CN1238807A - Stabilized transient gene expression - Google Patents

Abstract

This invention provides methods and agents for enhancing transient expression in eukaryotic cells. Also provided are a model system for achieving prolonged transient expression in solid tumors, a means for culturing hepatocytes without feeder cells or an extracellular matrix bonded to the substratum, and a mehtod for manipulating cellular metabolism to reduce the cells' consumption of glucose.

Description

Stable transient gene expression

The application is U.S. Patent application 08/833, the 747 part subsequent application in (April 11 1997 applying date), and the latter is U.S. Provisional Application 60/030, the 109 part subsequent application in (November 1 1996 applying date).

Invention field

The present invention relates to improve the method and the reagent that have imported the transient expression of cultivating the foreign gene in the eukaryotic cell.

Background of invention

Foreign DNA is imported eukaryotic host cell many purposes are arranged.For example, this technology can provide a kind of method that is used to identify the genetic complementation of concrete gene, for example expresses gene for the vital enzyme of pathways metabolism and can utilize it to save the ability of deficient cells and obtain identifying in this approach.In addition, can import foreign gene makes recipient cell be exposed to the proteinic purpose of high dosage to reach, described protein is improper natural for described cell, for example a kind of cytotoxic protein matter is imported in the malignant cell to reach the purpose of killing described malignant cell.Perhaps, foreign gene can be imported host cell obtaining the enough amounts of protein products of foreign gene, thereby recyclable described protein is to be used for further research or as medicine.In addition, the importing of foreign gene is a kind of promising method of body gene therapy.Gene therapy purpose be by provide effective copy to the patient lose or dcc gene is cured born hereditary defect, perhaps, temporarily provide exogenous genes products in order to reach therapeutic purpose.A kind of body gene therapy method is the method that exsomatizes, and wherein takes out cell in body, and transgenosis DNA is inserted described cell, then described cell is retracted in the body.In another approach, come the target cells in vivo by directly importing the intravital foreign DNA of patient.

Foreign gene can be imported in the eukaryotic cell of living by the whole bag of tricks.These methods comprise for example utilizes the virus vector that has wherein connected foreign gene.Usually, virus vector only target enliven splitted cell (for example hemopoietic stem cell).The another kind of useful method that is used to import foreign DNA is an electroporation, wherein exists under the condition of dna solution, and cell is to using thereon instantaneous high pressure electricimpulse and react and taking in DNA.Other common method of foreign DNA transfered cell is comprised the fat transfection, wherein DNA is combined with liposome that described liposome is the formed liquid filling capsule of fat molecule that forms membrane structure by assembling.Dna molecular can be coated in the liposome or with liposome membrane and link to each other.Liposome and recipient cell merge, thereby become an approach with the foreign gene transfered cell.Although be widely used, the defective that fat dyes is that liposome has a toxicity to the eukaryotic cell of living.In other method commonly used, can be before being applied to cell, with DNA and coprecipitation of calcium phosphate, perhaps can foreign DNA be imported by the DEAE-dextran, this polymkeric substance of described DEAE-dextran and DNA form electrostatic complexes, this mixture enters cell interior (Kormis and wu, SeminarsLiv.Dis., 15:257-267 (1995)) by endocytosis.Specifiable transfection method a lot (referring to for example, Sambrook et al., Molecular Cloning, 2d ed., (1989), the document is incorporated herein by reference; Gorman, C., to mammal cell with high efficient metastatic gene (" High EfficiencyGene Transfer into Mammalian Cells "), Chap.6, pp.143-190, from " (dna clone II-practical approach ", IRL Press, Oxford (1985), Ed.Glover, D.M.; Wynshaw-Boris et al., biotechnology (BioTechniques), 4:104-119 (1986); Chang, P.L. (Ed), somatic gene therapy (Somatic Gene Therapy), CRC Press, 1995; " eukaryotic cationic lipid reagent transfection guide " (Guide toEukaryotic Transfection with Cationic Lipid Reagents), LifeTechnologies (Gibco-BRL)).

" transfection " is a term general, is usually used in describing the method that foreign gene (" transgenosis ") is imported the host cell of living.Another term of this method is " transduction ", when referring to the transgenosis of virus vector mediation, and back more commonly used one term.The host cell of expressing or mix foreign DNA is called as " transformant ", and its method that becomes conversion conditions is called as " conversion " or " transduction ".The susceptibility difference of dissimilar cells to transforming, and by adjusting various parameters such as pH, type of culture medium, the DNA amount, gas concentration lwevel or the method that imports DNA can optimize be used to import foreign DNA method (referring to for example Chen and Okayama, molecular cytobiology (Mol.Cell.Biol.), 7:2745-2752 (1987)).

When during with the foreign DNA transfered cell, having observed most of cell and begun to take in DNA with calcium phosphate or DEAE-dextran method, but after described DNA is imported into a few days ago in, have only the described DNA of parts of fine cellular expression (referring to, Gorman (1985) for example).The early expression of transfection DNA is normally short-lived, and is called as " transient expression ".Still have small portion recipient cell (0.1-0.001%) by the DNA covalency with transfection be connected into stably mix in the host genome described DNA (referring to, Wynshaw-Boris et al. for example, (1986)).After the foreign DNA of transfection inserted in the host DNA with the mode covalency of supporting described exogenous gene expression, the cell of gained was exactly so-called " stable conversion ".The possible reason that the covalency integrative levels is low is only can carry out foreign DNA to integrate when active dna synthetic.Therefore, only it is believed that cell is just to the stable conversion sensitivity in the cell cycle S phase.

In the cell of stable conversion, during each cell fission, foreign gene all can be replicated, and can be obtained by the enzymatic mechanism identical with transcribing the endogenous cell chromogene expressing by described foreign gene encoded protein matter.But, after the transient expression of beginning, have only the small portion cell to contain the rotaring redyeing gene of complete copy usually in the transfection culture.Therefore, the amount of expressed exogenous gene is very little in this culture, even may can not detect.Therefore, stable method for transformation depends on the screening step after the transfection usually provides the selection growth vigor so that give adding the minority stable transformed cells that produces behind the foreign DNA.

Can under various test conditionss, also continue to express the clone of described foreign gene so that obtained integrating foreign gene by the pure growth of selective separation stable transformed cells.In order to reach this purpose, in the DNA that imports the coding desired protein, a selected gene must be imported host cell, described selected gene is normally given the gene of drug resistance or coding product chromoprotein.The example that is applicable to the reporter gene of this purpose comprises genes (referring to for example Alam and Cook, analytical biochemistry, 188:245-254 (1990)) such as bacterium E.C. 2.3.1.28, luciferase, alkaline phosphatase, bacteria beta-galactosidase.If use the drug resistance mark, must come the screening of medicaments resistant cell in related drugs by long-term exposure, so that make the cell of stable conversion in culture, account for major part.Perhaps, express the cotransfection gene that product look substrate can be transformed into coloring matter by them and can identify the cell that contains dna integration, the feasible cell that can identify and manually clone single stable conversion of described coloring matter.In some cases, required gene itself can be given the cell of stable conversion with the selectivity proterties, but this situation is rarely found.Under any circumstance, the generation of stable transformed cells system all will spend one to trimestral time just can finish (Wynshaw-Boris et al., (1986)) with separating.

Compare with stable conversion, the transient expression of transfection DNA does not rely on foreign DNA and is integrated in the host cell chromosome.Although it is believed that the most of DNA that adds in the cell is transported to rapidly in the nuclear, in some systems, do not exist under any situation that detects integration, can after transfection, reach and detect expression in 80 hours (referring to for example Gorman (1985); Wynshaw-Boris et al., (1986)).Before detecting transient expression, do not need to screen step.But, the cell of taking in the 1-10% that only has an appointment in the foreign DNA usually from transfected transcription of foreign genes mRNA (referring to, Gorman etc. for example, nucleic acids research (Nucl.Ac.Res.), 11:7631-7648 (1983)).Although in the cell of transient transfection, the DNA of a large amount of transfections is not incorporated in the host DNA, has mixed described DNA (Alamand Cook (1990)) in the cell of about 0.001-1% really.Among the exogenous gene expression figure that after transfection, promptly observes, it is believed that the cell of this small portion stable transfection does not play a part remarkable or useful.

Do not screen step, expression of exogenous gene disappears from the culture of transfectional cell rapidly.Usually, the transient expression in culturing cell reached peak value in the time of about 48 hours, and only can detect (Gorman (1985) in 24-80 hour; Wynshaw-Boris etal., (1986)).Everybody generally believes that the most of DNA that is taken in by transfectional cell is decomposed by nuclease rapidly or is diluted by cell fission (referring to, Gorman (1985) for example; With the eukaryotic cell transfection guide of cationoid reagent, Life Technologies).

Because transient expression does not need target cell carrying out the activity division, therefore, but in the cell of the final differentiation that does not have proper splitting, carry out transient expression, although there were significant differences for the transfection susceptibility of these cells.For example naked DNA by direct injection to mice skeletal, can obtain expressing (Wolff etc., science, 247,1465-1468 (1990)).In other research, naked DNA is used as vaccine (Cohen, J., science, 259,1691-1692 (1993)).

Many researchs all concentrate in vivo with liposome with foreign DNA be passed to liver cell (referring to, Wu and Wu for example, journal of biological chemistry, 263:14621-14624 (1988); Chow etal., J.Pharmacol.Exp.Ther., 248:506-13 (1989); Wu et al., journal of biological chemistry, 264:16985-16987 (1989); Kaneda et al., journal of biological chemistry, 264:12126-12129 (1989a); Kaneda et al., science, 243:375-378 (1989b); Wilson et al., journal of biological chemistry, 267:963-967 (1992); Wilson et al., journal of biological chemistry, 267:11483-11489 (1992b); Chowdhury et al., journal of biological chemistry, 268:11265-11271 (1993); Perales et al., institute of NAS newspaper, 91:4086-4090 (1994); Kormis and Wu (1995)).A kind of method with particular organization in the foreign DNA guide way is receptor-mediated liposome transmission (seeing the summary (1995) of Kormis and Wu).When this method was applied to liver, Wu and he's colleagues had utilized asialoglycoprotein acceptor that surface of hepatocytes exists and with the liposome guiding liver of injection.This transfer system (Wu and Wu (1988) has been described in a series of publication; Wu et al., (1989); Wilsonet al., (1992a); Wilson et al. (1992b); Chowdhury et al. (1993); Peraleset al. (1994)).Asialoglycoprotein is packaged in the liposome with DNA, and described DNA forms electrostatic complexes with many Methionins.After initial effort success, this group attempts by carry out the stable integration maximization that partially hepatectomized makes foreign DNA in the acceptor rat.Because in the regenerated liver cell, want high in the ratio normal hepatocytes of S phase cell, therefore infer that this taxis can increase the hepatocellular ratio that can integrate foreign DNA.Behind the partially hepatectomized, after transfection, reach in the time in 11 weeks, in blood, all can detect transgenic protein (Wu etal. (1989)).Originally, these researchists believe that the DNA of injection is integrated, but later test shows the DNA that does not detect integration, and the foreign DNA that this explanation keeps is present in plasma membrane/interior body portion (Wilson etc. (1992b); Chowdhury etc. (1993)).This surprising observations shows that partially hepatectomized is by making that with the synthetic a kind of mechanism that has nothing to do of DNA itself transgenosis DNA is kept.

Another group also uses the guiding strategy (Kaneda etc. (1989a) that directly DNA are injected to liver; Kaneda etc. (1989b)).This group is that NHC protein is packaged in the liposome with transgenosis DNA with the normal protein of finding in nuclear.They observe, and the vesicle of injection is transported in the liver cell nuclear, after injection, reach 7 or 8 days and detect transgene expression.But this DNA is not incorporated in the liver cell karyomit(e).Other people have reported after calcium phosphate-DNA precipitation direct injection is to liver, spleen or the peritonaeum, have successfully expressed foreign DNA (referring to (1989a) such as Kaneda) in vivo.

