CN1245508C - Human atrial natriuretic peptide gene, its strong mutant and its application in treating relative diseases - Google Patents

Abstract

The present invention relates to a strong-efficiency mutation type human atrial natriuretic peptide gene, an expression type recombinant containing the gene and an application of the gene in gene treatment of nephrotic syndromes, chronic cardiac insufficiency and hypertension. The present invention also relates to strong-efficiency mutation type human atrial natriuretic peptide polypeptide encoded by the gene, which also relates to an application of the strong-efficiency mutation type human atrial natriuretic peptide gene, a wild human atrial natriuretic peptide gene and a human brain natriuretic peptide gene in single or compound treatment of nephrotic syndromes, chronic cardiac insufficiency and hypertension.

Description

The application in the treatment relative disease of human atrial natriuretic peptide gene, its potent mutant and human brain natriuretic peptide gene

The present invention relates to potent mutant human atrial natriuretic peptide gene, comprise described expression of gene type recombinant chou and the application of described gene in gene therapy nephrotic syndrome, chronic cardiac insufficiency and hypertension.The invention still further relates to potent mutant human atrial natriuretic peptide polypeptide by described genes encoding.The invention still further relates to described potent mutant human atrial natriuretic peptide gene or wild-type human atrial natriuretic peptide gene separately or with human brain natriuretic peptide gene combination therapy nephrotic syndrome, chronic cardiac insufficiency and hypertensive application.

Atrial natriuretic peptide is a kind of mainly synthetic and excretory peptide hormone by atrial muscle cell, and B-Type natriuretic peptide is the mainly synthetic and secretion by ventricular muscle cell then.Utilize studies show that atrial natriuretic peptide and/or B-Type natriuretic peptide polypeptide done, they all have intensive and suppress physiological action widely such as renin-angiotensin (RAS) system, diuresis, sharp sodium, vasodilator and the adjusting of participation fluid and electrolyte balance.Though experiment in vivo and vitro has all confirmed atrial natriuretic peptide polypeptide and B-Type natriuretic peptide polypeptide and has had above-mentioned physiological action widely, people also wish to utilize them to treat some disease such as nephrotic syndrome, chronic cardiac insufficiency and hypertension, but reality is that people can't overcome short defective of its transformation period.As if intravenous drip can remedy this deficiency, can pour into also unrealistic over a long time.Therefore, fundamental research and the clinical application about atrial natriuretic peptide and B-Type natriuretic peptide all is unsafty.

On the other hand, because atrial natriuretic peptide and B-Type natriuretic peptide have physiological action widely such as the RAS of inhibition system, diuresis, sharp sodium, vasodilator and adjusting electrolyte balance, so, with atrial natriuretic peptide and/or B-Type natriuretic peptide gene treat as the gene therapy of functional gene or assisting therapy nephrotic syndrome and chronic cardiac insufficiency still very likely.But present gene therapy scheme is the strategy (compensation, inhibition or activation etc.) according to the single gene inheritance disease gene therapy mostly to be formulated.Such as, suppress oncogene or activate the expression of antioncogene, certain functional molecular that compensation obviously lacks or the like.As can be seen, these schemes all are very strong for the specific aim on disease genetic basis with to the dependency of its genetic background knowledge.Yet,, currently also can't understand or thoroughly disclose its inheritance for multigenic disease.Moreover, exactly under the situation of the genes involved of having affirmed them or Disease-causing gene, also be difficult to adopt above-mentioned strategy to correct the function of a plurality of dcc genes correspondingly simultaneously.In view of this, the principle of " lack what what is mended " is the gene therapy that is unsuitable for multigenic disease, is like this at least at present.Also have, according to estimates, in more than 6000 kinds of heredopathias, single-gene disorder only accounts for 30%, and multigenic disease accounts for 70%.The sickness rate height of multigenic disease, harm is serious, loss is huge and characteristics that be difficult to cure are asked for help again constantly seeks new treatment means.In view of this, the inventor has proposed the strategy of phenotype genes treatment.This is a kind of under the situation of the genetic background of not understanding disease, directly the gene therapy of carrying out at its phenotype (symptom).Utilize the principle and the method for gene therapy that certain or several gene (being atrial natriuretic peptide gene and B-Type natriuretic peptide gene in the present invention) that can produce the material of eliminating symptom, recovering the normal physiological phenotype are imported in patient's body exactly, and continue therein, stably express, thereby the purpose of realization treatment or the disease of healing patient own.This just likes miniature pharmaceutical factory has been built in the body, can continuously provide drug molecule for the patient.That is to say, compare that the phenotype genes treatment just changes to some extent, promptly directly uses the DNA medicine on medicament forms and administering mode with the traditional treatment means.This imagination if can be come true, a new road is opened up in the treatment that will be difficult to the multigenic disease for the treatment of for many sickness rate height, harm are serious current again.

Therefore, one object of the present invention is to provide a kind of potent mutant human atrial natriuretic peptide gene, and the potent mutant human atrial natriuretic peptide of its coding has the transformation period of prolongation than the wild-type human atrial natriuretic peptide.

Another object of the present invention is to provide and comprise described potent mutant human atrial natriuretic peptide gene, wild-type human atrial natriuretic peptide gene or human brain natriuretic peptide expression of gene type recombinant chou.

A further object of the present invention is to provide described potent mutant human atrial natriuretic peptide gene or wild-type human atrial natriuretic peptide gene to be compounded in application in gene therapy nephrotic syndrome, chronic cardiac insufficiency and the hypertension separately or with the human brain natriuretic peptide gene.

According to an aspect of the present invention, provide a kind of recombinant DNA (mhANP) of potent mutant human atrial natriuretic peptide and comprise the expression type recombinant chou of described DNA.The nucleotide sequence of the recombinant DNA of described potent mutant human atrial natriuretic peptide (mhANP) is shown in SEQ ID No:3, and it is the 8th and the 12nd amino acid whose codon TTC/Phe with wild-type human atrial natriuretic peptide 28 peptides (hANP28) coding region ⁸And ATG/Met ¹²Be mutated into TCC/Ser corresponding among the mhANP respectively ⁸And ATA/Ile ¹²The result, be mhANP hereinafter to be referred as this recombinant DNA.The active polypeptide mhANP that mhANP is coded ₂₈Aminoacid sequence shown in SEQ IDNo:4.

Gene mhANP of the present invention can introduce various expression vectors with construction expression type recombinant chou according to technology well known in the art, thereby expresses described potent mutant human atrial natriuretic peptide polypeptide mhANP ₂₈These expression recombinants also can be used for treating diseases such as nephrotic syndrome, chronic cardiac insufficiency, hypertension.The example of such expression type recombinant chou comprises (seeing embodiment for details) such as pLHY24, pYF1.

Another aspect of the present invention relates to potent mutant human atrial natriuretic peptide gene or the application of wild-type atrial natriuretic peptide gene in gene therapy nephrotic syndrome, chronic cardiac insufficiency and hypertension.

Of the present inventionly relate in one aspect to potent mutant human atrial natriuretic peptide gene or wild-type human atrial natriuretic peptide gene and human brain natriuretic peptide gene again and be compounded in application in gene therapy nephrotic syndrome, chronic cardiac insufficiency and the hypertension.

In this treatment application facet of the present invention, utilized a kind of nephrotic syndrome animal model, promptly by Zorubicin (adriamycin, ADR) inductive kidney of rats disease syndrome (NS) model with oliguresis feature.With the object of rat NS model as the somatic gene therapy of atrial natriuretic peptide gene; mainly be to occur under the situation of obstacle in order to inquire at renal function; atrial natriuretic peptide gene and atrial natriuretic peptide and B-Type natriuretic peptide gene long-term diuresis, natriuresis and the kidney defencive function after somatocyte shifts is for the treatment nephrotic syndrome provides reference.In one embodiment of the invention; in muscle imports the naked DNA of the eukaryotic cell expression recombinant chou pLHY24 of mhANP this animal pattern body with oliguresis feature; observed at last and continued and tangible diuretic properties; impaired kidney also there is significant protective effect, and does not find obvious toxic and side effects (seeing embodiment).

In addition, the present invention has utilized the animal pattern in heart failure due to a kind of physical abuse, it is the heart failure rat model that the heart valve damage method obtains, and the direct intracorporal method of employing gene therapy, through muscle the expression type recombinant chou pLHY24 of mhANP and hBNP and the naked DNA of pLT28 are imported in the animal pattern body in heart failure, observed the Electrocardiographic obvious improvement of Ischemic Heart at last, the cardiac muscle hyperplasia is suppressed and variations such as energy metabolism significantly improves, and illustrates that sharp sodium polypeptide gene such as atrial natriuretic peptide and B-Type natriuretic peptide continuous expression in vivo have the good curing effect to heart failure.

