up fragment from pCRII-Δ amyE, be cloned among the pShv2.1 with SalI and HindIII double digestion, obtain pShv2.1-Δ amyE with SalI-HindIII form cutting-out absence type amyE.This plasmid is imported subtilis BW154, so that conjugal transfer is to bacillus subtilis A 16 4 Δ spoIIAC Δ nprE Δ aprE.

With regard to spoIIAC, the described method of nprE and aprE substitutes the amyE gene with missing gene according to above.Utilize erythromycin-sensitive and lose the ability that on the flat board that is added with Celeste starch top layer, produces limpid band, select producer alternate bacterium colony.By utilizing the primer 17 and the 20 pairs of chromosomal DNAs to carry out the pcr amplification of this missing gene, confirm the disappearance of amyE gene.

Embodiment 6: the srfC gene among the disappearance bacillus subtilis A 16 4 Δ spoIIAC Δ nprE Δ aprE Δ amyE obtains bacillus subtilis A 16 4 Δ spoIIAC Δ nprE Δ aprE Δ amyE Δ srfC

Synthesize following primer 2 1-24, be used to lack the srfC gene of surfaction operon.Already present HindIII site (underscore) has overlappingly in primer 21 and the srfC gene, matches with primer 22, can go out from the dna fragmentation of 410 Nucleotide to 848 Nucleotide in srfC translation starting point downstream by pcr amplification.The underscore part and the 1709-1725 position Nucleotide complementation of ATG initiator codon downstream of primer 22.Go out the zone of 1709 to 2212 Nucleotide in srfC translation starting point downstream with primer 23 and 24 usefulness pcr amplifications.The underscore part and the 835-848 position Nucleotide complementation of ATG codon downstream of primer 23.Amplification reaction system (25 μ l) contains the 2 described identical components with embodiment, and carries out under the same conditions.

Primer 2 1:5 '- AAGCTTTGAATGGGTGTGG-3 ' (SEQ ID NO:21)

Primer 2 2:5 '- CCGCTTGTTCTTTCATCCCCTGAAACAACTGTACCG-3 ' (SEQ ID NO:22)

Primer 2 3:5 '- CAGTTGTTTCAGGGGATGAAAGAACAAGCGGCTG-3 ' (SEQ ID NO:23)

Primer 2 4:5 '-CTGACATGAGGCACTGAC-3 ' (SEQ ID NO:24)

Utilize the centrifugal post of Qiagen PCR (Qiagen, Chatsworth, California), from the PCR product, remove primer and other pollutent.The intersegmental complementarity of two sheets that produces through PCR makes and can finish montage by SOE.Except that preceding 3 circulations were carried out before adding primer, to extend outside the overlap, other PCR condition is identical with the above, adds " outer end primer "-primer 21 and 24, and PCR product (every kind 2 μ l or about 50ng) montage is arrived together.The length that obtains lacking inner 859 Nucleotide of srfC gene through SOE reaction is the fragment of 955 Nucleotide.The part that the srfC gene is lacked is responsible for adding seven amino acid (being leucine) to the surfaction molecule, its disappearance further causes the phase shift mutation of gene, cause peptide before the zone of similar thioesterase avtive spot, to stop, and infer that this zone participates in the proteic surfaction of SrfC and discharges (Cosmina etc., 1993, see before).

According to above with regard to spoIIAC, nprE, the deletion method that aprE and amyE address substitutes the srfC gene with missing gene.Utilize the erythromycin-sensitive feature and lose on blood agar plate the ability (Grossman etc., 1993, bacteriology magazine 175:6203-6211) that produces limpid band, and contain 10% sucrose, 4% soyflour, 0.42% anhydrous Na being added with 50ml ₂HPO ₄And 0.5%CaCO ₃And the 250ml that adds the PS-1 substratum of 5 μ g/ml paraxin shakes in the bottle, and 37 ℃, 250rpm cultivated 4 days, lacks foamy and produces, and selects producer alternate bacterium colony.Utilize primer 21 and 24, pcr amplification missing gene from chromosomal DNA, conclusive evidence srfC gene lacks.

Bacillus subtilis A 16 4 Δ spoIIAC Δ nprE Δ aprE Δ amyE Δ srfC are called as bacillus subtilis A 16 4 Δs 5 here.