Shown that many reagent all can improve external stable conversion efficient.Research group's report, in the transfection process of calcium phosphate mediation, by the pH of control substratum, stable conversion efficient can be up to 50% (Chen and Okayama (1987)).

Another kind it is reported that the reagent that can improve the transfection DNA expression is butyric acid or its sodium salt (Gorman etc. (1983)).Because it changes the known capabilities of chromatin Structure, Gorman etc. (1983) have tested the influence of butyric acid to the expression of exogenous gene of the transfered cell by transfection.In these researchs, first transfectional cell contacts 12 hours with cell then with Sodium propanecarboxylate.At ensuing 5 days monitoring transient expressions, they observe the recipient cell per-cent of expressing rotaring redyeing gene increased 2-4 doubly.They are also noted that when the transfection construct comprises a SV40 enhancer element expression of exogenous gene level has increased 25-100 doubly.During other culture screening stable conversion body of transfection, they observe the transfectional cell per-cent that produces the stable conversion body has remarkable increase than control cells under the condition that butyrates is existed.But Palermo etc. (biotechnology magazine, 19:35-48 (1991)) find no matter whether have butyrates in the transfection step, but all stable conversion body transfer expression of gene increases of butyrates.In fact, it is synthetic or improve the ability of cytodifferentiation that many reports have all been put down in writing butyrates external evoked specified protein.(Boffa etc., journal of biological chemistry, 256:9612-9621 (1981); Kruh, molecular cell biological chemistry 42:65-82 (1982); Chabanas etc., molecular biology magazine 183:141-151 (1985); Parker, journal of biological chemistry, 261:2786-2790 (1986); Kooistra etc., Biochem.J., 247:605-612 (1987); Kaneko etc., cancer research (Canc.Res.) 50:3101-3105 (1990); Nathan etc., experimental cell research, 190:76-84 (1990); Palermo, biotechnology magazine, 19:35-48 (1991); Kosaka etc., experimental cell research, 192:46-51 (1991) and Oh etc., biotechnology biotechnology (Biotechnol.Bioeng.), 42:601-610 (1993)).The optimum concn that is used for gene induced butyrates is different with the difference of cell type, and the suitable concentration scope of cytotoxicity minimum must be determined (referring to for example Gorman (1985) according to experience according to the kind of every kind of target cell; Parker etc. (1986); Oh etc. (1993)).

The effect of butyric acid (or butyrates) in viable cell is not limited to modify chromosomal protein.A characteristic the most significant of this compound is the ability (referring to (1981) such as for example Boffa, it is reported that the most of cell that contacts with butyrates is stuck in G1/S phase intersection) that its reversibility ground suppresses the culturing cell growth.In addition, butyrates can improve the antitumor action (Kruh (1982)) of Interferon, rabbit.This anti-tumor activity is to make us interested especially, because just can produce this activity by 0.5ml 50mM butyrates solution is injected directly in the mouse alive.

For expression of exogenous gene, utilize transient expression many advantages to be arranged than stable conversion.At first, utilize transient expression, can promptly analyze a large amount of relatively constructs.In addition, it also can become transmits the proteinic selecting method of treatment, only needs to exist in vivo described protein in lysis.In addition, transient expression has been avoided inserting the mutagenesis or the necrocytosis danger that may cause in the important cells gene because of foreign DNA.In addition, can in the primary cell line of immortalization not, finish transient expression, and the stable conversion body can only be from setting up cultivating medium-term and long-term survival and splitted cell.But the hepatectomy model is an exception, and the major defect of present known transient expression method is that expression of exogenous gene is short-lived relatively always, and transfection reagent (comprising purify DNA itself) has toxicity to viable cell.For most of practical purpose, hepatectomy or other surgical excision method are very violent methods.Therefore, other method of stablizing transient expression can enlarge the potential range of application of this technology.

The present invention's summary

The invention provides can significantly improve import in the host eukaryotic cell outside the method and the reagent of expression of source DNA.Reagent described herein has increased the quantity and the time length of transient expression.The chemical substance that has confirmed to contain these reagent all is effective for the static culture of cell of growing and Unseparated Cell.This situation shows that the increase with the viewed transgene expression of these compounds does not relate in the genome that foreign DNA is integrated into the acceptor host cell.

In addition, show that also The compounds of this invention has reduced the consumption of culturing cell to glucose in the substratum, therefore, for example lipoid or protein obtain energy to make cell depend on other carbon source.The hydrazine yield of these cells increases, and therefore shows that protein is used as a kind of energy.It is plastosomes that the main action site of these compounds is pointed out in its influence to glucose consumption.This observations means that in vitro and in vivo plastosome plays an important role in the continuous expression of nonconformity foreign DNA.In addition, exist the cell of growing under the condition of these compounds by abduction delivering and the endogenic alkaline phosphatase activities of secretion.

The present invention also provides the long-term transient expression that imports the foreign gene of target cell through various transfer systems, and described transfer system includes but not limited to cation lipoid (being liposome) and various synthetic polymer such as tree-shaped polymkeric substance (dendrimer) (being also referred to as " starburst " polymkeric substance).Many compounds of the present invention all influence expression of exogenous gene after foreign DNA is imported into cell, so its effect is irrelevant with the method that imports DNA.Some of them compound preceding 4 days after foreign DNA imports are effective especially for improving the expression degree, therefore may be able to improve the initial DNA amount of taking in cell or the ratio that improves the cell of expressible dna, and perhaps both all are improved.

The compounds of this invention has hydrophobic part and acidic moiety, and the latter can be the form of salt or ester.In addition, they are biocompatibilities, and promptly when being used for cell with proper concn, the cell more than 50% still can be survived.

The inventive method comprises and compound is divided into " A type " preparation and " Type B " preparation, and the former mainly improves the transient expression degree in preceding 4 days after foreign DNA is added to cell, and the latter mainly stablizes transient expression after foreign DNA enters cell.Therefore, title " A type " and " Type B " have reflected that described compound adds to the time in the culture.By before the transfection step, in the process and/or afterwards (the transient expression first phase) with A type compound treatment cell, after importing foreign DNA, add the Type B compound again in a few hours or a couple of days (for example 12-60 hour) then, make itself and cells contacting (the transient expression second phase), can obtain optimum expression.All contain A type compound in the substratum in being preferably in during two of transient expression.The present invention also provides the detection method of the purposes effectiveness of preparation during transient expression two that is used for definite individualized compound and two or more compounds.

The compounds of this invention makes viable cell produce significant metabotic change, thereby it can be kept the transient expression of foreign DNA than a lot of time of observed length in the past.In addition, after adding these chemical substances, cultured cells has obviously reduced glucose consumption, improved simultaneously its to different energy sources such as protein, may also have the utilization of lipoid.

In other embodiments, the invention provides and do not have feeder cell and do not needing with cultivating hepatocellular method under condition protein or the pre-coated cell culture medium layer of other short adhesion molecule.

Accompanying drawing is described

After with reference to following detailed description and consideration accompanying drawing, aforementioned aspect of the present invention and many advantages of following are with easier understanding and understanding, wherein:

Fig. 1 shows the cell growth curve of the cell that contacts with several different compounds of the present invention.Fig. 1 illustrates the dull and stereotyped cell yield of describing of a part in embodiment 4 and table 7.Insert the number of frame among Fig. 1 corresponding to the listed number of plates of table 7;

Fig. 2 illustrates the cytotoxicity of some compounds, and its test-results is listed in table 7.Insert the number of frame among Fig. 2 corresponding to the listed number of plates of table 7; With

Fig. 3 illustrates the test-results of embodiment 6.These tests relate under the condition of all cpds that existence can prolong the transient expression time, the transient expression in the pig PICM-193BT of similar hepatocellular differentiation cell.

Fig. 4 illustrates the amount of the beta-galactosidase enzymes of measuring in the sample that gather in the crops every day in the process of the test described in the embodiment 8, and the permanent stability of transgene expression in the transfectional cell of cultivating (promptly 32 days) are stablized under the compound condition of transient expression in the explanation existence in bioreactor device.

Fig. 5 A-5C illustrates in embodiment 8 described processs of the test, ammonia, glucose and lactate concentration in the substratum of sampling every day.The ammonia concentration of measuring in every kind of sample of Fig. 5 A explanation; The glucose concn of measuring in every kind of sample of Fig. 5 B explanation; The lactate concentration of measuring in every kind of sample of Fig. 5 C explanation.

The detailed description definition of preferred embodiment:

Transfection: in order to reach following open purpose, " transfection " refers to foreign DNA is imported any method in the recipient cell, comprise liposome-mediated method, viral vectors, calcium phosphate-DNA co-precipitation, DEAE-glucan, naked DNA, have DNA transfection compound with protein under the starburst polymer condition, or other imports DNA the method for recipient cell.

Foreign DNA/transgenosis DNA: be the inhereditary material of suitably being modified at the acceptor eukaryotic expression, usually but and the nonessential organism that is derived from beyond the recipient cell. Transgenosis DNA contains the code area of biological activity protein or protein domain usually. " suitably modify " and refer to that transgenosis DNA effectively links to each other with any other adjusting sequence with guarantee the eukaryotic promoter that foreign gene is effectively transcribed in host cell. Described DNA is ring-type normally, and contains polypeptid coding area, and this code area effectively links to each other with the conditioning signal of transcribing and the subsequently translation of gained mRNA is required. Sort signal comprises promoter, enhancer, transcription stop signals, ribosome bind site, translation initiation and the termination signal in conjunction with RNA polymerase, and poly (A) adds signal etc. Described enhancer can be tissue-specific.

Beta galactosidase (β-gal): a kind of bacterial enzyme that colourless substrate can be transformed into coloured product of easy detection. In the following example, this gene is used as a kind of representative foreign gene so that efficient of the present invention to be described.

The invention provides for improving method and the reagent of foreign gene in the expression of eukaryotic. Shown the method at human colon cancer cell, mouse black-in tumor cell, pig primary hepatocyte and to be similar in the hepatocellular pig cell system of differentiation be effective. The method at first comprises the exogenous DNA molecule of coded protein with can be in the form transfered cell of cells.

Can be with the foreign DNA transfered cell by any suitable method, described method includes but not limited to that fat dyes, electroporation with the calcium phosphate-DNA coprecipitate incubation, is incubated with the DEAE-glucan, DNA is linked to each other with viral vectors etc. The carrier that is derived from retroviruse or adenovirus can be used for foreign DNA is imported eukaryotic host cell. If need, the plasmid or the viral nucleotide sequence that can provide between promoter and insertion site that contain foreign DNA, perhaps be positioned at the nucleotide sequence that inserts behind the site, so that the nucleotide sequence coded one or more amino acid that provided by carrier merge with protein by described foreign DNA coding. This fusion sequence can provide the peptide that instructs required posttranslational modification, for example is used for the signal peptide of secretion, perhaps is used for connecting the site of carbohydrate part.

The invention provides for improving method and the reagent of foreign gene at the cell transient expression. Before with the foreign DNA transfered cell, in the process or afterwards, cell is contacted with following one or more compounds, like this, the expression of foreign DNA cell of transfection when not having these compounds is compared suitable raising. " raising transient expression " refer in this article when using described method, after transfection a few days ago in, compared with the control, the transgene expression amount is improved, perhaps the transient expression duration prolongs compared with the control, or these two kinds of effects have both at the same time. In the methods of the invention, the cell that imports foreign DNA is contacted with the chemical reagent that can improve initial DNA absorption or expression efficiency or can prolong its effective half-life after foreign DNA enters cell. Individualized compound might improve initial expression efficiency, and also may prolong the duration of transient expression. On temporal meaning, term used herein " effective half-life of foreign DNA " refers to the time span that the protein by foreign DNA coding can detect in cell. When using conventional transfection method, namely do not use the what follows compound of open method and when carrying out transfection, transient expression is down to undetectable level in the 3-4 after foreign DNA is imported into cell days usually. But, use the inventive method, usually at after the transfection 14 days and after transfection, observed the expression of easy detection level in 32 days. In the transfectional cell of processing with the inventive method, also detected DNA and RNA with transfected foreign DNA homology after the transfection in 32 days. Use the inventive method, transient expression reached peak value in about 2-3 days usually, fell to then 1/3rd of about initial level, after this still can stablize a couple of days to a few weeks longer.