The effect of mhANP polypeptide of the present invention that the present invention has also utilized spontaneous hypertensive rat (SHR) model measurement to reduction animal blood pressure or the rising of inhibition animal blood pressure.

As mentioned above, the strategy that provides a kind of phenotype genes treatment of the present invention, compare with traditional treatment means, phenotype genes is treated the change that used medicine has had essence in form, it no longer is the final expression product of certain gene, but the gene of this expression product of encoding itself, promptly so-called genomic medicine or DNA medicine.So the present invention has important significance for theories and realistic meaning.

In the present invention, for example, in order to obtain definite results, at first use the dosage of 5mg/kg body weight, adopt the direct intracorporal method of transgenosis in the gene therapy, the eukaryotic cell expression type recombinant chou pLHY19 of hANP and mhANP and pLHY24 are imported respectively in the NS animal pattern body without any genetic background with the form of naked DNA, last, observed and continued and tangible diuretic properties.To importing behind the DNA medicine the 5th day, the 10th day analysis revealed with the increment (comparing with the value before the treatment respectively) of urine amount/weight ratio of the 15th day, mhANP is respectively hANP 1.60 times (2.75/1.72) and 2.04 times (6.89/3.37) in the diuretic properties intensity of the 5th day and the 10th day.This presentation of results is transformed into the mhANP of mutant by the hANP with wild-type, and we have reached the sudden change synergic purpose of expection, has obtained the human atrial natriuretic peptide gene mhANP of potent mutant.

Describe the present invention in detail hereinafter with reference to sequence table, drawings and Examples, wherein:

SEQ ID NO:1 is the nucleotide sequence of wild-type human atrial natriuretic peptide gene hANP, and boldface type wherein shows active polypeptide hANP ₂₈Coding region sequence.

SEQ ID NO:2 is the coded proteinic aminoacid sequence of hANP, and boldface type wherein shows active polypeptide hANP ₂₈Aminoacid sequence

SEQ ID NO:3 is the nucleotide sequence of mhANP, and boldface type wherein shows active polypeptide mhANP ₂₈Coding region sequence, black italic and have the underscore person is mhANP ₂₈Distinctive sudden change codon.

SEQ ID NO:4 is the coded proteinic aminoacid sequence of mhANP, and boldface type wherein shows active polypeptide mhANP ₂₈Aminoacid sequence, black italic and have the underscore person is active polypeptide mhANP ₂₈Distinctive amino acid.

SEQ ID NO:5 is the nucleotide sequence of wild-type human brain natriuretic peptide gene hBNP, comprises 3 exons, 2 introns.Capitalization wherein shows exon, and lowercase shows intron.

SEQ ID NO:6 is the coded proteinic aminoacid sequence of hBNP, and active polypeptide hBNP represented in boldface type wherein ₃₂Aminoacid sequence.

Fig. 1 shows the building process of recombinant chou pLT17.

Fig. 2 shows the building process of recombinant chou pLT18 and pLT19.

Fig. 3 shows the building process of recombinant chou pLHY19.

Fig. 4 shows the building process of recombinant chou pLHY24.

Fig. 5 shows the building process of recombinant chou pYF1.

Fig. 6 shows the building process of recombinant chou pYB1.

Fig. 7 shows the building process of recombinant chou pLT25.

Fig. 8 shows the building process of recombinant chou pLT28.

Fig. 9 shows the building process of recombinant chou pYF2.

Figure 10 shows the influence (embodiment 4) of intravenous injection Zorubicin to rat body weight.

Figure 11 shows the influence (embodiment 4) of intravenous injection Zorubicin to rat urine amount.

Figure 12 shows the intravenous injection Zorubicin to the rat proteic influence (embodiment 4) of urinating.

Figure 13 shows the influence (embodiment 4) of sudden change to atrial natriuretic peptide gene diuretic properties.

Figure 14 shows the influence (embodiment 4) of atrial natriuretic peptide transgenation to animal " increment of urine amount/weight ratio ".

Figure 15 shows the influence (embodiment 5) of intravenous injection Zorubicin to rat body weight.

Figure 16 shows the influence (embodiment 5) of intravenous injection Zorubicin to rat urine amount.

Figure 17 shows the intravenous injection Zorubicin to the rat proteic influence (embodiment 5) of urinating.

Figure 18 shows retroviral vector mediation mhANP and the hBNP transgenosis influence (embodiment 5) to the animal urine amount.

Figure 19 shows retroviral vector mediation mhANP and hBNP transgenosis to the proteic influence of animal urine (embodiment 5).

Figure 20 shows common plasmid vector mediation mhANP and the hBNP transgenosis influence (embodiment 6) to animal pattern urine amount.

Figure 21 shows intramuscular injection mhANP and the back influence (embodiment 7) to chronic cardiac insufficiency animal hearts weight of two weeks of hBNP gene.

Figure 22 shows intramuscular injection mhANP and the hBNP gene influences (embodiment 7) to chronic cardiac insufficiency animal hearts exponential after two weeks.

Figure 23 shows the influence (embodiment 7) of intramuscular injection mhANP and hBNP gene pairs chronic cardiac insufficiency animal heart rate.

Figure 24 shows the influence (embodiment 7) of intramuscular injection mhANP and hBNP gene pairs chronic cardiac insufficiency animal energy metabolic substd ATP.

Figure 25 shows the influence (embodiment 7) of intramuscular injection mhANP and hBNP gene pairs chronic cardiac insufficiency animal energy metabolic substd Pcr.

Figure 26 shows the influence (embodiment 7) of intramuscular injection mhANP and hBNP gene pairs chronic cardiac insufficiency animal energy metabolic substd LA.

Figure 27 shows the influence (embodiment 7) of intramuscular injection mhANP and hBNP gene pairs chronic cardiac insufficiency animal blood pressure.

Figure 28 shows the influence (embodiment 7) of intramuscular injection mhANP and hBNP gene pairs chronic cardiac insufficiency the weight of animals.

Figure 29 shows the Electrocardiographic influence of intramuscular injection mhANP gene pairs chronic cardiac insufficiency animal (embodiment 7).

Figure 30 shows the mhANP gene through the influence (embodiment 8) of collagen method transfer to the SHR rat blood pressure.

Figure 31 shows the mhANP gene through the influence (embodiment 8) of collagen method transfer to SHR rat urine amount.

Embodiment 1 human atrial natriuretic peptide gene's sudden change transformation

For physiologically active and its transformation period of prolongation of improving the atrial natriuretic peptide gene product, its gene is transformed with fixed-point mutation method.

1. hANP encodes ₂₈The sudden change transformation of the codon of the 8th and 12 amino acids

For transformation period and its physiologically active of raising that prolongs atrial natriuretic peptide, to ripe 28 peptide hANP among the wild-type human atrial natriuretic peptide gene ₂₈The transformation that suddenlys change of the 8th and the 12nd bit codon of coding region.With TTC/Phe ⁸And ATG/Met ¹²Be mutated into TCC/Ser respectively ⁸And ATA/Ile ¹²Thereby, the human atrial natriuretic peptide gene mhANP of acquisition mutant.For reaching this purpose, following PCR primer (primer T3 and T7 are universal primer) has been used in design, synthetic and selection, and its sequence is as follows:

T3：5’-AATTAACCCTCACTAAAGGG-3’

T7：5’-TAATACGACTCACTATAGGGC-3’

Pm1：5’-GCTGCTC CTGCAGGGGGCAGGATAGACAGGATTGG-3’

Pm2：5’-CTGCCCC CTGCAGGAGCAGCTGGATCTCCG-3’

For Pm1, except will be with hANP ₂₈The codon ATG of coding region the 12nd amino acids Met changes into outside the codon ATA of Ile, has also added four base TGCA between the CG of its 5 ' end, to introduce a PstI restriction enzyme site.For Pm2, except will be with the codon of the 8th amino acids by TTC/AAG ⁸Make TCC/AGG into ⁸Also introduced the PstI restriction enzyme site outward, on its next door.The long 450bp of the pcr amplification product of primer T3 and Pm2, the long 120bp of the amplified production of Pm1 and T7.

1.1. to hANP ₂₈The sudden change transformation of the 8th amino acids codon

With the hANP cDNA among the recombinant chou pLHY9 (clone has the pBluescript II SK carrier of wild-type hANP cDNA, and the inventor makes up in early days) is template, at first utilizes primer T3 and Pm2 (wherein to contain 1 PstI site and hANP ₂₈The sudden change codon TTC/Phe of the 8th amino acids ⁸→ TCC/Ser ⁸) carry out PCR, to finish to hANP _2RThe sudden change transformation of the 8th amino acids codon.The PCR reaction parameter is: the 100ul reaction system, each 25pmol of primer, dNTP 20nmol, boiled in the water-bath 10 minutes, put immediately in the ice bath 5 minutes, add pfu archaeal dna polymerase 2 units, paraffin oil 50ul, directly enter circulation behind the mixing: 94 ℃ 35 seconds, 54 ℃ 60 seconds, 72 ℃ 60 seconds, totally 30 circulations, 72 ℃ of extension PCR products 10 minutes.The pcr amplification product of extracting, purifying primer T3 and Pm2, behind BamHI and PstI double digestion, 400bp fragment with in the low melting point agarose gel electrophoresis method recovery PCR product links to each other with the plasmid vector of handling through BamHI and PstI equally, thereby obtains recombinant chou pLT17 (see figure 1).