Embodiment 7: the structure of bacillus subtilis A 16 30 Δ spoIIAC Δ nprE Δ aprE Δ amyE Δ srfC

According to embodiment 1-6 with regard to the described same program of bacillus subtilis A 16 4 Δ spoIIAC Δ nprE Δ aprE Δ amyE Δ srfC (bacillus subtilis A 16 4 Δs 5), be utilized as the constructed all disappearance plasmids of bacillus subtilis A 16 4 disappearances, construct bacillus subtilis A 16 30 Δ spoIIAC Δ nprE Δ aprE Δ amyE Δ srfC from bacillus subtilis A 16 30 (NCFB736 is once called as NCDO736).

Bacillus subtilis A 16 30 Δ spoIIAC Δ nprE Δ aprE Δ amyE Δ srfC are called as bacillus subtilis A 16 30 Δs 5 here.

Embodiment 8: structure is used for amyQ promotor-amyM is transcribed the carrier that box is integrated into bacillus subtilis A 16 4 bacterial strains

At the bacillus amyloliquefaciens amylase (BAN that and then encodes ^TM, Novo NordiskA/S, Bagsverd, Denmark) the promotor downstream of amyQ gene import NOVAMYL ^TM(amyM) gene and its natural ribosome bind site are built into and transcribe syzygy.Utilize following primer 25 and 26, with embodiment 2 described identical conditions under, pcr amplification goes out amyQ gene promoter (BAN ^TMPromotor), and be cloned on the pCRII carrier, order-checking conclusive evidence does not have the amplification mistake, is connected to then in the multiple clone site with SfiI and the SstI couple of intestinal bacteria-genus bacillus shuttle vectors pHP13-ampMCS that cut.

Primer 2 5:5 '-TTT GGCCTTAAGGGCCTGCA ATCGATTGTTTGAGAAAAGAAG-3 ' (underscore partly is respectively SfiI and ClaI site) (SEQ ID NO:25)

Primer 2 6:5 ' TTT GAGCTCCATTTTCTTATACAAATTATATTTTACATATCAG-3 ' (underscore partly is the SstI site) (SEQ ID NO:26)

Cut pUC19 with the AatII enzyme, Klenow fragment and deoxyribonucleotide are cut with the HindIII enzyme after mending and putting down again, construct the variant pHP13-ampMCS of pHP13 (Haima etc., 1987, " MGG " 209:335-342).With Qiaex test kit (Qiagen, Thousand Oaks, California) the 2.2kb fragment that gel-purified is bigger.PHP13 cuts through HpaI (cutting in erythromycin resistance gene) enzyme, mends and puts down, and cuts with the HindIII enzyme again.To big fragment be connected from the 3.0Kb of pHP13 then with the 2.1Kb pUC9 fragment that contains pUC9 replication orgin and ampicillin resistance gene.At last, at 50mM NaCl, among 10mM Tris pH7.5 and the 1mM EDTA, following two kinds of oligonucleotide 27 and 28 each 100pmol are boiled boil 5 minutes, during 2 hours, slowly be chilled to room temperature then, thereby anneal, obtain new multiple clone site (MCS), and with the multiple clone site of its alternative pUC9.

Oligomer 27:5 '-AGCTAGGCCTTAAGGGCCCGGGACGTCGAGCTCAAGCTTGCGGCCGCCATGGTCGA CG-3 ' (SEQ ID NO:27)

Oligomer 28:5 '-AATTCGTCGACCATGGCGGCCGCAAGCTTGAGCTCGACGTCCCGGGCCCTTAAGGC C-3 ' (SEQ ID NO:28)

Owing to be used for pcr amplification BAN ^TM(amyQ) primer of promotor has imported SfiI and SstI site, transcribes syzygy in order to make up, must be at NOVAMYL ^TM(amyM) the open reading frame upstream imports the SstI site.Therefore, design contains 5 ' PCR primer (following primer 2 7) of SstI joint, makes itself and NOVAMYL ^TM(amyM) 4 Nucleotide in ribosome bind site upstream can be annealed.The position of this PCR primer is close to the downstream of a potential hairpin structure, therefore it can be omitted in amplification step.Under embodiment 2 described conditions, make template DNA with 200ng pSJ3200 (Fig. 2), utilize with PvuII site eclipsed PCR primer (following primer 2 8) and contain the combination of primers in SstI site, amplify the NOVAMYL that encodes ^TMThe fragment of terminal 327 Nucleotide of N-.