The reagent that can be used for the inventive method comprises a large amount of compounds of hereinafter comprehensively describing. " reagent " can be made up of a kind of compound, or the combination of two or more compounds. In addition, described reagent can be included in early stage one or more compounds that add of transfection process, and one or more other compounds that add after foreign DNA enters cell. These transient expression reinforcing agents can be before foreign DNA imports, adding after the process neutralization. When just reagent being added cell after importing DNA, this reagent and cell are kept and are contacted at least 24 hours or longer usually.

Usually, can be in the present invention comprise at least one hydrophobic part and at least one acid moieties as the compound of reagent.Acid moieties also can be hydrophobic and organic.For some this specific compound, salt or ester acid moieties have been modified to.In one embodiment, described compound is by general formula R ₁-C (=O)-OR ₂The carboxylic acid derivative of expression, in another embodiment, described compound is by general formula R ₇-SO ₂-OR ₈The sulfonic acid of expression.

Suitable carboxylic acid derivative (is R ₁-C (=O)-OR ₂) comprise that natural amino acid is (as glycine, L-Ala, Xie Ansuan, leucine, Isoleucine, aspartic acid, L-glutamic acid, glutamine, Serine, Threonine, methionine(Met), arginine, Methionin, Histidine, proline(Pro), tryptophane, phenylalanine, tyrosine), its non-natural optical isomer and some amino acid derivative (3-methyl-L-Histidine for example, α-Tong Wuersuan, Beta-alanine, carnosine, citrulline, creatine, folic acid, gsh, urobenzoic acid, homoserine, the N-carbanyl aspartate, N-formyl-L-methionine(Met) and ornithine).

With regard to amino acid whose general carboxylic acid derivative molecular formula R ₁-C (=O)-OR ₂, R ₁Be CHNH ₂R ₃, R wherein ₃It is the side chain of natural amino acid.Other amino acid derivative that can be used for the inventive method comprises and also contains alkyl substituent and with the amino acid of the alkyl substituent of other functional group.These amino acid are represented by above-mentioned carboxylic acid derivative molecular formula, wherein R ₁Be-CHNH ₂(CH ₂) _nR ₅, n=1-7 wherein, R ₅Be selected from CH ₃, OH, CONH ₂, C ₆H ₄OH and CONHNH ₂Perhaps R ₁Be-(CH ₂) _nCHNH ₂CO ₂H (wherein n=1-8), or-CH (CO ₂H) NHCONH ₂Or R ₁Be-C ₅H ₄N (being nicotinic acid and derivative).

Except that amino acid, the carboxylic acid derivative that can be used for the inventive method comprises the alkyl and the aromatic base carboxylic acid derivative of alkyl, aromatic base and replacement.Preferably the carboxylic acid derivative of alkyl and substituted alkyl is represented by above-mentioned general formula, wherein R ₁Be-(CH ₂) _nR ₆, n=1-9 wherein, R ₆Be selected from indyl, NCH ₃C (=NH) NH ₂, SCH ₃, NH ₂, CH ₃, CO ₂H, CONH ₂And NHC (=NH) NH ₂Preferred aromatic base carboxylic acid derivative comprises phenylformic acid and its derivative.Benzoic acid derivative represented by above-mentioned molecular formula, wherein R ₁Be-C ₆H ₄R ₄, R wherein ₄Be selected from H, CH ₃, (CH ₂) _nCH ₃, NH ₂, COCH ₃, CO (CH ₂) _nCH ₃, C (CH ₃) ₃, CH (CH ₃) ₂, (CH ₂) _nCH (CH ₃) ₂, (CH ₂) _nCOCH ₃, OCH ₃And O (CH ₂) _nCH ₃, n=1-3 wherein.Found that side chain is usually more effective than straight chain.

Useful in the present invention carboxylic acid derivative comprises that carboxylic acid (is R ₂Be H); Carboxylicesters is (as R ₂Be CH ₃(CH ₂) _nCH ₃, n=1-8 wherein), described carboxylicesters comprises the ester that has other functional group such as ether and ketone group (R for example ₂Be (CH ₂) _xO (CH ₂) _yCH ₃(CH ₂) _xCO (CH ₂) _yCH ₃, x+y=2-7 wherein); Carboxylate salt comprises metal-salt (for example lithium, sodium, potassium, calcium and magnesium) and relative low-molecular-weight positively charged ion (for example ammonium).

By general formula R ₇-SO ₂-OR ₈The suitable sulfonic acid of expression comprises alkyl, aromatic base or the alkyl or the aromatic base sulfonic acid (being that R7 is alkyl, aromatic base or substituted alkyl or aromatic base) that replace.Preferably, sulfonic acid is that low alkyl group (is straight or branched C ₁-C ₅Alkyl) sulphonate, the more preferably amino low alkyl group sulphonate that replaces, for example taurine.Preferred fragrance base sulfonic acid is a benzene sulfonic derivative, the more preferably amino Phenylsulfonic acid that replaces, for example 3-aniline sulfonic acid.Can be used for sulfonic acid of the present invention and comprise that sulfonic acid (is R ₈Be H) and sulfonate, described sulfonate comprises metal-salt (R for example ₈Be lithium, sodium, potassium, calcium or magnesium) with relative low-molecular-weight organic cation (as R ₈Be ammonium ion).

In another embodiment, the compound that can be used as reagent in the methods of the invention comprises the sulfonated glycosaminoglycan.Preferred described polysaccharide is a sulfonated N-acetylize glycosaminoglycan.Suitable polysaccharide contains 4-200 the saccharide residue of having an appointment usually.

Preferred sulfonated N-acetylize glycosaminoglycan comprises chrondroitin-6-sulfuric acid and sulfonation melon that glycan (guarans).Your glycan of melon is isolating from the endosperm of guar seed, is to contain the α-1 that links to each other with the mannosans skeleton, high molecular β-1, the 4 D-polygalactomannan (for example up to about 1,200,000 dalton) of the D-galactose residue that 6-connects.You comprise the 2-hydroxypropyl ether derivative that is commonly referred to the hydroxypropyl guar glycan by glycan suitable melon.

Other compound that can be used for the inventive method comprises suprarenin, actimide and methyl cobalamin.

Think that up to now especially effectively the example of sulfonation glycosaminoglycan is chrondroitin-6-sulfuric acid (a C type chondroitin sulfate), the polyanionic mucopolysaccharide.Chondroitin sulfate is the natural mucopolysaccharide of finding in the cartilage of whole body and soft connective tissue.C type chondroitin sulfate is a vicissitudinous polymerizable molecular aspect the relative distribution of molecular weight, the sulfonation degree of N-acetylgalactosamine residue that repeats disaccharides and sulfation and sulfation repeating unit not.Molecular weight about 4000 daltonian chrondroitin-6-sulfuric acid are effective especially.Coml C type chrondroitin-6-sulfuric acid goods contain proportional different A type chondroitin sulfate, i.e. chrondroitin-4-sulfuric acid usually.The goods that mainly contain C type chondroitin sulfate are very effective for stablizing transient expression, but the goods that mainly contain this polymer A type form are invalid.Therefore, in given polymer product, occupying the 4-sulfuric ester of N-acetylgalactosamine residue of repetition disaccharides and relative quantity that the 6-sulfuric ester replaces the site is very important for the activity of polymkeric substance in the inventive method, because have only 6-sulfuric ester form showing activity aspect the transient expression improving.

At compounds effective aspect the raising transient expression following required common trait is arranged:

1. when with when improving the effective concentration range of transient expression and add to cells in culture, almost or do not have a cytotoxicity.For the sulfonated glycosaminoglycan, this scope is about 0.01-0.5mM.For improving aspect the transient expression effectively all the other compounds, this scope is between about 1-15mM.These optimum quantities do not comprise the amount of these materials (as specific amino acids) that exist as the cell culture medium component.According to this detection, this paper will not have Cytotoxic compound to be defined as " biocompatibility ".In order to reach purpose of the present invention, cytotoxic substance can be defined as in given concentration, with described material Continuous Contact, 8 days static cultures of SW480 cell are viable count minimizing＞50% in 4 days after transfection, wherein when 8 days time finishes, there is not the net increase of cell.However, it should be understood that the susceptibility difference of dissimilar cells to different compounds.Therefore, though can be with the SW480 cell as the convenient tool of determining compound biocompatibility concentration, must adjust the concentration of determining with the SW480 cell so that make the biocompatibility with other cell type reach the best by experience.In embodiment 4, will describe in more detail and measure Cytotoxic experiment.

2. always there are (as carboxylic acid, sulfonic acid etc.) in acidic functionality and can modify to reduce cytotoxicity it.The preferred modification is to form ester and salt (comprising with the organic cation being the salt that the basis forms), because after compound enters target cell, salt and ester bond are easy to by the metabolic process cracking.In preferred embodiments, the pH of compound water solution is 4.5-9.0.

3. acid groups links to each other with relative hydrophobic organic group.For the compound beyond the sulfonation polysaccharide, this part of described molecule is preferably nonpolar and hydrophobic.Equally, the sulfonation polysaccharide makes its natural hydrophilic feature obtain modifying by there being hydrophobic relatively functional group's (for example chrondroitin on 2-the position of substitution-6-vitriolic N-ethanoyl).Confirmed the effective chemical compound lot of the present invention is all contained organic and hydrophobic acid groups.

Effective agents (for example 50/50 mixture of phenylformic acid and Sodium Benzoate (benzoate damping fluid), and chrondroitin-6-sulfuric acid) has anti-oxidant and free radical scavenging characteristic (for example referring to the Merck catalogue).

For convenience, hereinafter will be called " I class " preparation, the sulfonation glycosaminoglycan is called " II class " preparation except that the compound the sulfonation glycosaminoglycan.In a preferred embodiment of the invention, before the foreign DNA transfered cell and in the process, cell is contacted with the compound that is selected from the I class, behind the foreign DNA transfered cell, again cell is contacted with the compound that is selected from the II class then.No matter be before the transfection step, in the process or after add The compounds of this invention, they all are effective.

The invention provides the method that can be used for prolonging the transient expression in the culturing cell, described cell comprises primary culture, the clone of having set up, the stable culture of noble cells, the normal cell system that contacts with somatomedin and keep, and transformant, the culture as setting up from various tumours comprises hybridoma and SW480P3 CCL188 (ATCC#CCL228; Hereinafter referred to as " SW480 cell ").

The inventive method also can be used for foreign DNA is imported cells in vivo.Can use described compound by various methods easily, these methods comprise oral, topical application, use by perfusion or by injection.If need make host and contacting of compound be limited in desire accepts in the tissue of foreign DNA, then can perhaps import described compound by locating injection such as direct injection to solid tumor by protein being mixed in the liposome (described protein will make liposome guiding specific tissue).Then inject the carrier that is used to transmit foreign DNA when injection compound or compound make up or afterwards at same loci.Perhaps, with can be so that the carrier that slowly discharges compound at target site is used described compound, for example dissolving by inert solid carrier.

The inventive method is included under the condition that has above-claimed cpd, reclaims by the transgenosis DNA expressed protein in the transfered cell.Available any facilitated method is as extracting cells transfected or collecting protein by the substratum that extracts the cell growth.If desired, can utilize the carrier that signal peptide is provided to come express transgenic protein, described signal peptide instructs transgenic protein to secrete to substratum.Also can in the process of a couple of days, detect excretory protein to determine proteinic relative quantity or the absolute magnitude of being produced, the method for estimating the validity of each variable in the transfection method is provided thus.Can detect the granular cell extract to analyze proteinic enzymatic or other biological activity of collecting, perhaps before finishing the Function detection of protein active, be further purified described protein with standard method.If express transgenic in vivo then can be from host's body fluid as protein as described in collecting milk or other bodily tissue.The purification process that is used for specified protein depends on described proteinic physical property, as its size, shape, hydrophobicity, stability etc.In addition, also available physical method such as gel electrophoresis, isoelectrofocusing or the protein of collecting by detection such as chromatographic process such as high pressure liquid chromatography or quantitative assay.