2.2. to hANP ₂₈The sudden change transformation of the 12nd amino acids codon

HANP cDNA with recombinant chou pLHY9 (seeing above-mentioned) is a template, (wherein contains 1 PstI site and hANP with primer T7 and Pm1 ₂₈The sudden change codon ATG/Met of the 12nd amino acids ¹²→ ATA/Ile ¹²) carry out PCR, to finish to hANP ₂₈The sudden change transformation of the 12nd amino acids codon.The PCR reaction parameter is the same.The pcr amplification product of extracting, purifying primer T3 and Pm2, with extracting again behind PstI and the KpInI double digestion, purifying it, directly and the plasmid vector of handling through BamHI and PstI equally link to each other, obtain recombinant chou pLT18 (see figure 2).

The sequencing results by hANP cDNA among the recombinant chou pLT18 knows that in the sequence between BamHI to KpnI, except 4 bases of PstI site intermediary that we specially add, other sequence is consistent with sudden change remodeling hANP (hmANP) cDNA that estimates.With the PstI enzyme cut, that the T4DNA polysaccharase scabbles that the PstI enzyme cuts that the back produces is outstanding 3 ', the way that the end back connects self just in time can be removed this 4 extra bases.So, with PstI cutting recombinant chou pLT18, under the condition that dNTP exists, scabble with the T4DNA polysaccharase, self connect and obtain recombinant chou pLT19 (see figure 2).

The structure of embodiment 2 hANP and mhANP eukaryotic cell expression type recombinant chou

Suddenly change to the physiologically active of atrial natriuretic peptide polypeptide and the influence of transformation period thereof for being implemented in purpose and the research of expressing atrial natriuretic peptide in the eukaryotic cell, with retroviral vector construct expression type recombinant chou pLHY19 and the pLHY24 of hANP and mhANP, with common plamid vector construction the expression type recombinant chou pYF1 of mhANP.

1. the structure that contains the recombinant chou pLHY19 of hANP

The pLHY17 that uses when making up pLHY19 is a transition plasmid, it be Expression element combination clone with second intron (intron) of the promotor of human cytomegalic inclusion disease virus CMV (CMV), rabbit beta-globin gene and the common composition of wild-type human atrial natriuretic peptide gene (hANP) advance common plasmid vector pBluescfipt II SK+/-in the result.The purpose that makes up this transition plasmid is to be convenient to this Expression element composite entity is cloned into retroviral vector pLNCX.

PLNCX total length 6620bp is mainly by the long terminal repeat (5 ' LTR and 3 ' LTR) of Moloney murine leukemia virus (Mo-MLV), the resistant gene Neo of being convenient to the eukaryotic cell screening of its 5 ' LTR promotor control ^r, Colicine replication orgin (ColE1), be convenient to the resistant gene Amp of prokaryotic cell prokaryocyte screening ^rWith the compositions such as multiple clone site that insert for foreign gene.

The purpose that makes up pLHY19 is to express in eukaryotic cell for the ease of wild-type human atrial natriuretic peptide gene hANP.The method that makes up is to cut recombinant plasmid pLHY17 with XbaI, under the condition that dNTP exists, mend flat with Klenow, cut with HindIII again, recovery is by the promotor CMV of human cytomegalic inclusion disease virus, second intron (intron) of rabbit beta-globin gene and the Expression element combination (segment of 1870bp) that wild-type human atrial natriuretic peptide gene hANP forms jointly, link to each other with the retroviral vector pLNCX that handled through BamHI, Klenow and HindIII then, thereby obtain recombinant chou pLHY19 (see figure 3).

2. the structure that contains the recombinant chou pLHY24 of mhANP

Used pLHY23 also is a transition plasmid when making up pLHY24, it be with second intron of the promotor of CMV, rabbit beta-globin gene and the common Expression element combination clone of forming of mutant human atrial natriuretic peptide gene mhANP advance plasmid vector pBluescript IISK+/-in the result.The purpose that makes up this transition plasmid is for this Expression element composite entity is cloned into retroviral vector pLNCX.

The purpose that makes up pLHY24 is for the expression of mutant human atrial natriuretic peptide gene mhANP in eukaryotic cell.Its method is to cut recombinant plasmid pLHY23 with XbaI, under the condition that dNTP exists, mend flat with Klenow, cut with HindIII again, reclaim the segment of 1870bp, link to each other with the retroviral vector pLNCX that handled through XbaI, Klenow and HindIII equally then, thereby obtain recombinant chou pLHY24 (see figure 4).

3. the structure that contains the recombinant chou pYF1 of mhANP

Making up the used plasmid vector pcDNA3.1 of pYF1 (-) Myc-His A is the product of Invitrogen company.In this carrier, remove the resistant gene Amp that general plasmid all has ^r, outside replication orgin ColE1 and the multiple clone site inserted for goal gene, control promotor CMV, Trobest (BGH) poly (A) signal BGHpA, the SV40 promotor of destination gene expression in addition, by the resistant gene Neo of SV40 promotor control ^rPoly (A) signal with SV40.

The purpose that makes up pYF1 is to mediate the expression of mutant human atrial natriuretic peptide gene mhANP in eukaryotic cell with common plasmid.Its method is with SalI and HindIII double digestion recombinant plasmid pLHY24, the 1120bp segment that recovery is made of rabbit beta-globin gene second intron (Intron) and mhANPcDNA, link to each other with plasmid vector pcDNA3.1 (-) the Myc-His A that handled through XhoI and HindIII, thereby obtain recombinant chou pYF1 (see figure 5).

The structure of embodiment 3 hBNP eukaryotic cell expression type recombinant chou pLT28 and pYF2

1. the structure of recombinant chou pYB1

For obtaining the genomic dna hBNP of coding human brain natriuretic peptide, designed two PCR primer P1 and P2, in P1 and P2, introduced EcoRI and ClaI identification cleavage site respectively, its sequence is as follows:

P1：5’-CGC? GAA?TTC?ACC?ATG?GAT?CCC?CAG?ACA?GCA?CC-3’

P2：5’-CGC? ATC?GATTTA?ATG?CCG?CCT?CAG?CAC-3’

The PCR reaction parameter is: the 100ul reaction system, make template with the 100ng human gene group DNA, each 25pmol of primer, dNTP 20nmol boiled in the water-bath 10 minutes, put immediately in the ice bath 5 minutes, add pfu archaeal dna polymerase 2 units, paraffin oil 50ul directly enters circulation behind the mixing: 94 ℃ 30 seconds, 56 ℃ 36 seconds, 72 ℃ 90 seconds, totally 30 circulations, 72 ℃ of extension PCR products 10 minutes.Extracting, purifying primer PCR product, cut it respectively with EcoRI and ClaI, reclaim 1.2kb PCR product with low melting point agarose gel electrophoresis method, extracting again, purifying are once, link to each other with the plasmid vector pBluescript II SK that handled through EcoRI and ClaI equally, thereby obtain recombinant chou pYB1 (see figure 6).

2. the structure of recombinant chou pLT25

PLHY16 also is a transition plasmid, it be with second of the promotor of CMV, rabbit beta-globin gene include molecular Expression element combination clone advance plasmid vector pBluescript II SK+/-in the result.The purpose that makes up this transition plasmid is for the ease of relevant goal gene being cloned into the downstream of this Expression element combination, and then is convenient to they whole clones are advanced in the related expression carriers.

The purpose that makes up pLT25 is to express in eukaryotic cell for wild-type human brain natriuretic peptide gene hBNP.Its method is to cut plasmid pYB1 with EcoRI, and is flat with the Klenow benefit under the condition that dNTP exists, and again with the KpnI cutting, reclaims the segment of 1.2kb, links to each other with the plasmid pLHY16 that handled through BamHI, Klenow and KpnI then, obtains recombinant chou pLT25 (see figure 7).

3.hBNP the structure of retrovirus expression recombinant chou pLT28

Cut pLT25 with SalI, reclaim the dna segment of 1.84kb, link to each other with the plasmid pLHY24 that handled through SalI and XhoI then, obtain recombinant chou pLT28 (see figure 8).

4.hBNP the building process of common plasmid-type expression recombinant pYF2

Cut recombinant chou pYB1 with EcoRI, flat with the Klenow benefit under the condition that dNTP exists, again with the XhoI cutting, reclaim the hBNP segment of 1.2kb, link to each other with the plasmid pYF1 that handled through BamHI, Klenow and XhoI, obtain recombinant chou pYF2 (see figure 9).