Primer 2 9:5 '-CT GAGCTCTACGAAAGGAGACACACATGC-3 ' (being scribed ss the SstI site) (SEQ ID NO:29)

Primer 30:5 '-ACGCC CAGCTGTTTAAGATAAG-3 ' (being scribed ss the PvuII site) (SEQ ID NO:30)

With NOVAMYL ^TMGene constructs pSJ3200 plasmid (Fig. 2) in deriving plasmid pSJ2662 (Fig. 3) as the PstI-BglII fragment cloning to the pUB110 that contains big multiple clone site.

In order to rebuild the amyM gene, the fragment of 327 Nucleotide that will obtain through pcr amplification cuts out as the SstI-PvuII fragment, and is connected among the pUC118 that cuts with SstI with 3-fragment ways of connecting with downstream 2.2Kb PvuII-SstI fragment (latter half of coding amyM).Then the amyM gene that rebuilds is cut out as the SstI fragment, clone amyQ promotor downstream contained in pSJ2882-MCS.Fig. 4 has summed up these clone's steps.PSJ2882-MCS is from pHP13 (Haima etc., 1987, molecule General Genetics 209:335-342), but contains the multiple clone site that two ends are SifI-NotI, also has the 0.5Kb SstI fragment that contains from the oriT district of pUB110.Back one fragment makes and can plasmid be migrated to (Battisti etc., 1985, bacteriology magazine 162:543-550) in the bacillus subtilis A 16 4 by the joint of pLS-20 mediation.

The ligation thing is directly changed among the subtilis PL1801spoIIE.Occur on the Celeste starch flat board that contains 5 μ g/ml paraxin or lack the bacterium colony of being with haloing according to being grown in, confirm that the amyM open reading frame is with respect to the proper orientation of amyQ promotor among the pSJ2882-MCS.

In order to make up integrative vector pCAsub2, downcut the neomycin resistance gene of pPL2419 (Fig. 5) with BclI and BglII digestion, and replace BamHI fragment (the Young man etc. that contain E.C. 2.3.1.28 (cat) gene on the pMI 1101,1984, plasmid 12:1-9), obtain plasmid pPL2419-cat.(BamHI sticky end and BclI are compatible with the BglII sticky end).Then, by at 50mM NaCl, 10mM Tris pH7.5, mix following two kinds of oligonucleotide (SEQ ID NO:31 and SEQ ID NO:32) among the 1mM EDTA, every kind of each 100pmol boils and boils 5 minutes, slowly cool to room temperature through time again above 2 hours, and, obtain containing the new multiple clone site in SfiI and NotI site with these two kinds of oligonucleotide annealing, be used for substituting the multiple clone site (MCS) of pPL2419-cat.

5 '- AGCTTGGCCTTAAGGGCCCGATATCGGATCC GCGGCCGCTGCA GGTAC-3 ' (underscore is represented the compatible site with KpnI of HindIII, and a following stroke two-wire is represented SfiI and NotI site) (SEQ ID NO:31)

5’-CTGCAGCGGCCGCGGATCCGATATCGGGCCCTTAAGGCCA-3’(SEQ?ID?NO：32)

Annealed oligonucleotide (2 μ l) is connected in the pPL2419-cat (0.2 μ g) of HindIII and KpnI incision, obtains p2419MCS5-cat.Then, utilize bacillus subtilis strain A164 Δ 5 chromosomal DNAs (as described in embodiment 2, making) to make template, the following primer (SEQ ID NO:33 and SEQ ID NO:34) that contains NotI and KpnI (Asp718) joint, as described in embodiment 2, pcr amplification amyE (GenBank Locus BSAMYL, acceptance V00101, J01547) 942 to 1751 Nucleotide, and insert in the p2419MCS5 of NotI and Asp718 digestion, obtain integrative vector pCAsub2 (Fig. 6), CAsub is meant chlorampenicol resistant, and the amylase homologue is used for bacillus subtilis mushroom host.

5 '- GCGGCCGCGATTTCCAATGAG-3 ' (the NotI site of line part expression design) (SEQ ID NO:33)

5 '- GGTACCTGCATTTGCCAGCAC-3 ' (the Asp718I site of line part expression design) (SEQ ID NO:34)

This carrier is integrated into alone in the subtilis 168, and coated plate illustrates amylase activity and completely loses on Celeste starch top layer flat board.

AmyQ promotor-amyM construction is cut out from pSJ2882-MCS as the SfiI-NotI box, be cloned among the pCAcub2 that cuts with same enzyme, obtain fully integrated carrier pBAN-NOV (Fig. 7).