The inventive method can be produced the milligram quantities protein of the rotaring redyeing gene of being expressed rapidly in the mammalian hosts of eukaryotic cell of cultivating or transient expression.It is more superior than bacterial expression system to produce protein in transfecting eukaryotic cells, and reason is that the expression in the eukaryotic cell can be supported for the essential posttranslational modification of the biological activity of numerous protein.In addition, replace prokaryotic host cell with eukaryotic host cell, can avoid having to removing from the end article of transgenic protein may deleterious bacterioprotein.

The inventive method provides to be utilized eukaryotic host cell to obtain commerce the method for the biological activity protein of consumption (as somatomedin, hormone, microbiotic etc.) is arranged, and not needing to set up the permanent cell line that contains source DNA outside the stable integration, available these methods obtain being used to detect the biological substance of its medicinal property rapidly.

Cell contacted with the compound that is selected from II class of the present invention can improve cell adhesion and cell-cells contacting and get in touch, therefore, these compounds the approach that improves these cell-cell interactions that provides is provided.Therefore, present invention resides in the adhesion that culturing cell improves cell and culture medium layer under the condition that existence added to the sulfonation glycosaminoglycan in the substratum, promote the method for life of cell in the culture thus.For example in the cloned culture of the feature with differentiated hepatocellular, chrondroitin-6-sulfuric acid is for promoting that its long term growth is effective.Normally say, unless provide feeder cell or at first with promoting the adherent material of liver cell to apply culture medium layer, otherwise liver cell can not survive in culture (referring to, Sidhu and Omiecinski for example, pharmacogenetics (Pharmacogenetics), 5:24-36 (1995)).

When reagent of the present invention was contacted with culturing cell, cell showed the metabolic process of change, comprise that glucose consumption and lactic acid-producing reduce, and ammonia production increased.Therefore, the present invention can be used for controlling cellular metabolism so that described cell utilizes other carbon source such as protein or lipoid.In addition, these reagent inducing cells are expressed the endogenous alkaline phosphatase activities of elevated levels.I class and II compounds all can be used for this purpose.The reagent that is specially adapted to control the energy utilization of cell is phenylformic acid, the 4-ethyl benzoate, the mixture of chrondroitin-6-sulfuric acid and benzoate damping fluid, wherein the benzoate damping fluid be phenylformic acid and Sodium Benzoate etc. molar mixture.The inventive method can be used for external or the cellular metabolism of body inner control, for example treats the Mammals obesity.

Because its hydrophobicity, the compound of described method can stride across highly hydrophobic mitochondrial outer membrane.Because these reagent can influence the metabolic process relevant with plastosome, i.e. glucose metabolism, therefore, observed expression level improves to transcribe because of Intramitochondrial foreign DNA and causes.Because foreign DNA is cyclic, therefore, it in addition can duplicate by the mechanism that is usually used in duplicating the ringed line mitochondrial DNA, improve the template amount that can be used for express transgenic thus.

The invention provides these compounds as the purposes that improves the reagent of transient expression in external and the body.When in external or body, using, before being preferably in foreign DNA and importing, use described compound after the process neutralization.Remove these compounds from cell culture medium after, they fade away to the influence of long-term expression, and recover the behavior before the cell.When using in vivo, compound can be mixed to receptor tissue or with transgenosis dna solution intravenously as initiator injection, after importing foreign gene, use then by injection, perhaps can be used as food additive and use.For example, can pass through the direct injection compound, a little injection in evening DNA causes tumour by the identical or different compound of oral supplementation again evening a bit then.

In other embodiments, the invention provides the stable method of transient expression that makes foreign gene in the cell culture system, described cell culture system keeps cell, the cell of promptly growing in bio-reactor in the semisolid matrix that stimulates solid tumor.Can use by the method for this model tumour system development and will express the gene direct transfection of antineoplastic compound (as IL-2) in solid tumor.

The mechanism of reagent raising transgene expression of the present invention is still uncertain.They may be direct stable transfection DNA or its transcript, perhaps even may be to make expressed protein stable, although a kind of possibility in back is very little.In addition, I class and II compounds seemingly work by different mechanisms and improve transient expression, because two compounds use simultaneously often than independent use more effective (referring to for example embodiment 6).In the preferred embodiment of the invention, before transfection, after the process neutralization, cell is contacted with one or more I compounds, after the transfection step, be that the sulfonation polysaccharide contacts then with a kind of II compounds.

Defined following parameters so that characterize the compound that can be used as the reagent that prolongs the transient expression time.These parameters are called as " X " factor, " G " factor and " K " factor.

1.X the factor: $X=100-\frac{(A\×100)}{C},$ Wherein " A " be in the selected time in the contrast transfectional cell expressed proteins quality, " C " adds the protein mass of producing in the cell of compound.

This factor has reflected that the compound that adds in the transfectional cell improved the degree of stabilization transient expression in preceding 4 days after transfection.For activated compound in stablizing transient expression, the X value is with＞1.For example, if having double expression, then X=50 under the condition of compound.Preferred compound X＞10, the X of optimizing compound＞25.This factor is for existing observed exogenous gene expression amount in the The compounds of this invention and not having that observed expression amount provides an approach in the control cultures of this compound in the substratum in after the transfection relatively preceding 4 days.Therefore, the X factor is with existence with do not exist under the described compound condition ratio between the observed expression amount relevant.When agents useful for same is the mixture of more than one compounds, calculate X by similar approach.

By the observed value with every day in the separatory such as culturing cell add and, can measure cumulative protein and express, be i.e. the value of " A " and " C ".

2.G the factor.G-factor only is different from the X factor on computing time.In order to calculate G-factor, measured the protein mass of expressing from 4-7 days or 4-17 days, wherein the 0th day be that foreign DNA is added to that day in the cell.Subscript represents which section period is Fundamentals of Measurement.Therefore, " G ₇" show at 4-7 days and measure " G ₁₄" be illustrated in 4-14 days and measure.As the X factor, Wherein " A " is identical with the definition of carrying out with regard to the X factor with " C ".

With X and the two characterizing compounds of G-factor is very useful, because some has the compound of low or negative X value to have height or positive G-factor value.G ₇Or G ₁₄The high compound of value is for after entering cell at DNA, and is promptly particularly useful to the transient expression that substratum adds one or more compounds in the transient expression second phase.The G of compound＞0 preferably.More preferably, G＞10, best G＞25.

3.K the factor.The K factor be the contrast transfectional cell with cell that The compounds of this invention contact in foreign DNA express the rate constant ratio of decline.Determine K according to following equation:

" k wherein _(DNA)" be as the function of time and the first order rate constant of the transgenosis DNA of marking protein expression decline, that is: $\frac{-d_{\left(\mathrm{DNA}\right)}}{\mathrm{dt}}=k_{\left(\mathrm{DNA}\right)}$ 。It is equivalent to ${\log }_{\left(\mathrm{DNA}\right)}=\frac{\mathrm{kt}}{2.303}+{\log }_{\left(\mathrm{DNA}\right)}$ 。For convenience, use term " d _(DNA)", it has reflected the variation of transfection DNA effective concentration, although viewed expression variation also may be other parameter but not only be the function of foreign DNA concentration in the cell.Therefore, can be k with the first order reaction rate representation of contrast transfection culture _(DNA)=d _(DNA)/ dt=or log _(DNA)=kt/2.303+log _{(DNA) 0}Therefore, work as log _(DNA)When the time is mapped, intercept on the Y-axis or log _{(DNA) 0}The starting point concentration that has reflected the transfection DNA of being expressed.In addition, this line institute slope equals-k _(DNA)/ 2.303.

k _(DNA)Value can obtain by computer program, and this program is mapped the log value of exogenous protein concentration to the time.This program has been determined that part of slope during the gained curve reduces corresponding to protein production.Usually, in the optimum quantity of protein synthesis occurs in after the transfection during 48 hours.After this, express speed and descend, by before transfection, in the process and/or afterwards cell is contacted this speed of controlling with all cpds of the present invention with certain speed.Therefore, calculate described slope at this decrement phase and obtain k _(DNA)With the K value, can reach the purpose that the different compounds of comparison are renderd a service.Especially effectively the The compounds of this invention preparation has a speed to raise after expression speed begins to descend.

Therefore, the K factor has reflected that foreign gene enters the influence of the interior back of cell compound to the stability of this exogenous gene expression, rather than reflects the influence that these compounds are taken in initial DNA.The K factor is extremely important, because compare with other currently known methods that improves transient expression, advantage of the present invention mainly comes from provides the method that is used for stablizing transient expression after the transfection step, and traditional method is to make great efforts to improve DNA to take in efficient.Yet compounds more of the present invention have maximum efficiency in initial 4 days after transfection, therefore show that they may be to absorb more substantial transfection DNA by inducing cell to play a role.After in foreign DNA carries out cell, this compound may can also prolong the effective half-life of genetic expression well.Positive K value show a kind of compound or compound composition effectively the foreign DNA behind the stable transfection express, therefore, K value＞0 of preferred compound of the present invention and preparation.

Under the condition that does not have The compounds of this invention, the decline that transgenosis DNA expresses is k _(DNA)It is first order reaction.After being added to The compounds of this invention in the culture, compare with control cultures, foreign DNA is expressed kinetics and is significantly changed.Exist under the situation of these compounds, with exogenous protein production continue for a long time carry out k _(DNA)Become bigger.For some preparations (be the K value greater than 40 those preparations) most preferably, this change highly significant, so that conventional first order kinetics ecbatic suitably.Therefore, as if preferred compound/preparation becomes kinetics into pseudo-first-order reaction or second order reaction.This result is unpredictable with conventional theory.

The chemical compound lot and the preparation that can be used for the inventive method have been discussed in an embodiment, and they have been listed in the table 1,8,9 and 10, wherein listed X, G and K value.

It is that the basis is used to screen chemical reagent to determine whether they can stablize the method for transient expression that the present invention also provides with the SW480 cell.For this method, the candidate compound that is used to screen is biocompatible, and contains at least one hydrophobic part and at least one acid moieties.Before the 0th day imports foreign DNA, in the process and/or afterwards, test compound or compound group are added in the SW480 cell culture, if described foreign DNA is expressed a kind of protein that can be detected of then encoding in cell.Following period of time after the transfection step is collected culture samples and is determined the wherein amount of exogenous protein.Accumulation expressed proteins quality is by measuring adding of quantity every day and determining in the culture in the sample, these summations are compared between test culture (those cultures that promptly contact with test compound, and the parallel control culture that does not contact with test compound).Between 0-4 days or 4-7 days or 4-14 days, collect the sample that is used for the protein measurement every day, utilize the protein mass that records to determine X, G by above-mentioned formula respectively ₇Or G ₁₄Value.If the X of Que Dinging, G thus ₇Or G ₁₄Value＞0, can reach a conclusion: described reagent can improve transient expression.Preferred X, G ₇Or G ₁₄Value＞10, the best is＞25.Such compounds identified can be used for aforesaid method to improve the transient expression of foreign gene.In this shaker test, available other clone replaces the SW480 cell.

Preferred product preparation is selected from those compounds and the compound combination of the highest (or positive peak) X, G and K factor values.In addition, all cpds of the present invention can use together so that the raising that render transgenic is expressed reaches at utmost.For example, in this procedure, available different compound is handled same culture at different time.Different preparations need different property combination.Two kinds of complete dissimilar preferred formulations are:

A type preparation: these are compounds that high X value is arranged.These compounds have greater activity immediately after the transfection step is, therefore may be by increasing DNA absorption efficient and playing a role in the first phase of transient expression.Therefore, the log (DNA) 0 of the above-mentioned half log figure of A type compound or preparation or Y intercept are greater than the value of the control cultures that does not contain these compounds.Infer that this compound can influence DNA and take in efficient, because the Y intercept is roughly measuring of intracellular reactive foreign DNA concentration at once behind the foreign DNA transfered cell.The X factor of the chemical compound lot of test all has on the occasion of (referring to table 1).As if therefore, the present invention not only provides the compound that is used for stable transfection DNA, also provide to improve the compound that the initial DNA of cell takes in.The compound of many processing has high G ₇Or G ₁₄Or K value and high X value, therefore, all effectively (for example referring to table 1,3,8 and 9) in during two of transient expression.