Embodiment 4 atrial natriuretic peptide transgenations are to the bioactive influence of atrial natriuretic peptide polypeptide

1.hANP and the preparation of mhANP expression recombinant pLHY19 and pLHY24 plasmid DNA

1.1 prepare plasmid DNA in a large number with alkaline lysis

1.2 with PEG precipitator method plasmid DNA purification

Concrete steps are seen the molecular cloning laboratory manual.

2. rat nephrotic syndrome (nephrotic syndrome, NS) preparation of animal model

5 weeks conformed 1-2 week after age, male Wistar rat was bought back, numbered, weighed, random packet.Abdominal injection 2% vetanarcol (45mg/kg body weight) anesthesia is treated to soak the mouse tail after anaesthetic comes into force in warm water, distends the blood vessels.Water is dried, with 75% cotton ball soaked in alcohol wiping mouse tail.By the dosage of 5.0mg/kg body weight through the tail vein slowly inject the Zorubicin that is dissolved in physiological saline (adriamycin, ADR, 2mg/ml).Regularly weigh in, collect indexs such as urine and mensuration urine protein concentration weekly.

3. the metabolic cage method is collected urine sample

Regularly press the dosage of 5ml physiological saline/100g body weight and give rat oral gavage, put (1/cage) in the metabolic cage, fasting, taboo water 6 hours are also collected urine sample.Accurately measure volume of urine, centrifugal 5 minutes of 3000rpm to remove graininess impurity, is used to measure indexs such as urine protein concentration.

4. the intramuscular injection of naked DNA

Purified recombinant chou pLHY24 and the naked DNA of pLHY19 are dissolved in the physiological saline, make into the solution of 1mg/ml.Anaesthetize the nephrotic syndrome animal pattern of tool oliguresis feature with the method for abdominal injection vetanarcol (25mg/kg body weight), dosage by the 2.5mg/kg body weight injects the dna solution that accounts for total amount 1/6 respectively at its pair hindlimb muscle (3 places/limb), slowly push solution, pull out pin rapidly, and massage slightly in the injection site.

5. qualitative, the quantitative analysis of urine protein

5.1 qualitative analysis

Get urine sample 1ml, add 20% sulphur salicylic acid (20% sulphosalicylic acid: 95% alcohol=2: 1) 1～2, tentatively judge protein content with muddy degree behind the mixing.As the result is (-)～(+), and during quantitative analysis, urine sample is not diluted, and as the result is ++, +++and ++ ++, urine sample need be diluted 4,6 and 8 times respectively.

5.2 quantitative analysis

Reagent: 25% bovine serum albumin (25mg bovine serum albumin, 5ml 10% sodium azide adds deionized water to 100ml), 12.5% Tricholroacetic Acid (AcCl ₃).

Method:

Standard control:

Standard pipe: 4ml bovine serum albumin+1ml AcCl ₃

Control tube: 4ml physiological saline+1ml AcCl ₃

Sample hose:

When a. not diluting:

Standard pipe: 4ml urine sample+1ml AcCl ₃

Control tube: 4ml urine sample+1ml deionized water

When b. diluting 4 times:

Standard pipe: 1ml urine sample+3ml deionized water+1ml AcCl ₃

Control tube: 1ml urine sample+4ml deionized water

When c. diluting 6 times:

Standard pipe: 1ml urine sample+5ml deionized water+1ml AcCl ₃

Control tube: 1ml urine sample+6ml deionized water

When d. diluting 8 times:

Standard pipe: 1ml urine sample+7ml deionized water+1ml AcCl ₃

Control tube: 1ml urine sample+8ml deionized water

Condition determination: the 72-1 spectrophotometer, wavelength 420nm is with control tube zeroing with transfer 100.

Calculation formula: sample OD value/standard OD value * 25 * extension rate=urine protein concentration (mg%)

6. statistical procedures

Experimental datas such as urine amount/weight ratio and urine protein concentration are carried out statistical procedures.

7. result

For obtaining positive result, at first used the genomic medicine of higher dosage.The expression type recombinant chou pLHY19 of hANP and mhANP and the dosage of pLHY24 naked DNA are the 5mg/kg body weight.Adopt direct intracorporal method, through hindlimb muscle it is injected respectively in the NS animal pattern body, its result is as follows:

7.1 the preparation of rat NS animal model

By the dosage of 7.5mg/kg body weight through the tail vein slowly inject be dissolved in the ADR of physiological saline after, indexs such as observation at interval body weight, urine amount and urine protein concentration weekly.Credit is analysed by statistics, and after finding to inject ADR, the rate of growth of rat body weight obviously reduces, and the urine amount obviously reduces, and urine protein concentration obviously increases.The results are shown in Figure 10,11 and 12.

7.1.2 the comparison of diuretic activity before and after the atrial natriuretic peptide transgenation

ADR inductive rat NS animal model has the feature of oliguresis.After importing hANP and mhANP expression of gene type recombinant chou pLHY19 and pLHY24 in the animal body respectively by intramuscular injection, compare with the animal of the non-treatment group of injecting empty carrier, the urine amount of treatment treated animal obviously increases, during by the 10th and the 15th day, the urine amount of mhANP group has returned to the level of normal group.The validity period of hANP and mhANP diuretic properties was respectively for 2 week and 3 weeks (the results are shown in Figure 13).

Through the analysis to animal " increment of urine amount/weight ratio " after importing the DNA medicine (comparing with the value before the treatment respectively), discovery mhANF is respectively 1.60 times (2.75/1.72) of hANP, 2.04 times (6.89/3.37) and 1.91 times (10.05/5.26) the 5th, 10 and 15 day diuretic properties intensity.The atrial natriuretic peptide transgenation is seen Figure 14 to the influence of animal pattern " increment of urine amount/weight ratio ".

Above presentation of results by the rite-directed mutagenesis to the hANP gene, reached the enhancing biological activity of expection and the purpose that prolongs effective acting time, that is we has obtained the human atrial natriuretic peptide gene mhANP of potent mutant.

The retrovirus expression type recombinant chou of embodiment 5mhANP gene shifts through somatocyte and controls

Treat nephrotic syndrome

1. method: except that special instruction was arranged, test method was the same.

The retrovirus expression type recombinant chou of used in the present embodiment mhANP gene is pLHY24.For strengthening this tactful practicality and inquiring into the preferred plan for the treatment of, the dosage of genomic medicine has been dropped to the 2.5mg/kg body weight, also establish 1 " 0.25mg/kg body weight " group for recombinant chou pLHY24 specially.

The used mhANP expression of gene type recombinant chou of present embodiment is pLHY24.Making up their used carriers is the retroviral vector pLNCX that obtains widespread use at home and abroad.So far do not see that retroviral vector recovers the report of replication, also do not see it causes the report of tumour because of inserting at random statement of facts because of reorganization, the security of retroviral vector is very high.

2. result:

2.1NS the preparation of animal model

The dosage of used ADR is the 5mg/kg body weight.Changing conditions with indexs such as body weight, urine amount and urine protein concentration of the NS animal pattern of oliguresis feature is seen Figure 15,16 and 17.

2.2 the influence of intramuscular injection mhANP gene pairs NS animal urine amount

ADR inductive NS animal has the feature of oliguresis.After importing mhANP expression of gene type recombinant chou in its body by intramuscular injection, compare with the animal of the non-treatment group of injecting empty carrier, the urine amount of treatment treated animal obviously increases the level that has met or exceeded normal group that has.The diuretic properties validity period of this method of gene introduction is 2-3 week.The results are shown in Figure 18.

2.3 intramuscular injection mhANP and the proteic influence of hBNP gene pairs NS animal urine

In three weeks after importing the mhANP gene, compare with non-treatment treated animal, the urine protein of treatment treated animal has the trend of reduction.The results are shown in Figure 19.

2.4 urine sodium and urine potassium

Compare with the animal pattern of non-treatment group, the urine sodium of treatment treated animal and urine potassium concn do not have considerable change.

2.5 Histological change

The mhANP gene shifts through somatocyte, can alleviate the degree of injury of NS animal tissues organ due to the ADR and promote its recovery.Concerning kidney, the importing of mhANP gene can alleviate the degeneration necrosis of renal tubular epithelial and promote it to recover regeneration, reduces the protein cast in renal tubules,convoluted and the collecting tubule, reduces the infiltration of inflammatory cell.Equally, after the mhANP gene imported, the heart and injury of animal pattern also had recovery trend.Alleviate such as myocardium graininess change, inflammatory cell infiltration reduces in the matter, and the myocardial cell arranges more neat, does not have obvious flesh agglutination phenomenon etc.