Embodiment 9: make up subtilis F+strain BW100

Structure can keep and move " slave's type " integrated plasmid based on pE194, the suitable F+strain of pCAsub2 as described in example 8 above (give chlorampenicol resistant and contain oriT).This F+strain should have following feature: bac-1-, the dal-disappearance, contain pLS20 or pX0503 and (contain oriT and orf-beta based on " assisting " plasmid of pE194, with migration " assisting " and " slave's type " plasmid, also contain repF, provide repF albumen with trans, thereby make that " slave's type " plasmid can duplicate and keep as plasmid replicon) (WO91/09129).This strain construction is as follows: can provide the helper plasmid pPL2541-tet (Fig. 8) at the anti-screening of F+strain to change among the subtilis BW96, and obtain subtilis BW99.Next, utilize subtilis BW97, plasmid pXO503 is imported among the subtilis BW99 by engaging as F+strain.Subtilis BW97 makes up as follows: at first, the pXO503 plasmid is migrated to from subtilis MT101 F+strain among the bac-1 bacterial strain subtilis 1A758, on the TBAB flat board that is added with erythromycin (5 μ g/ml), select transconjugant (the dal-F+strain can not be grown, because do not contain the D-L-Ala in the substratum).Obtained having the subtilis bac-1-bacterial strain of pXO503 plasmid like this.Subtilis MT101 is from subtilis DN1280, the latter is the derivative strain (Diderichsen that contains the subtilis 168 of dal genetically deficient, " genus bacillus molecular genetics and biotechnology applications handbook, A.T.Ganesan and J.A.Hoch chief editor, academic press company limited, New York, 1986).

Next, with the two ends described in the embodiment 8 be the BamHI site of cat box gene (giving chlorampenicol resistant) the insertion pCRII-dal Δ plasmid in BamHI site.The ScaI linearizing of this plasmid, and change in the bac-1 bacterial strain that contains conjugative plasmid pXO503, on the TBAB flat board that is added with D-L-Ala (0.1mg/ml) and paraxin (5 μ g/ml), carry out chlorampenicol resistant (via the double exchange homologous recombination) screening, obtain bac-1, dal Δ ∷ cat engages effective F+strain-subtilis BW97.At last, subtilis BW97 engages with the subtilis BW99 that contains pPL2541-tet, be added with D-L-Ala (0.1mg/ml), filter out transconjugant on the TBAB flat board of tsiklomitsin (10 μ g/ml) and erythromycin (5 μ g/ml), obtain F+strain subtilis BW100: the bac-1-of a kind of pXO503 of containing and helper plasmid pPL2541-tet, the subtilis of dal-disappearance.

Embodiment 10: the integration and the amplification of amyQ promotor-amyM box in bacillus subtilis A 16 4 bacterial strains

With the described joint (Battisti etc. that contain the subtilis BW100 F+strain of the amyQ promotor-amyM box that is arranged in pBAN-NOV and helper plasmid pPL2541-tet by the pLS20 mediation of embodiment 9,1985, the source is the same) engage with bacillus subtilis A 16 4 Δs 3 and bacillus subtilis A 16 4 Δs 5 bacterial strains.

Shake in the bottle at the 125ml that contains the 10ml LB nutrient solution that has added 5 μ g/ml paraxin and to cultivate bacillus subtilis A 16 4 Δs 3 and Δ 5 transconjugants continuous two generations, then at 45 ℃ of coated plates, with duplicating of blocking-up pPL254-tet helper plasmid, and filter out the clone who on the amyE site, has the integrated plasmid integration.Integron subsequently coated plate in containing concentration, on the substratum of the paraxin that 45,60 and 80 μ g/ml increase gradually, to select the clone that the amyQ promotor-the amyM box obtains increasing who contains the chloramphenicol resistance gene by 15,30.

Embodiment 11: shake-flask culture has transformed bacillus subtilis A 16 4 bacterial strains of amyQ promotor-amyM box

Shake in the bottle at the 250ml that contains 50ml PS-1 substratum, 37 ℃, the 250rpm shaking culture contains the amyQ promotor-amyM box of chromosomal integration copy or only contains bacillus subtilis A 16 4 Δs 3 of integrative vector and bacillus subtilis A 16 4 Δs 5 about 4 days.