The Type B preparation: useful compound need possess high G and K factor values in this class.High X value is an ideal, but optional.The K value is the feature of compound that can stable transfection DNA greater than zero.The K of highly preferred Type B stablizer＞1, more preferably K＞10, and G ₇Or G ₁₄＞25.In addition, before confirming that particular agent is height preferred compound in A type or the Type B preparation, need carry out X and/or G-factor＞25 in revision test and the revision test.

Use for external and body planted agent, the utilization by A type and Type B preparation can make transient expression reach best.For example, preferable methods at first relates to before transfection, by cell is contacted and trigger cell with one or more A type compounds of X＞25.During the transfection, and preferably during whole transient expression, A type compound still exists.After the transfection step, in the remaining period of transient expression, with cell and G ₇Or G ₁₄One or more Type B compound contacts of＞25.In preferred embodiments, A type compound is the benzoate damping fluid, and the Type B compound is chrondroitin-6-sulfuric acid.In another embodiment preferred, A type compound is phenylformic acid and 4-ethyl benzoate, and the Type B compound is benzoate damping fluid and chrondroitin-6-sulfuric acid.In another embodiment preferred, A type compound is benzoate damping fluid and L-glutamic acid, and the Type B compound is chrondroitin-6-sulfuric acid.

For external application, before the transfection step, cell is cultivated a few hours and can be reached optimum in 20-24 hour according to appointment existing under the A type preparation condition.It should be noted that causing with A type preparation with food (or oral application) form is a kind of interior scheme of body of reality.The known chemical compound lot that can effectively improve instantaneous infection all is nontoxic (table 1 sees below).After the transfection, preferably culturing cell was kept 48 hours in the presence of A type preparation at least.If desired, can be after approximately＞90% cell be taken in foreign DNA, be about to DNA and add in the culture after a couple of days, remove A type preparation, perhaps in the second phase of transient expression, described preparation still with cells contacting.The Type B preparation preferably when the transgene expression peak (this normally after transfection 24-48 hour take place) add in cell.Be preferably in the process of the test, regularly repeat feeder cell with the substratum that contains the Type B preparation.

Obviously, the inventive method can be used (being in zooscopy and the clinical manipulation) in vivo.Specifically, in the gene therapy relevant, A type preparation and DNA transmission carrier can be used simultaneously, wherein before using this DNA, be come " sensitization " receptor tissue by injection A type preparation with solid tumor.And then use the Type B preparation.

The useful concentration range of each compound may be different, and the upper limit of useful concentration range may be subjected to the restriction of cytotoxic effect.DNA/A type preparation direct injection can only be related to ordinary method to tumour, because various pharmaceutical carrier is well known in the art.Direct injection can avoid making non-target tissue to contact with transfection reagent.Can be with choline, Liposomal formulation or controlled release preparation and the coupling of Type B preparation to prolong positioning action to the tumour cell of transfection.In addition, the Type B preparation can be offered the patient for a long time as dietary supplement ingredient (or additive) takes.Can use injection and food supply method to render a service simultaneously according to the factor such as toxicity etc. to reach best.The advantage of this method is high dosage cytotoxic protein matter can be passed to tumour and can not damage other bodily tissue.Use this strategy, but this this cytotoxic protein of continuous production in a couple of days of inducing tumor cell, and providing than simply doses protein itself being injected to far away in the tumour thus is effective transmission method.If be difficult for striding across plasma membrane during target protein matter external application, perhaps treat albumen back transformation period weak point in entering target cell, then this method may be particularly useful.

In other explanation of the present invention, the compound that is selected from the I class covalently or non-covalently can be linked to each other with the compound that is selected from the II class such as chrondroitin-6-sulfuric acid.

The method of the screening method contrast transfection that embodiment 1 transient expression improves

Provide transient expression with following method:

With SW480P3 (ATCC#CCL228) human colon cancer cell (common 1 * 10 ⁶Individual cell) is layered in the hole of 6 hole tissue culture plate.Number number in the hole of spreading has reflected the fate that test will be carried out after the transfection.Every hole contains the perfect medium of 1ml from the 30ml storing solution, and described storing solution contains: 26.4ml RPMI tissue culture medium (TCM), 4mM L-glutaminate, 3.0ml foetal calf serum and 10 μ g/ml gentamicins.Behind the bed board, in the CO2gas incubator that contains 10% carbonic acid gas, in 37 ℃ with cell cultures 24 hours, cell attachment is on flat board in this process.

The pre-cultivation after 24 hours removed RPMI, adds 900 μ L OPTI-MEM then ^(Gibco) substratum is finished the transfection step; contain 2 μ g express beta-galactosidase gene under cytomegalovirus promoter control VR1412 DNA (Vical in the described substratum; Inc.; SanDiego; CA) and 8 μ g cation lipoids (1; 2-myristyl oxygen propyl group-3-dimethyl-hydroxyethyl ammonium bromide (for example " DMRIE/DOPE ") mixes with molar ratios such as two oil base phosphatidyl thanomins) mixture, lipoid: the DNA mol ratio is 0.99: 1.Should notice that conventional transient transfection method uses 10 micrograms of DNA/10 ⁶Cell reduces the toxicity of pair cell but methods described herein are used less DNA.Then flat board is incubated 4 hours at 37 ℃.

Be incubated after 4 hours, the foetal calf serum (to stop transfection) and the 12.0 microlitre 50mg/ml gentamicins of 100 microlitre inactivations are added in each hole.Foreign DNA was added to Kong Zhonghou 24 hours, all cells in each hole is carried out tryptic digestion and counting, then with 2 * 10 in every hole ⁴Individual lysis is also stored in liquid nitrogen and is used for determining beta-galactosidase enzymes concentration until later on.At this moment, in each uncollected hole, add the aforementioned OPTI-MEM substratum of 1ml (not adding L-glutaminate).In order to carry out remaining test, collect a hole with 24 hours intervals, and added 1ml OPTI-MEM (do not contain L-glutaminate, but contain test compound) to uncollected hole every 48 hours.The method of detection compound:

In order to detect all cpds, the above-mentioned method that is used for control cultures is improved by candidate compound is added in the effectiveness aspect the raising transient expression.Remaining operation is still identical with the method that is used for control cultures.

Reservation is from 2 * 10 ⁴The lysate sample of individual cell detects to carry out beta-galactosidase enzymes, all kills the remaining cell in every hole every day.Lysate is freezing and remain in the liquid nitrogen up to carrying out beta-galactosidase enzymes and detect.With dichlorophenol sulfonphthalein is that basic dichlorophenol sulfonphthalein method detects the beta-galactosidase enzymes that melts sample, wherein uses the ultraviolet spectrophotometer at the coloured product of 580nm quantitative analysis.

This detected result of chemical compound lot is listed in hereinafter table 1.Provided the X value of determining in test in the table 1, wherein used the SW480 human colon cancer cell of the cultivation of the method described in the embodiment, and carried out transfection with bacteria beta-galactosidase gene.

In order to compare, table 1 be included in the compound that is measured as negative value in the mensuration and be measured as on the occasion of a large amount of compounds.PH value in the table 1 determines that in the aqueous solution the described aqueous solution is by preparing with the storing solution of deionized water dilution with medium preparation.The compound of observing pH and be about 3 (melanochrome)-10 (suprarenin) is effective for prolonging the transient expression time length.Preferred pH scope is about pH4.5-9.0.

If the calculated value of X, G or K, thinks then that test-results is for just greater than 0.

Table 1

The I class
						Compound	mM	pH(H 2O)	The X factor	G 14The factor	The K factor
3-[two (2-hydroxyethylamino)]-2-hydroxyl-1-propane sulfonic acid	1	6.81	-55	-10
						The 3-aniline sulfonic acid	1	3.8	-19	32
3-methyl-L-Histidine	4	7.39	-15	55
						The 4-benzaminic acid	1	7.67	52,52	96 *,-12	1,1
The 4-butylbenzoic acid	1	5.94	-26	65	9
						The 4-ethyl benzoate	1	6	42,46	43,63	1,2
4-hexyl benzene formic acid	1	6.13	-68	-26
						4-octyl group phenylformic acid	1	7.45	-2314	-665
4-amylbenzene formic acid	1	1	-96	-88
						The alpha-amino group butanic acid	4	7.58	-.19	35	1
Alpha Ketoglutarate	1	3.75	7.28	53
						Suprarenin	1	10.29	49	68
Aspartic acid	4	5.75	40,-13	-45,-17*
						Beta-alanine	4	8.38	.2	33	1
α-Bing Ansuan	4	7.27	31	35
						Benzoate/heparin	2.5,0.1	5.51	-3	22
Benzoate damping fluid (waiting a mole phenylformic acid/Sodium Benzoate)	4	4.74	29,17,3, 2,-16,30	41 *,58,27, 38,44,41 *	2,2,1,1, 1,3 *
						Phenylformic acid	1	4.21	-3.1	28	1

The I class
						Compound	mM	pH(H 2O)	The X factor	G 14The factor	The K factor
Phenylformic acid and 4-ethyl benzoate	1,1	5.82	41	80	2
						BES	1	6.64	77,57	32,-24	1,1
The butyric acid damping fluid	2.5	6.12	-169,-275	81 *,69 *	-9,8
						Carnosine	4	8.32	-8	35
Citrulline	1	7.71	39	46	1
						Actimide	N/A	N/A	-17	51
Creatine	4	7.54	.34	28
						Halfcystine	4	7.24	-35	-50
Diiodotyrosine	4	7.23	-48	-8 *
						4-acetylbenzoic acid ethyl ester	1	7.59	49	42	1
4-ethanoyl ethyl butyrate	1	5.98	51	58	1
						Folic acid	1	6	-1.4	24
L-glutamic acid	1	4.2	-17,8	-14 *,31 *	2
						L-glutamic acid and benzoate damping fluid	1	4.91	44,45,3, 44,42,53, 44	69,65,27, 69,76,10, 69 *	1,1,1,2, 6 *
Pentanedioic acid	1	3.85	22	-77
						Gsh	2	3.58	2	34	1
Glycine	4	7.27	-.34	40	2
						Urobenzoic acid	2	6.46	2	33	1
Histidine	4	6.75	26,-30	54 *,6	1,1
						Homoserine	1	7.4	77	39
Isoleucine	4	6.99	-119	30

The I class
						Compound	mM	pH(H 2O)	The X factor	G 14The factor	The K factor
The L-arginine	4	8.66	15,54	11 *,57
						L-glutaminate	4	7.14	-13	23
The L-Threonine	4	8.14	28	40	1
						Leucine	4	7.88	-13	32
L-Methionin	4	8.34	-39,18	-10,9 *
						Melanochrome	0.1	3.45	-155,0	-453,-173
Methyl cobalamin	N/A	N/A	1	25
						Methionine(Met)	1	7.41	2	36	0
N-(4-aminobenzyl)-L-glutamate diethyl ester	1	6.44	-35	8
						N-carbamyl-DI-aspartic acid	4	4.19	26	115
N-formyl radical-L-methionine(Met)	1	4.34	26	63
						Nicotinic acid	1	6.91	12	87	1
Ornithine	1	7.37	16	28
						Phenylalanine	4	6.97	-12	53	3
Proline(Pro)	4	7.71	-22	21
						S-carbamyl-L-halfcystine	1	6.52	-76	-74
Serine	1	7.4	43	104	1
						Sodium Benzoate	1	8.14	-15	-6	1
Taurine	4	7.88	-20	34	2
						Tryptophane	4	6.25	55	67	2
Tyrosine	4	7.88	36	52	2

The I class
						Compound	mM	pH(H 2O)	The X factor	G 14The factor	The K factor, r
Xie Ansuan	4	8.12	-18	40	2

* the G value representation of representing with asterisk is G ₇Value, and be not G with the G value of asterisk ₁₄Value.