The common plasmid expression type recombinant chou of embodiment 6mhANP shifts the treatment ephrosis through somatocyte

Syndrome

1. method: except that special instruction was arranged, test method was the same.

Used in the present embodiment mhANP expression of gene type recombinant chou is pYF1.For further strengthening this tactful practicality and inquiring into the preferred plan for the treatment of, the dosage of genomic medicine has been dropped to the 0.25mg/kg body weight.

The used mhANP expression of gene type recombinant chou of present embodiment is pYF1.Making up their used carriers is common plasmid vector pcDNA3.1 (-) Myc-HisA that obtains widespread use.

2. result:

2.1NS the preparation of animal model

The method for preparing the NS animal model is the same.

2.2 the influence of intramuscular injection mhANP gene pairs NS animal urine amount

It is the same that the naked DNA of the common plasmid expression type recombinant chou pYF1 of mhANP gene is imported its intravital method, and dosage is the 0.25mg/kg body weight.Non-treatment treated animal then inject isometric(al), etc. empty carrier pcDNA3.1 (-) the Myc-His A of quality.Urine amount/weight ratio of the 3rd, 6 and 9 day behind the intramuscular injection mhANP gene is analyzed, found that the urine amount of treatment treated animal obviously increases.The genomic validity period of mhANP is 9 days.The results are shown in Figure 20.

2.3 intramuscular injection mhANP and the proteic influence of hBNP gene pairs NS animal urine

In 9 days after importing mhANP and hBNP gene, the animal urine protein concentration is not seen obvious reduction.

2.4 urine sodium and urine potassium

In 9 days after importing mhANP and hBNP gene, animal urine sodium and urine potassium concn do not have considerable change.

Embodiment 7 potent mutant human atrial natriuretic peptides and B-Type natriuretic peptide gene shift the treatment chronic cardiac insufficiency through somatocyte

1.mhANP and the preparation of hBNP expression recombinant pLHY24 and pLT28 plasmid DNA

1.1 alkaline lysis prepares plasmid DNA in a large number

1.2PEG precipitator method plasmid DNA purification

Concrete steps see molecular cloning laboratory manual (press of cold spring harbor laboratory) for details.

2. the structure of chronic cardiac insufficiency animal model

Adopt mechanicalness heart valve damage method to make up animal model for heart failure.Abdominal injection vetanarcol (50mg/kg body weight) anesthetized animal separates right common carotid artery, slowly inserts the heart catheter that front end is cut into the inclined-plane, and the other end of heart catheter connects pressure transducer (YP100 type), by LMS-2B type two road physiograph recording blood pressures.Heart catheter is slowly inserted, judge the position of heart catheter front end according to blood pressure waveform.When conduit enters ventricle by aortic valve, write down the intraventricular pressure ripple, light again pull catheter makes it withdraw from ventricle, the arteriotony ripple occurs.The push-and-pull conduit makes it pass in and out ventricle repeatedly, to destroy aortic valve.After the rat aorta lobe is impaired, heart is because arterial blood refluxes, the heart emptying is incomplete, preload increases, and in postoperative 4-6 week, the myocardial ischemia electrocardiogram(ECG can appear in animal, cardiac muscle is hypertrophy because of tangible compensatory hypertrophy, cardiac weight and cardiac index (cardiac weight/body weight) increase, and intramyocardial energy matter such as ATP (Triphosaden), Pcr (Phosphorylcreatinine) content reduce, and the content of energy metabolism refuse LA (lactic acid) then obviously increases.Sham group (sham operated rats) animal is meant through same operation but the intac animal of heart valve.For the processing of this animal, except that its heart valve was without damage, other is just the same when adopting mechanicalness heart valve damage method to make up animal model for heart failure then.

3. the intramuscular injection of naked DNA

The recombinant chou pLHY24 of purified mhANP and hBNP gene and the naked DNA of LT28 are dissolved in the physiological saline, make into the solution of 1mg/ml.Method anesthesia animal pattern with abdominal injection vetanarcol (30mg/kg body weight).Inject the dna solution that accounts for total amount 1/6 by the dosage of 5mg/kg body weight respectively at two limb muscle (3 places/limb) thereafter.Slowly push solution, pull out pin rapidly, and massage slightly in the injection site.Control group (non-treatment group) and sham operated rats animal are injected isometric physiological saline.

4. treatment result

4.1 the influence of intramuscular injection mhANP and BNP gene pairs animal pattern cardiac weight

After the rat aorta lobe was injured, heart was incomplete because of the arterial blood emptying that refluxes, and preload increases, raised for 6 weeks after, heart shows tangible compensatory hypertrophy, myocardial hypertrophy, cardiac weight and cardiac index (heart weight/body weight) increase.Control group (non-treatment group) the average cardiac weight of animal increases more than 50% than sham operated rats.Heart failure forms back (4 weeks of postoperative), give the treatment treated animal once through the expression recombinant pLHY24 of intramuscular injection mhANP and hBNP and the naked DNA of pLT28 (5mg/kg body weight), the ischemia of the visible heart in two week backs is alleviated, and the heart weighs and cardiac index all significantly reduces (p＜0.01).Intramuscular injection mhANP and hBNP gene are heavy to the animal pattern heart after two weeks sees Figure 21 and 22 respectively with influence cardiac index.

4.2 the influence of intramuscular injection mhANP and hBNP gene pairs animal pattern heart rate

The control rats aortic valve is after impaired 2 weeks, and heart rate is accelerated to some extent, and sham operated rats is not seen considerable change.The rat aorta lobe is after impaired 4 weeks, and through the expression type recombinant chou pLHY24 of intramuscular injection mhANP and hBNP and the naked DNA of pLT28 (5mg/kg body weight) once, the Electrocardiographic ischemia of most animals changes and all makes moderate progress.The ischemic animal heart rate is accelerated to some extent, and heart disorder appears in individual animal, sham operated rats changes in heart rate not obvious (Figure 23).

4.3 the influence of intramuscular injection mhANP and the energy metabolism of hBNP gene pairs animal cardiac muscle

Energy matter in the animal cardiac muscle in heart failure such as ATP, Pcr content reduce, and the content of energy metabolism refuse LA then obviously increases.Show that heart in heart failure increases at preload, self compensatory in, the variation that energy metabolism has also taken place.The expression type recombinant chou pLHY24 of intramuscular injection mhANP and hBNP and pLT28 are after two weeks, and the energy metabolism situation of heart obtains obvious improvement, and margin of energy increases, and lactic acid is accumulated minimizing (Figure 24,25 and 26).

4.4 the influence of intramuscular injection mhANP and hBNP gene pairs animal pattern blood pressure

Existing lot of documents is reported for work, and atrial natriuretic peptide and B-Type natriuretic peptide polypeptide all have many-sided effect such as row sodium, diuresis and step-down, but behind animal muscle in heart failure injection mhANP and the hBNP gene, its blood pressure is not seen considerable change.Blood pressure behind the treatment of animals in heart failure slightly reduces before than art, and pulse pressure difference increases (Figure 27).SAP shows systolic pressure among Figure 27, and DAP shows diastolic pressure.

4.5 the influence of intramuscular injection mhANP and hBNP gene pairs animal pattern body weight

Experimental session, the weight of animals normal growth is not seen notable difference (Figure 28) between each group.

4.6 intramuscular injection mhANP and the Electrocardiographic influence of hBNP gene pairs animal pattern

The rat aorta lobe is after impaired 2 weeks, and heart rate is accelerated to some extent, and the visible ischemia of electrocardiogram(ECG changes.The electrocardiogram(ECG of sham operated rats animal is not seen considerable change.After impaired 4 weeks, through intramuscular injection mhANP and hBNP gene expression profiling recombinant chou, the variation of the electrocardiogram(ECG ischemia of treatment group most animals all makes moderate progress at the rat aorta lobe.Figure 29 shows to treatment group and non-treatment group (injection equivalent physiological saline) the Electrocardiographic changing conditions of animal behind the animal muscle injection mhANP gene.