After cultivating about 50 and 100 hours, get the culture supernatants sample preparation; With final concentration is that the PMSF of 2mM handles, frozen.In order to estimate NOVAMYL ^TMExpression, with supernatant liquor and isopyknic 2 * Laemmli sample-loading buffer mixing, boil immediately and boil, and be splined on 14% or the 8-16% acrylamide Tris-glycine gels available from businessman (NOVEX, San Diego, California), carry out electrophoresis.Also with the NOVAMYL of known quantity ^TMStandard model is splined on the same gel, is used for estimating the NOVAMYL that produces ^TMAmount.In some cases, utilize trisaccharide maltose to determine NOVAMYL as substrate ^TMTitre.Specifically, get the sample of enzyme and trisaccharide maltose, incubation 30 minutes altogether in the time of 37 ℃ at pH5.0.Then pH is transferred to about 11 with termination reaction.Under standard conditions, detect at 340nm with Hexose phosphate dehydrogenase and NADH, can determine amount by the glucose that glucose and maltose produced of trisaccharide maltose degraded.The NOVAMYL of known quantity ^TMStandard (Novo Nordisk A/S, Bagsvaerd, Denmark) is with comparing.

The result shows, cultivates after 2 days, and srfC is 8 centimetres of high foams of deletion mycopremna generation not, and the bacterial strain that has lacked srfC only produces 0.5 centimetre of high foam.When growing on blood agar plate, the srfC deletion mycopremna does not produce haemolysis, and this has confirmed that this bacterial strain does not produce surfaction.These results show that further two kinds of bacterial strains produce NOVAMYL ^TMAmount similar, but the srfC deletion mycopremna compares with deletion mycopremna not, the foam that the former produces significantly reduces.

Embodiment 12: the fermentation of bacillus subtilis A 16 4 bacterial strains

Containing 1.5 liters by typical carbon source and nitrogenous source, mineral salt, trace element and the anti-pore forming material of 3ml/L (Sigma mixed type 289 at least, Sigma Chemical Company, the St. Louis, MO) in 3 of the substratum of Zu Chenging liters of fermentor tanks, cultivate bacillus subtilis A 16 4 Δs 3 and bacillus subtilis A 16 4 Δs 5 of only having integrated/increased slave's type plasmid pCAsub2 respectively.In the culture with the ventilation of the speed of 1.5 liters of per minutes, and with two standard turbo with 1000 to 1500rpm rotating speed stirring.Leavening temperature remains on 37 ℃ to 39 ℃.

Quantitatively estimate foam number by the liquid volume that mensuration is taken fermentor tank out of by forming process.By measuring NOVAMYL with embodiment 11 described identical methods ^TMActive.

The result shows, ferments 5 hours in, and bacillus subtilis A 16 4 Δs 3 begin to produce foam, and foam is full of between 1.5 lift-offs on fermentor tank top, and begins to be spilled in the receiving flask by vapor pipe.In 10 to 20 hours,, make liquid volume ordinary loss 700 in the fermentor tank to 900ml because foamy overflows.After this stage, system stability gets off, but only is left 45% to 60% of first volume in the fermentor tank, and this makes this bacterial strain not be suitable in the scale operation.To the similar fermentation that bacillus subtilis A 16 4 Δs 5 carry out,, therefore do not lose any volume owing at least 50 hours fermentation time, do not produce foam.Two kinds of NOVAMYL that bacterial strain produces in every milliliter of fermented liquid ^TMAmount similar.

Sequence table

(1) general information:

(i) applicant:

(A) title: Novo Nordisk Biotech, Inc.

(B) street: 1445Drew Avenue

(C) city: Davis, California

(D) country: the U.S.

(E) postcode (ZIP): 95616-4880

(F) phone: (916) 757-8100

(G) fax: (916) 758-0317

(ii) denomination of invention: the method for in the bacillus cell mutant, producing polypeptide

(iii) sequence number: 34

(iv) contact address:

(A) address: Novo Nordisk of North Americ

(B) street: 405Lexington Avenue-64 ^ThFl.

(C) city: New York

(D) state: NY

(E) country: the U.S.