Those that it should be noted that X in table 1 compound＞1 be after transfection before a couple of days can increase the compound of transient expression degree.This compound is compared with other compound, can make every cell take in the DNA of bigger quantity, perhaps has more a high proportion of transfectional cell to express foreign DNA.These compounds also may improve early transcription or expression.Do not report in the past that these compounds had this effect to transfection.Surprisingly, melanochrome significantly suppresses transient expression.

Except that compound listed in the table 1, also detected some other compound, the compound that discovery can prolong transient expression comprises p t butylbenzoic acid, ethoxybenzoic acid, isopropyl acid, methoxybenzoic acid, isobutyl-benzene formic acid, chrondroitin-6-sulfuric acid (C type) and melon that glycan, particularly hydroxypropyl guar glycan.Embodiment 2 some compounds can improve transient expression and reduce sugar consumption

Finish other test so that further characterize the instant expression method that improves to some extent.In order to carry out these tests, detect 5 kinds of culture condition described in the table 2 with the instant expression method described in the embodiment 1.Use 6-hole flat board, with the hole of SW480 cell inoculation q.s so that can collect as described below from the cell in each hole.Table 2

Dull and stereotyped number	Compound	Concentration	Type of culture medium
				1A	Contain the contrast of gentamicin	--	See above
1B	Do not contain the contrast of gentamicin	See above	See above
				2	Benzoate damping fluid L-glutaminate	2.5mM 4mM	Add after the pre-transfection transfection transfection

3	Chondroitin sulfate (C type) benzoate damping fluid L-glutaminate	0.1mM 2.5mM 4?mM	Add after the pre-transfection transfection transfection
				4	L-glutamic acid benzoate damping fluid L-glutaminate	4?mM 2.5mM 4mM	Add after the pre-transfection transfection transfection

Collect a porocyte every day so that count, will be from 2 * 10 of every hole collection ⁴Individual lysis keeps split product to carry out the beta-galactosidase enzymes test.Will be from the supernatant liquor in these holes freezing and be used to assess pH, glucose consumption, lactic acid and hydrazine yield later on.Shown in hereinafter table 3, the various of compound used therefor are combined in increase and keep the genetic expression aspect variant in the flat board 2,3 and 4.In this test, dull and stereotyped 4 total behaving oneself best, its X and G-factor value height.Have only dull and stereotyped 3 to contain the II compounds in this test, clearly illustrate that transfection effectiveness reduces (being that the X factor is little), but for keeping expression very promising (being that G-factor is higher relatively).

Table 3

	Dull and stereotyped number
						????1A	????1B	???2	????3	????4
	Parameter	Gentamicin	No gentamicin
The factor						Do not survey	????9	???30	????-26	????44
	The factor	Do not survey	????32	???41	????51						????69
Institute's time-consuming						%X-gal (blueness)
	24 hours	60-70	??85-90	?80-90	??85-95						??95-100
48 hours						40-50	????60	?50-60	????70	????80
	72 hours	40-50	????60	?60-70	????60						??70-75
96 hours						10-20	????30	?50-60	??55-60	????30
	120 hours	10-20	??20-30	?30-40	??20-30						????30
144 hours						10-15	??10-20	???20	????25	??20-30
	168 hours	10-15	???2-5	???10	????10						????2-5

Cell culture test has 20% standard deviation usually.Owing to this reason, if X and G-factor, just do not think that comparison is according to increasing significantly less than 25.

Comprised in above-mentioned testing program controlled trial (dull and stereotyped 1A and 1B, table 3) is to determine existing gentamicin (a kind of microbiotic) whether to influence the result of above-mentioned test in substratum.From the result that contrasts dull and stereotyped 1A and 1B relatively as can be seen, gentamicin is to obvious some restraining effect of proteinic production.In the contrast that contains gentamicin is among the dull and stereotyped 1A, and X and G-factor value are lower slightly than the value of the dull and stereotyped 1B of the contrast that does not contain gentamicin, and this point just has been described.In addition, the result from the beta-galactosidase enzymes test also supports this conclusion.

Glucose consumption and lactic acid production and hydrazine yield in these cell samples have been analyzed.Standard method that provide according to Kodak and that routine is used to measure serum glucose and lactate level in clinical labororatory is measured glucose and lactic acid with Kodak Ektachem DT60 II analyser.Finish analysis (Ektachem DT slide glass (GLU) or Ektachem DT slide glass) by every kind of test sample of 10 microlitres being added in the hole that covers with film on the plastic slide, contain in the described hole and measure glucose or all required reagent of lactic acid.In order to measure glucose, this analysis is based on enzymatic glucose of glucose oxidase and molecular oxygen reaction, and produces second of red that intensity is directly proportional with glucose amount in this sample and react.The slide glass that is used to measure lactic acid provides the enzyme and the substrate that can produce red equally, and the amount of lactic acid is directly proportional on the red amount that is produced and the slide glass.Slide glass is placed in the Ektachem DT60 II analyser, in this analyser, reads red value by the reflected light spectrophotometer.By similar method, with Ektachem DT slide glass (NH ₃), according to NH ₃The ammonia analysis is finished in the reaction that produces the blue dyes of available same instruments detection with the tetrabromophenol sulfonphthalein reaction.

In table 4, listed measuring result as the glucose and the lactic acid concn of the function of time.Table 4 shows that astoundingly the contrast (dull and stereotyped 1A) that contains gentamicin has consumed more glucose and produced more lactic acid (not comprising the contrast that does not contain gentamicin in the attention table 4, promptly dull and stereotyped 1B) than the arbitrary test sample that contains gentamicin equally.The data of table 4 clearly illustrate that for contrast, the cell of having accepted the described compound of table 2 has complicated variation aspect metabolism, show that the expression of exogenous gene level significantly improves.

Except that the data in the table 4, the combination of also observing phenylformic acid and 4-ethyl benzoate also can reduce glucose consumption.Finish a test at this, wherein before the transfection step and in the process, A type preparation at first is applied to the SW480 cell, one day after, add the Type B preparation then the DNA transfered cell.A type preparation is by containing the 1mM phenylformic acid, and the OPTI-MEM of 1mM4-ethylamino benzonitrile hydrochlorate and 4mM L-glutaminate forms, and the Type B preparation also contains 0.1mM C type chrondroitin-6-sulfuric acid except that containing these components.Gentamicin is present in the entire test.In this test, in 14 days, perhaps cultured cells in 32 days, is not observed glucose consumption to cultured cells basically in the reactor after transfection after transfection in the flat board of 6-hole, and during this, cell continues the DNA marking protein from transfection.

Table 4

Dull and stereotyped number	Fate	Glucose concn (mg/dL)	Lactate concentration (mmo/L)
				1A．	??0	????218	????1.5
	??2	????180	????6.0
					??4	????141	????9.6
	??6	????38	????＞12.0
				?2．	??0	????209	????1.8
	??2	????188	????5.0
					??4	????175	????6.5
	??6	????---	????---
				?3．	??0	????213	????1.6
	??2	????195	????4.3
					??4	????185	????6.1
	??6	????---	????---
				?4．	??0	????209	????1.6
	??2	????199	????3.8
					??4	????181	????5.7
	??6	????140	????9.5

Reported in the past that butyric acid in the I compounds can compensate the influence of glucose hunger to post-translational glycosylation when adding in the liver cell of cultivation, probably the glucose pond reaches (Morrow etc., biological chemistry and biophysical studies communication (Biochem.Biophys.Res.Comm.) 112:115-125 (1983)) in the cell by increasing for this.But people such as Morrow do not detect the glucose consumption in its culture, and therefore, that does not observe that the present invention notices exists the metabotic change that takes place under the I compounds condition.It is a notable attribute very of the present invention that viewed glucose metabolism changes.Not only relevant with gene therapy method with the raising compound of this feature is renderd a service relevant (can obviously be found out by present embodiment), and show, these compound selectives and heavily instruct the ability of cellular process to have wide range of therapeutic applications innocuously for example comprise and regulate fat/lipid metabolism in the treatments of obesity.Transient expression in embodiment 3 reactors improves

Finish 4 gene transfection tests of dying in the efficient tubular fibre perfusion prototype bio-reactor (" HPBr " device hereinafter referred to as) in Genespan prototype insulation can based on fat.This device mainly comprises sterilisable chamber, has two groups of tubular fibres to pass through in this chamber.Substratum is circulation continuously in one group of fiber, and the required gas (as oxygen and carbonic acid gas) of cell growth passes through second group of fiber.Described fiber is made up of porous material, and gas and nutritive substance can a direction pass through this fiber, and are passed through with other direction by the refuse molecule that indoor grown cell produced.The cell of growth can be a suspended state in this device, perhaps can be attached to the outside surface of these two groups of mesopore fibers.

A useful feature of HPBr device is to stir cell by the chamber that swivel pipe passes therein.When described chamber rotates 120 degree with a direction around the longitudinal axis, when spending with other direction rotation 120 then, promptly constitute a rotation " circulation ".Perhaps, can rotate and under " static " condition, cultivate culture.

Adopt the HPBr device, use the SW480 cell to finish a series of tests.Each test all contains a parallel control, and wherein cell is layered on the flat board of conventional 6-hole, and is placed in conventional 10% CO2gas incubator.Be used to contrast dull and stereotyped method with the foregoing description 1 and cultivate and the described contrast of transfection 6-hole flat board, and following test method is used for reactor assembly.The HPBr device experiment

In the HPBr device, with being similar to the method that is used for 6-hole flat board among the embodiment 1, finish 4 beta-galactosidase enzymes reporter gene transfection tests, but will adjust large volume and the big quantity of the volume of all ingredients pro rata with cell in the adaptive response device.Because therefore the fill-up mode (be continuous-feeding, this is the feature of HPBr) of cell cultures does not need manual feed supplement regularly.

The process of bio-reactor experiment is different with embodiment 1 described process aspect following.With the enough Cytodex of the pre-swelling of phosphate buffered saline(PBS) ^1 microcarrier (i.e. the microballoon of forming by crosslinked dextran, described dextran has positively charged quaternary ammonium functional group so that cell adhesion on the surface; Sigma, St.Louis MO), imports the lateral areas of HPBr then.Per 10 cells use 1 microcarrier bead approximately.When on-test, with 1 * 10 ⁷Individual SW480 cell alive and 1 * 10 ⁶Individual pearl is expelled in the device together.When cell inoculation to the device in the time, use be the substratum described in the table 5.Table 5 has indicated rotation parameter used in this research (" cpm " refers to the revolution of per minute).The 839ml substratum is added in each bio-reactor.2,3 with the OPTI-MEM transfection media of No. 4 (" number " refer to different tests) in contain the C type chondroitin sulfate of 0.1mM.After the transfection step, change the OPTI-MEM substratum (i.e. substratum in the pipe) of recirculation, but the substratum in celliferous chamber (being the extracapillary space) need not be replaced.Replace in the substratum and comprised the listed compound of table 5.With cell inoculation to the bio-reactor back 24 hours, the liposome that will contain foreign DNA adds to the extracapillary space.This space and volume (839ml) in vitro be specific volume less (17ml) mutually.

Table 5

Number	Type	Condition	Substratum is formed
				1	Dull and stereotyped	Carbonic acid gas insulation can (contrast)	OPTI-MEM (seeing embodiment 1)
2	HPBr	30?cpm	OPTI-MEM; 10% foetal calf serum; 4mM L-glutamine; The 10g/ml gentamicin; 2.5mM benzoate damping fluid; 0.1mM chondroitin sulfate (C type) (also being present in the OPTI-MEM transfection media)
				3	HPBr	Static	Identical with No. 2
4	HPBr	Preceding 48 hours is 30cpm; Static then	Identical with No. 2
				5	HPBr	Static (contrast)	OPTI-MEM

From the Cytology Lab of each bio-reactor, get cell and supernatant samples (about 1.5ml) every day, replenish the fresh culture of equal volume then.Determine cell counting and viability, with 2 * 10 ⁴Individual viable cell cracking preserves to be used for determining beta-galactosidase enzymes with embodiment 1 described spectrophotometry then.