The restraining effect of embodiment 8mhANP gene pairs SHR rat blood pressure

1.mhANP the preparation of eukaryotic cell expression type recombinant chou pLHY24 plasmid DNA

1.1 conventional alkaline lysis prepares plasmid DNA in a large number

1.2 conventional PEG precipitator method plasmid DNA purification

2. liposome-mediated transgenosis

Adopt liposome-mediated gene transfer method that plasmid pLHY24 transfection is advanced in the Retronituse encapsulated cell line PA317 cell.Detailed process is: digestion, collect and counting cells, with 30～35% density inoculation PA317 cell (about 5 * 10 at the bottom of the six orifice plate wares that can be paved with φ 35mm ⁴/ ware), adds the 2ml perfect medium, in 37 ℃, 5%CO ₂Cultivated under the condition about 24 hours, the concrete time with cell density be no more than 60～65% be advisable with.In 12 * 75mm sterile tube, prepare solution A: the suitableeest nutrient solution of 2ug super spirial plasmid DNA+100ul (OPTI-MEM I Reduced Serum Medium), pressure-vaccum 7～8 times is with abundant mixing gently, solution B: with 10ul Lipofectamine Regent reagent abundant mixing in the suitableeest nutrient solution of 100ul, left standstill under the room temperature 15 minutes, with solution A and B mixing gently, leave standstill 45 minutes under the room temperature to form the DNA-liposome complex, add the suitableeest nutrient solution of 800ul and mixing again.Cell before 45 minutes time limits arrive in the usefulness 2ml physiological saline washing culture dish 1 time is abandoned most washings, adds the mixture (1ml/ hole) of solution A and B immediately.37 ℃, 5%CO ₂After cultivating 3～5 hours under the condition, the D-MEM continuation cultivation that 1ml contains 30% calf serum is added in every hole.Transfection is carried out changing normal nutrient solution after 24 hours.Transfection is after 48～72 hours (concrete time visual cell density and decide, be no more than 95% with it and be advisable), goes down to posterity with the density of energy confluent culture bottle 30～40%, adds normal cultivation and cultivates based under 37 ℃, 5%CO2 condition.

3.PA317 cell resistance clone's screening and amplification

3.1G418 initially screen determining of concentration

Different cells is had any different to the susceptibility of G418, should pre-determine suitable initial screening concentration.The PA317 cell inoculation in six orifice plates, is treated that cell grows to 50～60%, add G418, changed liquid once in 3～4 days, observe about 10 days by the every hole of certain concentration gradient.Cell begins death after 3～4 days, concentration is initially screened in whole dead G418 concentration conducts after 6～7 days in the selection cultivation.

3.2 the screening and the amplification of transfect cell G418 resistance clone

After treating that above-mentioned transfectional cell launches fully, change and add the D-MEM that contains initial screening concentration G418 and carry out screening and culturing, set the control group of not transfection simultaneously, changed 1 not good liquor in 3 days.Transfection group can form G418 resistant cell clone in about 10～14 days.Amplification resistant cell clone.

4.G418 the extraction of resistant cell genomic dna

Digestion, collection cultured cells, PBS washes 2 times, and cell is resuspended in (5 * 10 cells/ml), add 5ml cell pyrolysis liquid (0.5%SDS among the 0.5ml TE; 0.lmol/L EDTA, pH8.0; 10mmol/L Tris-Cl, PH8.0; 20ug/ml RNase), be transferred in the 50ml Erlenmeyer flask, mixing gently, 37 ℃ incubation l hour.Adding Proteinase K to final concentration is 100ug/ml, with a glass rod gentleness enzyme is sneaked in the viscous solution.The suspension of lysing cell is put 50 ℃ of water-baths 3 hours, and shake this viscous solution frequently.Solution is chilled to room temperature, and in the immigration centrifuge tube, add equal-volume through 0.5mol/L Tris-Cl (pH8.0) equilibrated phenol, slowly put upside down centrifuge tube back and forth 10 minutes, room temperature 5000rpm 15 minutes, move supernatant with heavy caliber transfer pipet or rifle head and put another centrifuge tube, repeat extracting 2 times with phenol again, with chloroform extracting 1 time.Add 2 times of volume 95% ethanol in the supernatant, 1/10 volume 3M NaAc precipitation is rotated a little and is seen that promptly thread genomic dna occurs, with the Tip head thread DNA is moved in the 1.5ml Eppendorf pipe, wash 1 time with 70% ethanol, be dissolved among the 1ml TE (PH8.0)-20 ℃ of preservations after drying.

5. the replication-defective virus particulate is collected and titer determination

Treat that PA317 cell in 24 orifice plates is long during to 80-100%, change the nutrient solution that does not contain G418, continue to cultivate 24 hours, collect viral supernatant, remove cell and impurity with 0.45 μ ml membrane filtration, take out a part, measure destination gene expression product mhANP with putting the method for exempting from (RIA) ₂₈Expression level, another part is in-70 ℃ of preservations, is used for virus titer and measures and/or cells infected.

Adopt rapid method to measure replication-defective virus particulate titre.With 1 * 10 ⁵The NIH3T3 cell inoculation is put 37 ℃, 5%CO in 6 orifice plates ₂Cultivate under the condition, after 24 hours, abandon nutrient solution, every hole adds fresh medium 1ml and viral supernatant 100ul, add polybrene to final concentration 8ug/ml, continue to cultivate after 24 hours, go down to posterity in 1: 6 ratio, visual cell's growing state carried out screening and culturing with the nutrient solution that contains G418 after 24-48 hour.Form the cell clone of anti-G418 after 10-14 days.Choose several resistant cell clones and carry out amplification cultivation, frozen standby respectively.

6.SHR it is foster that rat freshman mouse skin flbroblast former is commissioned to train

Newborn SHR suckling mouse (being born back 24 hours in) integral body is soaked in 70% the ethanol, moves into after 5 minutes in another cup 70% ethanol, soaked again 5 minutes.The clip skin of back is put the skin histology piece of cutting in 70% ethanol and to be soaked 10 minutes.Remove fatty tissue as far as possible, skin graft is cut into 0.5cm ²About size, with the physiological saline rinsing 2 times that contains penicillin, each 400u/ml of Streptomycin sulphate and 400 μ g/ml, 5 minutes/time.Take out skin graft and remove drop as far as possible, put in the penicillin bottle, add two calf serums, as far as possible it is shredded with scissors.With the elbow suction pipe with " mud shape " tissue dibbling in the culturing bottle wall, add a little D-MEM nutrient solution (calf serum 15%, each 100u of penicillin and streptomycin and 100 μ g/ml), the amount of nutrient solution is with can wall is moistening exceeds with whole bottle.Culturing bottle is inverted in 37 ℃, 5%CO ₂Under the condition 10-30 minute, so that " mud shape " tissue can be attached at a bottle wall more securely.Reverse culturing bottle, so that " mud shape " tissue of dibbling contacts with nutrient solution light and slowly.If the quantity not sufficient of nutrient solution, available elbow dropper with nutrient solution slowly place the destination organization piece around.Place 37 ℃ of cultivations.Be that visible spindle cell grows around the tissue block after general three days.Changed liquid once on the 3rd day.Since for the first time institute to add nutrient solution few, so need not abandon old liquid when changing liquid the first time, promptly only be liquid feeding.A small amount of old nutrient solution continues to stay in culturing bottle, can avoid adding that the growing environment of cell changes too greatly behind the new nutrient solution.Treating that cell around the different tissues piece connects goes down to posterity when in blocks: abandon old nutrient solution, physiological saline cleans to grow has the bottle of cell wall once, add about 0.025%EDTA 0.5ml, rotate culturing bottle so as with the cell uniform contact, add several 0.25% pancreatin again, rotate culturing bottle behind the mixing again with peptic cell, after treating the cell change garden about 1/2, add an amount of nutrient solution (15% calf serum) and stop digestion, dispel cell gently, the visual cell what and move and in 1～several new culturing bottles, continue to cultivate.

7. the skin flbroblast of Infection in Vitro SHR newborn rat

With the skin flbroblast of SHR newborn rat with 5 * 10 ⁵Be inoculated in the 250ml culturing bottle, in 37 ℃, 5%CO ₂Cultivate under the condition, add destination gene expression level and all higher viral suspension of virus titer at the bottom of waiting to be paved with bottle during 70% left and right sides, add polybrene simultaneously to final concentration 6ug/ml, continue to cultivate after 24 hours, go down to posterity in the 250ml culturing bottle with 1: 5, visual cell's growing state adds G418 and carries out screening and culturing after in 24 to 48 hours.

8.mhANP the screening of high expressing cell system

Filter out Neo with G418 ^rPositive cell clone detects gene mhANP at Neo with the PCR method ^rIntegration situation in the positive cell clone with the secretion level that RIA measures gene mhANP expression product, is selected the also genetically engineered cell of enlarged culturing mhANP high expression level.

9. the preparation of rat tail collagen

3 on-20 ℃ of frozen rats (300～500 gram) tail, soaked 30 minutes in 70% ethanol, extracting tail tendon (extracts out as being difficult for, can be cut into segment earlier), shred as far as possible, soaked 48 hours in 4 ℃, centrifugal 1.5 hours of 4 ℃ of 5000rpm with 0.02M Glacial acetic acid 400ml, move supernatant in another pipe, 4 ℃, centrifugal 2 hours of 15000rpm inhales the collection supernatant, added 0.1MNaOH (6: 1, V/V) in and Glacial acetic acid after collagen protein promptly precipitate, centrifugal 10 minutes of room temperature 2000rpm abandons supernatant, 0.02M Glacial acetic acid with the new preparation of equal-volume dissolves the collagen protein precipitation again, and 4 ℃ of preservations are standby.