(F) postcode (ZIP): 10174

(v) computer-reader form:

(A) media type: floppy disk

(B) computer: IBM compatible

(C) operating system: DOS

(D) software: FastSEQ for Windows Version 2.0

(vi) current application information:

(A) application number:

(B) applying date: on June 12nd, 1997

(C) classification number:

(vii) proxy/agency's information:

(A) name: Lambiris, Elias J

(B) registration number: 33,728

(C) reference/number of documents: 5111.204-WO

(viii) contact details:

(A) phone: 212-878-9652

(B) fax: 212-878-9655

(2) data of SEQ ID NO:1:

(i) sequence signature:

(A) length: 22 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(xi) sequence description: SEQ ID NO:1

GAGCTCACAG?AGATACGTGG?GC 22

(2) data of SEQ ID NO:2:

(i) sequence signature:

(A) length: 23 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(xi) sequence description: SEQ ID NO:2

GGATCCACAC?CAAGTCTGTT?CAT 23

(2) data of SEQ ID NO:3:

(i) sequence signature:

(A) length: 21 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(xi) sequence description: SEQ ID NO:3

0GGATCCGCTG?GACTCCGGCT?G 21

(2) data of SEQ ID NO:4:

(i) sequence signature:

(A) length: 22 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(xi) sequence description: SEQ ID NO:4

AAGCTTATCT?CATCCATGGA?AA 22

(2) data of SEQ ID NO:5:

(i) sequence signature:

(A) length: 20 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(xi) sequence description: SEQ ID NO:5

AAGCTTAGGC?ATTACAGATC 20

(2) data of SEQ ID NO:6:

(i) sequence signature:

(A) length: 33 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(xi) sequence description: SEQ ID NO:6

CGGATCTCCG?TCATTTCCCA?GCCCGATGCA?GCC 33

(2) data of SEQ ID NO:7:

(i) sequence signature:

(A) length: 33 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(xi) sequence description: SEQ ID NO:7

GGCTGCATCG?GGCTGGAAAA?TGACGGAGAT?CCG 33

(2) data of SEQ ID NO:8:

(i) sequence signature:

(A) length: 18 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(xi) sequence description: SEQ ID NO:8

GATCACATCT?TTCGGTGG 18

(2) data of SEQ ID NO:9:

(i) sequence signature:

(A) length: 20 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(xi) sequence description: SEQ ID NO:9

CGTTTATGAG?TTTATCAATC 20

(2) data of SEQ ID NO:10:

(i) sequence signature:

(A) length: 20 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(xi) sequence description: SEQ ID NO:10

AGACTTCCCA?GTTTGCAGGT 20

(2) data of SEQ ID NO:11:

(i) sequence signature:

(A) length: 35 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(xi) sequence description: SEQ ID NO:11

CAAACTGGGA?AGTCTCGACG?GTTCATTCTT?CTCTC

35

(2) data of SEQ ID NO:12:

(i) sequence signature:

(A) length: 20 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(xi) sequence description: SEQ ID NO:12

TCCAACAGCA?TTCCAGGCTG 20

(2) data of SEQ ID NO:13:

(i) sequence signature:

(A) length: 29 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(xi) sequence description: SEQ ID NO:13

GCGAATTCTA?CCTAAATAGA?GATAAAATC

29

(2) data of SEQ ID NO:14:

(i) sequence signature:

(A) length: 36 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(xi) sequence description: SEQ ID NO:14

GTTTACCGCA?CCTACGTCGA?CCCTGTGTAG?CCTTGA 36

(2) data of SEQ ID NO:15:

(i) sequence signature:

(A) length: 36 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(xi) sequence description: SEQ ID NO:15

TCAAGGCTAC?ACAGGGTCGA?CGTAGGTGCG?GTAAAC 36

(2) data of SEQ ID NO:16:

(i) sequence signature:

(A) length: 29 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(xi) sequence description: SEQ ID NO:16

GCAAGCTTGA?CAGAGAACAG?AGAAGCCAG 29

(2) data of SEQ ID NO:17:

(i) sequence signature:

(A) length: 28 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(xi) sequence description: SEQ ID NO:17

CGTCGACGCC?TTTGCGGTAG?TGGTGCTT 28

(2) data of SEQ ID NO:18:

(i) sequence signature:

(A) length: 36 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(xi) sequence description: SEQ ID NO:18

CGCGGCCGCA?GGCCCTTAAG?GCCAGAACCA?AATGAA 36

(2) data of SEQ ID NO:19:

(i) sequence signature:

(A) length: 34 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(xi) sequence description: SEQ ID NO:19

TGGCCTTAAG?GGCCTGCGGC CGCGATTTCC?AATG 34

(2) data of SEQ ID NO:20:

(i) sequence signature:

(A) length: 28 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(xi) sequence description: SEQ ID NO:20

GAAGCTTCTT?CATCATCATT?GGCATACG 28

(2) data of SEQ ID NO:21:

(i) sequence signature:

(A) length: 19 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(xi) sequence description: SEQ ID NO:21

AAGCTTTGAA?TGGGTGTGG 19

(2) data of SEQ ID NO:22:

(i) sequence signature:

(A) length: 36 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(xi) sequence description: SEQ ID NO:22

CCGCTTGTTC?TTTCATCCCC TGAAACAACT?GTACCG 36

(2) data of SEQ ID NO:23:

(i) sequence signature:

(A) length: 34 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(xi) sequence description: SEQ ID NO:23

CAGTTGTTTC?AGGGGATGAA?AGAACAAGCG?GCTG 34

(2) data of SEQ ID NO:24:

(i) sequence signature:

(A) length: 18 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(xi) sequence description: SEQ ID NO:24

CTGACATGAG?GCACTGAC 18

(2) data of SEQ ID NO:25:

(i) sequence signature:

(A) length: 42 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(xi) sequence description: SEQ ID NO:25

TTTGGCCTTA?AGGGCCTGCA?ATCGATTGTT?TGAGAAAAGA?AG 42

(2) data of SEQ ID NO:26:

(i) sequence signature:

(A) length: 43 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(xi) sequence description: SEQ ID NO:26

TTTGAGCTCC?ATTTTCTTAT?ACAAATTATA?TTTTACATAT?CAG

43

(2) data of SEQ ID NO:27:

(i) sequence signature:

(A) length: 58 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(xi) sequence description: SEQ ID NO:27

AGCTAGGCCT?TAAGGGCCCG?GGACGTCGAG?CTCAAGCTTG?CGGCCGCCAT?GGTCGACG 58

(2) data of SEQ ID NO:28:

(i) sequence signature:

(A) length: 57 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(xi) sequence description: SEQ ID NO:28

AATTCGTCGA?CCATGGCGGC?CGCAAGCTTG?AGCTCGACGT?CCCGGGCCCT?TAAGGCC 57

(2) data of SEQ ID NO:29:

(i) sequence signature:

(A) length: 29 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(xi) sequence description: SEQ ID NO:29

CTGAGCTCTA?CGAAAGGAGA?CACACATGC

29

(2) data of SEQ ID NO:30:

(i) sequence signature:

(A) length: 22 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(xi) sequence description: SEQ ID NO:30

ACGCCCAGCT?GTTTAAGATA?AG 22

(2) data of SEQ ID NO:31:

(i) sequence signature:

(A) length: 48 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(xi) sequence description: SEQ ID NO:31

AGCTTGGCCT?TAAGGGCCCG?ATATCGGATC?CGCGGCCGCT?GCAGGTAC 48

(2) data of SEQ ID NO:32:

(i) sequence signature:

(A) length: 40 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(xi) sequence description: SEQ ID NO:32

CTGCAGCGGC?CGCGGATCCG?ATATCGGGCC?CTTAAGGCCA 40

(2) data of SEQ ID NO:33:

(i) sequence signature:

(A) length: 21 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(xi) sequence description: SEQ ID NO:33

GCGGCCGCGA?TTTCCAATGA?G 21

(2) data of SEQ ID NO:34:

(i) sequence signature:

(A) length: 21 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(xi) sequence description: SEQ ID NO:34

GGTACCTGCA?TTTGCCAGCA?C 21

Claims (22)

1. L. method of producing polypeptide comprises:

   (a) mutant cell of cultivation parent genus bacillus (Bacillus) cell under the condition that helps this polypeptide production, wherein, (i) this mutant cell comprises first nucleotide sequence and second nucleotide sequence, the described polypeptide of described first nucleic acid sequence encoding, contain the modification of being responsible for surfaction or its isotype biosynthesizing or at least a gene of excretory in described second nucleotide sequence, wherein said modification has been eliminated the generation of surfaction in the mutant cell or its isotype or has been reduced its production level, when (ii) cultivating under the same conditions, compare with parent's bacillus cell, surfaction or its isotype that this mutant cell produces will lack; With