Table 6 contains the data that 4 device for casting tests (2-5 number) and dull and stereotyped contrast (No. 1) compared gained.In table 6, the area under a curve that the amount of the beta-galactosidase enzymes that produces in the cell equal portions that the hurdle that indicates " area under curve " refers to collect every day is drawn at the duration of test in 2 weeks as the function of time.Therefore, the value in " area under curve " hurdle is cm with absolute units ²Expression has reflected in process of the test, the total amount of the beta-galactosidase enzymes that produces based on each cell.Last hurdle in the table 6 represents that each number is each flat board or bio-reactor, the total amount of beta-galactosidase enzymes in the 13rd day remaining all viable cell.

Obviously; can carry out extensive gene transfection and collect cells transfected with the perfusion bio-reactor, this uses (for example producing a large amount of T lymphocytes of stable or instant expression of exogenous gene and hemopoietic stem cell to be used for such as treated autologous cell) for treatment be useful.This system also can be used as artificial organs so that the simple long-term expression of also studying foreign gene truly; In this way, equal in complete intracorporeal organ, to carry out biopsy.

Table 6

The beta-galactosidase enzymes production in 2 weeks number tests below total cell count survival rate curve per 2 * 10 in dull and stereotyped and HPBr device ⁴Carefully at 13 days, at 13 days,

Condition (13 days) % amasss (cm ²) β-ng/ml of cellular expression is with viable cell

Tilactase β-Gal/2 * be basic

Account for the % 10 of contrast ⁴Total 1 flat board of expressing of cell contrasts 6.5 * 10 ⁶97% 70 0.084 33 2 30cpm 1 * 10 ⁷86% 84 20% 0.120 65 3 static 2.3 * 10 ⁷42% 105 50% 0.602 364 4 30cpm/48hr 7.3 * 10 ⁷77% 180 157% 0.357 1254

Static then 5 bio-reactors are to 29.3 * 10 ⁷34% 76 9% 0.040 249

According to (static)

Data in the table 6 show in the use of this device, and the rotation parameter of control bio-reactor is for improving transfection efficiency and keeping transient expression that a kind of uniqueness and method easily are provided.

It should be noted that the existence of C type chondroitin sulfate (a kind of polyanionic carbohydrate) can make transfection carry out in the clear, but also makes genetic expression that substantial raising be arranged.Some other polyanionic carbohydrate that detects can be blocked transfection process effectively.These carbohydrate comprise A type chondroitin sulfate, dermatan sulfate, heparin sulfate, heparin, carboxymethyl cellulose and N-carboxymethyl chitosan N, S-sulfuric acid (table 1).Therefore, cell to the tolerance of C type chondroitin sulfate be not generally cell to the feature of polysaccharide tolerance in the substratum.

As discussed above, microballoon can be added in the described chamber so that provide attachment site to cell.Observe, for example, when the mouse black-in tumor cell (being ATCC#B16-F0) with infinite multiplication imported in the chamber that contains microballoon, these microballoons were as " seed " of cell accumulation jumpbogroup.Also observe, but these cell masses of transfection, the DNA of these cell mass transient expression transfections then.By from described indoor substratum, taking a sample, can be easy to from this culture, obtain sample.Sampling is finished by the fresh medium in the syringe is expelled on the cell mass, thereby makes a certain amount of cell suspension that enough is used for taking a sample at substratum.Cell mass similar solid knurl, they provide model system for the methods of treatment that research can be passed to treatment protein in-vivo tumour effectively.

With the same procedure that makes cell mass mass efficient growth in bio-reactor, melanoma cells is subcutaneously injected in the mouse body, make it develop into tumour in injection site, the liposome that will contain the beta-galactosidase enzymes carrier DNA then directly imports tumour so that the transient expression beta-galactosidase enzymes.Estimate that for expressing the beta-galactosidase enzymes effective means for other protein also is effectively, similarly test with assessment the range protein treatment protein DNA of for example encoding directly is passed to the effect in the entity cell mass in the body.

The used bioreactor system of the inventive method carries out genetic modification for being produced as the expression exogenous protein a large amount of cells also are useful.In order to reach therapeutic purpose, this cell can be administered to the patient, after this they can only carry out keeping active condition in the process at treatment plan.Therefore, the invention provides a kind of gene therapy form of uniqueness, contacting wherein by restriction quiding gene and stabilization material, promptly treat proteinic cell by using transient expression, only during desired transgenosis continuous expression, use the enhancing compound then, can be easy to close quiding gene.

At last, it should be noted that the use of chondroitin sulfate (C type) is very important, although because high relatively speed of rotation is arranged, it can make the grappling dependent cell be attached on the microcarrier well.This result shows that the II compounds can be used for making culturing cell to be fixed in solid basic unit.Propose, chondroitin sulfate can be used as a kind of compound the cell attachment surface is provided in device, with control cell growth pattern (US5593814) from the teeth outwards.But the method for US5593814 is compared with the inventive method, needs chondroitin sulfate to combine with solid basic unit, rather than adds in the substratum.Other people have also reported chondroitin sulfate have been combined with other compound so that promote cell in culture or intravital adhering to.(US5593814；US4458678；US4418691；US4711780；US5545722)。Embodiment 4 cell toxicity tests

According to embodiment 1 described method, use the dull and stereotyped chemical compound lot that detects in 6-hole, with the relation between foreign gene absorption and the ability to express in definite its cytotoxicity and its promotion SW480 cell.Unless otherwise indicated, except that contrast, all flat boards all contain 4mM L-glutaminate and gentamicin to hinder bacterial growth.

Finish cell toxicity test by following method.Exist under the condition that needs its Cytotoxic compound of detection, at the 0th day, with SW480 cell (about 1 * 10 ⁶Individual cells/well) is layered among the 1ml RPMI in the culture dish of 6-hole.It is described to press embodiment 1, inoculates behind each hole 24 hours, removes the RPMI substratum, and the liposome that will contain foreign DNA then adds in the culture in the 1ml OPTI-MEM substratum.Transfection media also contains its cytotoxicity compound to be measured.Comprise that also contrast is dull and stereotyped, contrast is dull and stereotyped identical with test panel, and just the former does not contain test compound in substratum.In " static " condition, i.e. nonoscillatory, Rotating Plates, perhaps under the stirring condition, culture experiment and control cultures.Every day, collecting cell and with trypan blue dyeing assessment viability from a test holes and control wells carried out 8 days continuously.With control cultures that liposome DNA contacts in, preceding 4 days cell count quite stables or only be to increase a little to some extent after transfection, last every porocyte increased to about 1 * 10 at 8 days then ⁷Individual.The retarded growth of preceding 4 days internal reference cultures may be because liposome DNA itself has moderate cytotoxic effect.If in 4 days, viable count reduces＞50%, and at 8 days ends, cell did not have net increase after importing foreign DNA, just think that the compound that detects has " cytotoxicity " in described experimental concentration.

Use this test method, in many cases, the concentration that can control individualized compound or compound formulation is to reach the concentration that the fine tolerance of SW480 cell energy can improve transient expression level in these cells again.Also detected the tolerance of other cell type to some compounds of the present invention.Human melanoma cell, mouse black-in tumor cell and COS-7 cell (ATCCCRL1651) have for example been detected to adding to the tolerance of the preparation of No. 6 flat boards in the table 9.These cells are to some difference of susceptibility of test compound, but have identified one group of concentration that can be tolerated by all these cell types, and promptly in these concentration, according to above-mentioned detection method, these compounds do not have cytotoxicity.

Discovery can improve the sulfonation glycosaminoglycan of transient expression can both support normal cell growth, and promptly their toxicity is little, and cell can tolerate.The cell growth and the cytotoxicity curve of the cell that contacts with preparation with all cpds in the table 7 are listed in Fig. 1 and 2, wherein each figure description number corresponding to the flat board in the table 7 number.Table 7 explanation polysaccharide heparin can be blocked transient expression, but C type chrondroitin-6-sulfuric acid can improve transient expression.Although in table 7, do not list, observed your glycan of melon and also can improve transient expression.The genetic expression restraining effect of heparin mediation may be because the cation lipoid in heparin and the liposome has formed mixture, and therefore, making does not have carrier DNA can be passed in the cell.With regard to this influence, chrondroitin-6-sulfuric acid supports that the ability of genetic expression and cell growth is wonderful.

Table 7

Dull and stereotyped number	Compound/preparation	Classification	Transgene expression	Cytotoxicity
						1	Contrast 4mM L-glutaminate	n/a	Have	Do not have
2	2.5mM benzoate damping fluid～0.1mM chrondroitin-6-sulfuric acid (C type) 1mM L-glutaminate 4.0mM L-glutaminate	Ⅰ&Ⅱ	Have	Do not have

3	2.5mM benzoate damping fluid～0.1mM heparin 1mM L-glutaminate 4.0mM L-glutaminate	Ⅰ&	Do not have	Do not have
					4	～0.1mM heparin 1mM L-glutaminate 4mM L-glutaminate	Ⅱ	Do not have	Do not have
5	～0.1mM chrondroitin-6-sulfuric acid (C type) 1mM L-glutaminate 4mM L-glutaminate	Ⅱ	Have	Do not have
					6	2.5mM butyrates damping fluid	Ⅰ	Have	Have
7	2.5mM butyrates damping fluid 1mM L-glutaminate 4mM L-glutaminate	Ⅰ	Have	Have

The gene that contains the flat board expression transfection of butyrates damping fluid, but under the test conditions that is used for this group test, this damping fluid has cytotoxicity to the SW480 cell.Embodiment 5 usefulness Starburst polymkeric substance transfections

This group experimental study the inventive method shows whether the effectiveness that improves transient expression depends on DNA is passed to method in the cell.Except that be in the presence of tree-shaped polymkeric substance but not utilize liposome to send to pass and with the DNA transfered cell,, when transfection SW480 cell, use two kinds of different compounds combinations (seeing Table 8) herein with method similar to Example 1.These tree-shaped polymkeric substance are micro-synthetic polymer drops (being sold as being used for dimensioning " starburst " polymeric beads standard by Dow Chemicals at first), and they can be by chemical derivatization to play the effect of cation lipoid.The used tree-shaped polymkeric substance of present embodiment is that Jr. provides by the F.C.Szoka of San Francisco (California) University of California medicine/pharmaceutical chemistry system.Fat dyes or the method for tree-shaped polymkeric substance mediation is carried out the detailed mechanism that gene transmits although do not understand, and according to the distribution of physics-chem characteristic such as its shape and chemical group, they are very different probably.

Present method different with embodiment 1 in the following step.Dilute 14 micrograms of DNA with 397 μ l deionized waters, dilute the tree-shaped polymkeric substance of 56 micrograms with 393 μ l deionized waters.In 1 hour before use, dna solution and tree-shaped polymer slurry are mixed.OPTI-MEM (733 μ l) and the tree-shaped polymeric blends of DNA/ (167 μ l) are added in each hole, rotate 6-hole flat board with hand and mix fully guaranteeing.Be incubated after 5 hours, remove the substratum that contains the tree-shaped polymkeric substance of DNA/, add the 1.0ml substratum.Remaining step is described identical with embodiment 1.

Illustrated as table 8, when with tree-shaped polymkeric substance when foreign DNA is passed to the method for cell, the compound of test is effective.Therefore these find that effectively the listed compound formulation of announcement table 8 can play a role after DNA enters cell, no matter be used to import what the method for DNA is, this preparation all is effective.

Table 8

Dull and stereotyped number	Compound/preparation	The X factor	G-factor	The K factor
					1	Contrast	n/a	n/a	n/a
2	2.5mM benzoate damping fluid 0.1mM chrondroitin-6-sulfuric acid (C type) 4mM L-glutaminate	14	63	2
					3	2.5mM benzoate damping fluid 4mM L-glutamic acid 4mM L-glutaminate	42	34	-2

Proteinic output during embodiment 6 transient expressions

Following test explanation, transient expression system of the present invention is for being useful with the quick mass production of method described in the preamble embodiment by the protein that is directed into the exogenous gene expression in the recipient cell.