10. the preparation of collagen graft

At first with integrated in the genome foreign gene mhANP and can high expression level and the genetically engineered cell of secretion mhANP polypeptide be suspended in the nutrient solution (1.5 * 10 ⁶Cell/ml), then in rat tail collagen (2mg/kg body weight): 5 * D-MEM: calf serum: cell suspension=3.0: 1.0: 0.5: 0.5 ratio prepares the collagen graft.

11. expression-secretion mhANP ₂₈Genetically engineered cell to the transplantation experiments of SHR rat

Allow buy back 4 ages in week (on average weigh 66 gram) SHR shaked down for 1 week, be numbered then, work such as weighing and random packet.With the method anesthetized animal of abdominal injection vetanarcol (40mg/kg body weight), subcutaneous injection collagen graft.Divide inject the subcutaneous of both sides, SHR back at 4 by the amount of 5ml/ SHR.All regularly carry out body weight weighing, blood pressure determination, A urine sample collection device (measuring electrolyte concentration in urine amount, the urine) and eye socket before and after transplanting weekly and get blood (measuring wherein ionogen and ANP concentration).

12. the metabolic cage method is collected urine sample

Press the dosage of 5ml physiological saline/100g body weight and irritate stomach, put (1/cage) in the metabolic cage, fasting, taboo water 6 hours are also collected urine sample.Accurately measure volume of urine, centrifugal 5 minutes of 3000rpm to remove graininess impurity, is used for the mensuration of electrolyte concentrations such as potassium, sodium.

13. blood sample collection

Get blood from eye socket, be divided into two parts.Portion does not add antithrombotics, solidifies the back separation of serum, is used for the mensuration of electrolyte concentrations such as blood potassium, sodium.Another part then adds EDTA and the 10ul Trypsin inhibitor,Trasylol of 20ul in advance, and separated plasma is used for the mensuration of ANP concentration.As can not in time measuring, then cryogenic freezing is preserved.

14. measurement blood pressure

Measure blood pressure with mouse tail folder method.Every each accurate measurement three times of SHR is got its mean value.Annotate: the warm up time of animal should be greater than 15 minutes, so that its afterbody blood vessel fully expands.

15. treatment result

15.1mhANP transgenosis is to the influence of SHR rat blood pressure

After having implanted the collagen graft, though blood pressure and the control group of all treatment treated animals is the same, the increase of understanding the follower age is in rising gradually,, be lower than control group all the time in 7 weeks after transplanting.Compare with non-treatment group, the 1st week after transplant, the just obviously reduction of the rate of rise of treatment treated animal blood pressure, the produce effects phase was 7 weeks.Blood pressure difference the maximum came across for the 2nd week between treatment group and the non-treatment treated animal, reached 34mmHg (124.04 ± 22.41 and 158.83 ± 5.94, p＜0.001).The results are shown in Figure 30.

15.2mhANP transgenosis is to the influence of SHR rat urine amount

From treating second week after beginning, the urine amount of treatment treated animal is just obviously greater than non-treatment group, and the produce effects phase can keep for 2 weeks.Compare with non-treatment group, 2.3 (2.44/1.03)-3.2 (2.44/0.83) that the urine increment after the treatment treated animal treatment can reach the former doubly.The results are shown in Figure 31.

15.3 influence to other physical signs

After testing, in the whole experiment after transplanting, except that blood pressure mentioned above and urine amount, the mhANP gene imports the result who also expresses in the body does not have obviously influence through indirect intracorporal method to electrolyte concentrations such as the potassium in SHR rat blood and the urine, sodium, and its Plasma ANP level does not have considerable change yet.

Sequence table

SEQ ID NO:1 (nucleotide sequence of hANP)

ATG?AGC?TCC?TTC?TCC?ACC?ACT?CAA?GCT?AGC?TTC?CTC?CTT

TTA?CTG?GCA?TTC?CAG?CTC?CTA?GGT?CAG?ACC?AGA?GCT?AAT

CCC?ArG?TAC?AAT?GCC?GTG?TCC?AAC?GCA?GAC?CTG?ATG?GAr

TTC?AAG?AAT?TTG?CTG?GAC?CAT?TTG?GAA?GAA?AAG?ATG?CCT

TTA?GAA?GAT?GAG?GTC?GTG?CCC?CCA?CAA?GTG?CTC?AGT?GAG

CCG?AAT?GAA?GAA?GCG?GGG?GCT?GCT?CTC?AGC?CCC?CTC?CCT

GAG?GTG?CCT?CCC?TGG?ACC?GGG?GAA?GTC?AGC?CCA?GCC

CAG?AGA?GAT?GGA?GGT?GCC?CTC?GGG?CGG?GGC?CCC?TGG

GAC?TCC?TCT?GAT?CGA?TCT?GCC?CTC?CTA?AAA?AGC?AAG?CTG

AGG?GCG?CTG?CTC?ACT?GCC?CCT?CGG?AGC?CTG?CGG?AGA

TCC?AGC?TGC?TTC?GGG?GGC?AGG?ATG?GAC?AGG?ATT?GGA

GCC?CAG?AGC?GGA?CTG?GGC?TGT?AAC?AGC?TTC?CGG?TAC

TGA

(the proteinic aminoacid sequence that hANP is coded, wherein last 28 black italics show hANP to SEQ ID NO:2 ₂₈Aminoacid sequence)

Met?Ser?Ser?Phe?Ser?Thr?Thr?Gln?Ala?Ser?Phe?Leu?Leu?Leu?Leu?Ala?Phe

Gln?Leu?Leu?Gly?Gln?Thr?Arg?Ala?Asn?Pro?Met?Tyr?Asn?Ala?Val?Ser?Asn

Ala?Asp?Leu?Met?Asp?Phe?Lys?Asn?Leu?Leu?Asp?His?Leu?Glu?Glu?Lys

Met?Pro?Leu?Glu?Asp?Glu?Val?Val?Pro?Pro?Gln?Val?Leu?Ser?Glu?Pro?Asn

Glu?Glu?Ala?Gly?Ala?Ala?Leu?Ser?Pro?Leu?Pro?Glu?Val?Pro?Pro?Trp?Thr

Gly?Glu?Val?Ser?Pro?Ala?Gln?Arg?Asp?Gly?Gly?Ala?Leu?Gly?Arg?Gly?Pro

Trp?Asp?Ser?Ser?Asp?Arg?Ser?Ala?Leu?Leu?Lys?Ser?Lys?Leu?Arg?Ala?Leu

Leu?Thr?Ala?Pro?Arg?Ser?Leu?Arg?Arg?Ser?Ser?Cys?Phe?Gly?Gly?Arg

Met?Asp?Arg?Ile?Gly?Ala?Gln?Ser?Gly?Leu?Gly?Cys?Asn?Ser?Phe?Arg

Tyr

SEQ ID NO:3 (nucleotide sequence of mhANP)

ATG?AGC?TCC?TTC?TCC?ACC?ACT?CAA?GCT?AGC?TTC?CTC?CTT

TTA?CTG?GCA?TTC?CAG?CTC?CTA?GGT?CAG?ACC?AGA?GCT?AAT

CCC?ATG?TAC?AAT?GCC?GTG?TCC?AAC?GCA?GAC?CTG?ATG?GAT

TTC?AAG?AAT?TTG?CTG?GAC?CAT?TTG?GAA?GAA?AAG?ATG?CCT

TTA?GAA?GAT?GAG?GTC?GTG?CCC?CCA?CAA?GTG?CTC?AGT?GAG

CCG?AAT?GAA?GAA?GCG?GGG?GCT?GCT?CTC?AGC?CCC?CTC?CCT

GAG?GTG?CCT?CCC?TGG?ACC?GGG?GAA?GTC?AGC?CCA?GCC

CAG?AGA?GAT?GGA?GGT?GCC?CTC?GGG?CGG?GGC?CCC?TGG

GAC?TCC?TCT?GAT?CGA?TCT?GCC?CTC?CTA?AAA?AGC?AAG?CTG

AGG?GCG?CTG?CTC?ACT?GCC?CCT?CGG?AGC?CTG?CGG?AGA

TCC?AGC?TGC? TCC?GGG?GGC?AGG? ATA?GAC?AGG?ATT?GGA

GCC?CAG?AGC?GGA?CTG?GGC?TGT?AAC?AGC?TTC?CGG?TAC

TGA

(the proteinic aminoacid sequence that mhANP is coded, wherein last 28 black matrix three loigatures show mbANP to SEQ ID NO:4 ₂₈Aminoacid sequence)