   (b) isolated polypeptide from substratum.
2. 2. the method for claim 1, wherein said parent's bacillus cell is Alkaliphilic bacillus (Bacillus alkalophilus) cell, bacillus amyloliquefaciens (Bacillusamyloliquefaciens) cell, bacillus brevis (Bacillus brevis) cell, Bacillus circulans (Bacillus circulans) cell, Bacillus coagulans (Bacillus coagulans) cell, bacillus firmus (Bacillus firmus) cell, bacillus lautus (Bacillus lautus) cell, bacillus lentus (Bacillus lentus) cell, Bacillus licheniformis (Bacilluslicheniformis) cell, bacillus megaterium (Bacillus megaterium) cell, bacillus pumilus (Bacillus pumilus) cell, bacstearothermophilus (Bacillus stearothermophilus) cell, subtilis (Bacillussubtilis) cell, or bacillus thuringiensis (Bacillus thuringiensis) cell.
3. 3. the method for claim 2, wherein, described parent's bacillus cell is the bacillus subtilis mycetocyte.
4. 4. the method for claim 3, wherein, described parent's bacillus subtilis mycetocyte is subtilis ATCC 6051 or subtilis ATCC 6051A.
5. 5. the method for claim 3, wherein, described parent's bacillus subtilis mycetocyte is subtilis NCFB 736.
6. 6. the process of claim 1 wherein that described gene is the gene of srf operon.
7. 7. the method for claim 6, wherein, described gene is srfA.
8. 8. the method for claim 6, wherein, described gene is srfB.
9. 9. the method for claim 6, wherein, described gene is srfC.
10. 10. the method for claim 6, wherein, described gene is srfD.
11. 11. the method for claim 6, wherein, described gene is sfp.
12. 12. the process of claim 1 wherein, when under equal conditions cultivating, to compare with parent's bacillus cell, the surfaction that described mutant cell is produced or its isotype lack about 25% at least.
13. 13. the process of claim 1 wherein that described modification causes producing the non-foaming variant of surfaction or its isotype.
14. 14. the process of claim 1 wherein that described polypeptide is an external source for bacillus cell.
15. 15. the process of claim 1 wherein that described mutant cell also comprises the modification to one or more gene of proteins encoded enzyme, to compare with parent's bacillus cell, described modification has been eliminated the generation of proteolytic enzyme in the mutant cell or has been reduced its generation level.
16. 16. the method for claim 15, wherein, described gene is nprE and/or aprE.
17. 17. the process of claim 1 wherein that described mutant cell also comprises the deactivation to the spoIIAC gene.
18. 18. the process of claim 1 wherein that described mutant cell also comprises the modification to the amyE gene, to compare with parent's bacillus cell, this modification has been eliminated in the mutant cell diastatic generation or has been reduced its generation level.
19. 19. the mutant of parent's bacillus cell, it comprises first nucleotide sequence and second nucleotide sequence, the described first nucleic acid sequence encoding heterologous polypeptide, contain the modification of being responsible for surfaction or its isotype biosynthesizing or at least a gene of excretory in described second nucleotide sequence, wherein said modification has been eliminated the generation of surfaction in the mutant cell or its isotype or has been reduced its generation level, and when cultivating under the same conditions, compare with parent's bacillus cell, surfaction or its isotype that this mutant cell produces will lack.
20. 20. the mutant of parent's bacillus cell, it comprises first nucleotide sequence and second nucleotide sequence of at least two copies, the described first nucleic acid sequence encoding natural polypeptides, contain the modification of being responsible for surfaction or its isotype biosynthesizing or at least a gene of excretory in described second nucleotide sequence, wherein said modification has been eliminated the generation of surfaction in the mutant cell or its isotype or has been reduced its generation level, and when cultivating under the same conditions, compare with parent's bacillus cell, surfaction or its isotype that this mutant cell produces will lack.
21. 21. obtain the method for the mutant of claim 19, comprising:

    (a) in bacillus cell, introduce first nucleotide sequence that contains the modification of being responsible for surfaction or its isotype biosynthesizing or at least one gene of excretory, and second nucleotide sequence of coding bacillus cell heterologous polypeptide, described modification has been eliminated the generation of surfaction in the mutant cell or its isotype or has been reduced its generation level; With

    (b) identify the mutant cell that comprises described nucleotide sequence in the step (a).
22. 22. obtain the method for the mutant cell of claim 20, comprising:

    (a) in bacillus cell, introduce first nucleotide sequence that contains the modification of being responsible for surfaction or its isotype biosynthesizing or at least one gene of excretory, and second nucleotide sequence of coding bacillus cell natural polypeptides, wherein said modification has been eliminated the generation of surfaction in the mutant cell or its isotype or has been reduced its generation level; With

    (b) identify the mutant that comprises described nucleotide sequence in the step (a).

Images