Met?Ser?Ser?Phe?Ser?Thr?Thr?Gln?Ala?Ser?Phe?Leu?Leu?Leu?Leu?Ala?Phe

Gln?Leu?Leu?Gly?Gln?Thr?Arg?Ala?Asn?Pro?Met?Tyr?Asn?Ala?Val?Ser?Asn

Ala?Asp?Leu?Met?Asp?Phe?Lys?Asn?Leu?Leu?Asp?His?Leu?Glu?Glu?Lys

Met?Pro?Leu?Glu?Asp?Glu?Val?Val?Pro?Pro?Gln?Val?Leu?Ser?Glu?Pro?Asn

Glu?Glu?Ala?Gly?Ala?Ala?Leu?Ser?Pro?Leu?Pro?Glu?Val?Pro?Pro?Trp?Thr

Gly?Glu?Val?Ser?Pro?Ala?Gln?Arg?Asp?Gly?Gly?Ala?Leu?Gly?Arg?Gly?Pro

Trp?Asp?Ser?Ser?Asp?Arg?Ser?Ala?Leu?Leu?Lys?Ser?Lys?Leu?Arg?Ala?Leu

Leu?Thr?Ala?Pro?Arg?Ser?Leu?Arg?Arg?Ser?Ser?Cys? Ser?Gly?Gly?Arg? Ile

Asp?Arg?Ile?Gly?Ala?Gln?Ser?Gly?Leu?Gly?Cys?Asn?Ser?Phe?Arg?Tyr

SEQ ID NO:5 (nucleotide sequence of hBNP, wherein capitalization shows exon, lowercase shows intron)

ATGGATCCCCAGACAGCACCTTCCCGGGCGCTCCTGCTCCTGCT

CTTCTTGCATCTGGCTTTCCTGGGAGGTCGTTCCCACCCGCTGG

GCAGCCCCGGTTCAGCCTCGGACTTGGAAACGTCCGGGTTACA

G

gtgagagcggagggcagctcagggggattggacagcagcaatgaaagggtcctcacctgctgtccca

agaggccctcatctttcctttggaattagtgataaaggaatcagaaaatggagagactgggtgccctgac

cctgtacccaaggcagtcggttcacttgggtgccatgaagggctggtgagccaggggtgggtccctga

ggcttggacgcccccattcattgcag

GAGCAGCGCAACCATTTGCAGGGCAAACTGTCGGAGCTGCAGG

TGGAGCAGACATCCCTGGAGCCCCTCCAGGAGAGCCCCCGTCC

CACAGGTGTCTGGAAGTCCCGGGAGGTAGCCACCGAGGGCATC

CGTGGGCACCGCAAAATGGTCCTCTACACCCTGCGGGCACCAC

GA AGCCCCAAGATGGTGCAAGGGTCTGGCTGCTTTGGGAG

GAAGATGGACCGGATCAGCTCCTCCAGTGGCCTGGGCTGC

AAAG

gtaagcaccccctgccaccccggccgccttcccccattccagtgtgtgacactgttagagtcactttggg

gtttgttgtctctgggaaccacactctttgagaaaaggtcacctggacatcgcttcctcttgttaacagcctt

cagggccaaggggtgcctttgtggaattagtaaatgtgggcttatttcattaccatgcccacaataccttct

ccccacctcctacttcttatcaaaggggcagaatctcctttgggggtctgtttatcatttggcagcccccca

gtggtgcagaaagagaaccaaacatttcctcctggtttcctctaaactgtctatagtctcaaaggcagaga

gcaggatcaccagagcaatgataatccccaatttacagatgaggaaactgaggctcagagagttgcatt

aagcctcaaacgtctgatgactaacagggtggtgggtggcacacgatgaggtaagctcagcccctgcct

ccatctcccaccctaaccatcatcaccctctctctttccctgacag

TGCTGAGGCGGCATTAA

(the proteinic aminoacid sequence that hBNP is coded, boldface type wherein shows hBNP to SEQ ID NO:6 ₃₂Aminoacid sequence)

Met?Asp?Pro?Gln?Thr?Ala?Pro?Ser?Arg?Ala?Leu?Leu?Leu?Leu?Leu?Phe?Leu

His?Leu?Ala?Phe?Leu?Gly?Gly?Arg?Ser?His?Pro?Leu?Gly?Ser?Pro?Gly?Ser

Ala?Ser?Asp?Leu?Glu?Thr?Ser?Gly?Leu?Gln?Glu?Gln?Arg?Asn?His?Leu?Gln

Gly?Lys?Leu?Ser?Glu?Leu?Gln?Val?Glu?Gln?Thr?Ser?Leu?Glu?Pro?Leu?Gln

Glu?Ser?Pro?Arg?Pro?Thr?Gly?Val?Trp?Lys?Ser?Arg?Glu?Val?Ala?Thr?Glu

Gly?Ile?Arg?Gly?His?Arg?Lys?Met?Val?Leu?Tyr?Thr?Leu?Arg?Ala?Pro?Arg

Ser?Pro?Lys?Met?Val?Gln?Gly?Ser?Gly?Cys?Phe?Gly?Arg?Lys?Met?Asp

Arg?Ile?Ser?Ser?Ser?Ser?Gly?Leu?Gly?Cys?Lys?Val?Leu?Arg?Arg?His

Claims (14)

1, the polynucleotide of the potent mutant human atrial natriuretic peptide of coding, it is the sequence shown in the SEQ ID NO:3.

2, potent mutant human atrial natriuretic peptide polypeptide, it is the aminoacid sequence shown in the SEQ ID NO:4.

3, the expression type recombinant chou that comprises the polynucleotide of claim 1.

4, expression type recombinant chou as claimed in claim 3, it is based on the virus vector of retrovirus, adenovirus or adeno-associated virus (AAV) or contains the expression type recombinant chou of the common plasmid vector of eukaryotic cell expression element.

5, expression type recombinant chou as claimed in claim 4, it is pLHY24, collection of illustrative plates is seen Fig. 4.

6, expression type recombinant chou as claimed in claim 4, it is pYF1, collection of illustrative plates is seen Fig. 5.

7, comprise each the gene therapy medicament of expression type recombinant chou of claim 3～6.

8, each expression type recombinant chou of claim 3～6 is used for the treatment of application in the gene therapy medicament of nephrotic syndrome in preparation.

9, each expression type recombinant chou of claim 3～6 is used for the treatment of application in the gene therapy medicament of chronic cardiac insufficiency in preparation.

10, each expression type recombinant chou of claim 3～6 is used for the treatment of application in the hypertensive gene therapy medicament in preparation.

11, comprise claim 3～6 each the potent mutant human atrial natriuretic peptide of coding the expression type recombinant chou and be selected from gene therapy medicament as the expression type recombinant chou of the coding human brain natriuretic peptide of next group, wherein said group consists of: a) comprise human brain natriuretic peptide expression of gene type recombinant chou, wherein the nucleotides sequence of human brain natriuretic peptide gene is classified as shown in the SEQ ID NO:5, b) expression type recombinant chou pLT28, collection of illustrative plates is seen Fig. 8, and c) expression type recombinant chou pYF2, collection of illustrative plates is seen Fig. 9.

12, claim 3～6 each the potent mutant human atrial natriuretic peptide of coding the expression type recombinant chou and be selected from the application that is used for the gene therapy medicament of combination therapy nephrotic syndrome as the expression type recombinant chou of the coding human brain natriuretic peptide of next group in preparation, wherein said group consists of: a) comprise human brain natriuretic peptide expression of gene type recombinant chou, wherein the nucleotides sequence of human brain natriuretic peptide gene is classified as shown in the SEQ ID NO:5, b) expression type recombinant chou pLT28, collection of illustrative plates is seen Fig. 8, and c) expression type recombinant chou pYF2, collection of illustrative plates is seen Fig. 9.

13, claim 3～6 each the potent mutant human atrial natriuretic peptide of coding the expression type recombinant chou and be selected from the application that is used for the gene therapy medicament of combination therapy chronic cardiac insufficiency as the expression type recombinant chou of the coding human brain natriuretic peptide of next group in preparation, wherein said group consists of: a) comprise human brain natriuretic peptide expression of gene type recombinant chou, wherein the nucleotides sequence of human brain natriuretic peptide gene is classified as shown in the SEQ ID NO:5, b) expression type recombinant chou pLT28, collection of illustrative plates is seen Fig. 8, and c) expression type recombinant chou pYF2, collection of illustrative plates is seen Fig. 9.

14, claim 3～6 each the potent mutant human atrial natriuretic peptide of coding the expression type recombinant chou and be selected from the application that is used for the hypertensive gene therapy medicament of combination therapy as the expression type recombinant chou of the coding human brain natriuretic peptide of next group in preparation, wherein said group consists of: a) comprise human brain natriuretic peptide expression of gene type recombinant chou, wherein the nucleotides sequence of human brain natriuretic peptide gene is classified as shown in the SEQ ID NO:5, b) expression type recombinant chou pLT28, collection of illustrative plates is seen Fig. 8, and c) expression type recombinant chou pYF2, collection of illustrative plates is seen Fig. 9.

Images