Finish 15 treadmill tests, wherein the listed compound of table 9 is added to by embodiment 1 described on the flat board of 6-hole in the substratum of the SW480 cell of transfection.Calculate X, G ₁₄With the K value, and 2 * 10 ⁴The accumulation protein mass that individual cell produced in 14 days, protein mass are listed in last hurdle of table 9.Data listed in the table 9 show that with regard to the protein mass of producing under the situation about existing at them, all compositions of listing all are better than contrast.According to the effectiveness order, the most effective preparation is used those in dull and stereotyped 6,3,13 and 14.In having accepted the two flat board of A and Type B preparation, observe better result, therefore, these combinations are particularly useful for animal experiment, as treating tumour, hormone is passed to other disease of specific tissue or need localized delivery biological activity protein with toxic protein.

Table 9

Dull and stereotyped number	Compound/preparation	The X factor	G 14The factor	The K factor	Gross protein (ng/2 * 10 4Individual cell)
						1	Contrast (contain DNA but do not contain compound)	n/a	n/a	n/a	10.2
2	2.5mM benzoate damping fluid	-16	43	1	11.7
						3	2.5mM the benzoate damping fluid after 48 hours with the Type B preparation cell of feeding: 2.5mM benzoate damping fluid 0.1mM chrondroitin-6-sulfuric acid	-14	63	2	28.7
4	The 4mM tryptophane	55	67	2	34.2
						5	1mM phenylformic acid 1mM 4-ethyl benzoate	41	80	2	27.5
6	A type preparation: 1mM phenylformic acid 1mM 4-ethyl benzoate after 48 hours with the Type B preparation cell of feeding: 2.5mM benzoate damping fluid 0.1mM chrondroitin-6-sulfuric acid	20	82	42	26.2
						7	1mM 4-ethyl benzoate	47	64	2	21.9
8	1mM 4-butylbenzoic acid	-26	65	9	14.6
						9	The 4mM L-glutaminate	-12	42	…	11.7
10	The 4mM citrulline	40	46	1	17.5

11	4mM benzoate damping fluid 0.1mM chrondroitin-6-sulfuric acid	54	72	2	26.1
						12	2.5mM benzoate damping fluid 4mM L-glutamic acid	42	76	6	25.1
13	A type preparation 2.5mM benzoate damping fluid 4mM L-glutamic acid after 48 hours with the Type B preparation cell of feeding: 2.5mM benzoate damping fluid 0.1mM chrondroitin-6-sulfuric acid	49	78	…	28.2
						14	A type preparation: the amino n-butyric acie 1mM of 1mM glutathione 1mM methionine 4mM glycine 4mM α taurine 4mM phenylalanine 2.5mM benzoate buffer solution 4mM alanine	57	77	1	29.6
15	1mM4-ethanoyl ethyl butyrate	51	59	1	22.0

Annotate: the substratum in all flat boards all contains gentamicin, and except that contrast, all also contains the 4mM L-glutaminate; Chrondroitin-6-sulfuric acid is the C type.

These tests have shown that also the transient expression that improves can be used for the protein of production milligram quantities very promptly and need not to set up earlier the clone of foreign gene stable integration.Therefore, the transient expression of raising provides a kind of novel method for amount effective expression candidate bio-pharmaceutical and rapid its pharmaceutical activity of screening with enough recovery.Therefore, the invention provides the method that drug discovery process is finished in a kind of acceleration.For example dull and stereotyped 6 in 14 days, and per 2 * 10 ⁴The about 26ng beta-galactosidase enzymes of individual cells produce (seeing Table 9).Be extended in proportion and contain about 2 * 10 ⁶The conventional culture of individual cell will reach 26mg with the gross protein of said preparation production.In embodiment 2, in the used HPBr device, generally grow 10 ⁹Therefore Duo cell like this, in this culture, in a couple of days, can obtain tens of or even hundreds of milligrams new or required protein.The transient expression of embodiment 7 in liver cell

(U.S.D.A., Beltsville MA) obtain being derived from totipotency (stem-like cell) clone non-transformed cell system (the PICM-19 3BT cell of pig embryonic cell (epiblast phase) from Dr.N.Talbots; Hereinafter referred to as " PICM-19 cell ").The behavior and the liver stem cells of these cells are similar, when 5% or the condition of still less carbonic acid gas under when cultivating, the self characteristic was all arranged in many months.At high concentration CO ₂(as up to 10%) down, these cells begin differentiation.From the PICM-19 cell of differentiation, separated at least two kinds of different noble cells phenotypes, promptly ripe liver cell and liver tubule (ductile) cell, the latter produces bile.With the instrument of the PICM-19 cell of being induced differentiation as the transfection feature of determining primary hepatocyte, primary hepatocyte and PICM-19 cell are very similar.In early test with former generation pork liver culture, the symmetry as a result of the result of gained and above-mentioned SW480 cell.Because in former generation,, the liver culture contained the cell type beyond the liver cell, so with the PICM-19 cell revision test that liver cell like cell homogeneous thing is provided.

The method that is used for transfection SW480 cell among used method and the embodiment 1 is identical, uses 1 * 10 ⁷Individual cells/well, difference are that the PICM-19 cell is layered on STO l cell feeder cell (CRL1503) layer of mitomycin C inactivation, do not have this layer feeder cell, and the PICM-19 cell can not grown usually.In the process of preparation liposome, identical among the ratio of DNA/ lipoid and cell and the embodiment 1.Incubator all maintains 10%CO in these experimentations ₂Concentration level.PICM-19 cell proliferation under these culture condition, is divided into ripe liver cell.In order to ensure differentiation fully, before the transfection step, culture was kept for 3 weeks in 10% carbonic acid gas.

Table 10 has been described used substratum in the transfection research of using these cells, and with X, the G of these cultures measurements ₇With the K factor values.Result in the table 10 with regard to the SW480 cell observation to the result and when the result who under conditions of similarity, obtains during transfection from the pork liver isolate of former generation of growing up consistent.

Surprisingly, also observe, the flat board that does not contain feeder cell also can support the PICM-19 cell that breaks up to grow at least 4 weeks.In addition, as shown in Figure 1, these cells are also expressed the DNA of transfection.This as a result the utmost point make us feeling surprised because relevant liver cell has not added to growth in the culture of dull and stereotyped feeder layer or protein dressing (as collagen protein) before adding cell or the report that keeps cultivating more than a couple of days did not also have.Obviously, the cell in No. 4 flat boards adheres to equally well with cell in the flat board that contains feeder cell, and this shows that C type chrondroitin-6-sulfuric acid has produced similar intravital cell growth and conservation condition.Therefore, these tests have shown that first chondroitin sulfate is used under the condition that does not have feeder cell, cultivate liver cell in low-cost culture media composition, make simultaneously liver cell keep with body in the similar phenotype of liver cell.Table 10

Dull and stereotyped number	Compound/preparation	The X factor	G 7The factor	The K factor
					1	Contrast	n/a	n/a	n/a
2	2.5mM phenylformic acid 4mM L-glutaminate	-17	99	1
					3	2.5mM benzoate damping fluid 0.1mM chrondroitin-6-sulfuric acid (C type) 4mM L-glutaminate	-41	102	0.0
4	2.5mM benzoate damping fluid 0.1mM chrondroitin-6-sulfuric acid (C type) 4mM L-glutaminate does not have feeder cell	-357	103	2
					5	2.5mM benzoate damping fluid 4mM L-glutamic acid 4mM L-glutaminate	-46	103	0.0

Embodiment 8 reclaims transgenosis mRNA and DNA from the transfectional cell of growing bio-reactor

In a test of 32 days, use the high-efficient biological reactor device (HPBr) described in the embodiment 3, wherein by embodiment 3 and table 5 described transfection SW480 cell and breed.Except that described below, identical with described in the embodiment 3 of used condition and detection.When on-test, will be from tissue culture flasks fresh collection 1 * 10 ⁷Individual SW480 cell and 1 * 10 ⁶Individual preswollen microballoon is expelled in the HPBr device simultaneously.Then described cell was cultivated 24 hours in the substratum that contains 1mM phenylformic acid and 1mM4-ethyl benzoate (A type preparation) without spin.When finishing in 24 hours, add the plasmid DNA of coding beta-galactosidase, then bio-reactor was rotated 4 hours with the speed of 30cpm.Then by with the substratum flushing that contains 1mM phenylformic acid, 1mM4-ethyl benzoate and 0.1mM chrondroitin-6-sulfuric acid (Type B preparation) three times, thereby remove the substratum that contains DNA from extracapillary space (ECS).After this, raise substratum with 1 liter that contains identical Type B preparation and replace 1 liter of substratum of round-robin in bio-reactor.In order to carry out remaining test, replaced round-robin substratum in bio-reactor with 1 liter that contains the Type B preparation fresh raising substratum every 7 days.Swivel arrangement not after removing DNA is so that cell can form tumour sample solid group.

After from bio-reactor, removing DNA 24 hours, from ECS, get cell and culture supernatants sample every day, continue 32 days.Cell sampling is to finish with the gained cell suspending liquid that sweeps away the part cell, takes a morsel then by nutrient solution stream being rushed at cell mass.By cell and the substratum in every kind of sample of centrifugation a little.To 2 * 10 in the every day sample ⁴Individual cell analysis beta-galactosidase enzymes is analyzed its metabolic marker with the supernatant liquor of every day, i.e. its glucose, lactic acid and ammonia concentration.After having collected the 32nd day sample, from ECS, collect remaining cell by tryptic digestion, then with collect 2.8 * 10 ⁵Individual cell extraction RNA and DNA.

Press the beta-galactosidase enzymes in embodiment 3 described detection cell samples every day, the result of these tests has been described among Fig. 4.Fig. 4 shows being expressed in the 4th day and reaching the peak level of beta-galactosidase enzymes, and all remains unchanged substantially until about 12 days, after this, and some instability of numerical value, but still quite high.Last data point corresponding to the cell of collecting by tryptic digestion when the off-test is described with square symbols in Fig. 4, and its value is about to being equivalent to 60% of peak value.Therefore, in whole 32 days process, all there is quite high-caliber beta-galactosidase enzymes to produce in the culture.

With glucose, lactic acid and ammonia concentration in the embodiment 2 described methods measurement supernatant liquors, these measuring results are listed in Fig. 5 A-5C.From Fig. 5 A and 5B obviously as can be seen, in entire test, glucose and lactic acid concn do not have noticeable change (because lactic acid production is low in these samples, and the numerical value that recorded is relatively stable, therefore think not significantly fluctuation of lactic acid) after the 7th day.By comparison, when each 7 days end cycle of changing between the substratum, ammonia concentration, has all increased more than 2 times before falling to being back to base value provide fresh culture at every turn.Repeat accumulation at each this ammonia after changing substratum and advantageously supports following opinion: contact with the compound of stable transfection and can make cellular metabolism utilize protein or amino acid as its main carbon source (tricarboxylic acid cycle) from utilizing glucose (glycolysis-) to become.If the cell in this test utilizes glucose as its main energy sources, estimate in each period of 7 days, be that lactic acid rather than ammonia concentration increase (attention Fig. 5 B shows during first 7 days, and some glycolysis-s may take place).

Ammonia is the by product of deamination, and deamination is the early stage step that amino acid metabolites enters tricarboxylic acid cycle.Therefore, the most possible explanation of ammonia accumulation is that cell utilizes amino acid in the substratum, maybe may be peptide or protein as its energy with the compound contact process that is used for stablizing transient expression.These amino acid may be derived from the peptide in the substratum for example.This peptide may be when the serum in the heat inactivation substratum be produced by the cracking of thermal induction serum protein.

It makes cell utilize amino acid significant for the purposes of the compound of stablizing transient expression as the ability of the energy from utilizing glucose to become as the energy.For example, the tricarboxylic acid cycle of carrying out amino acid metabolism is also very important in the metabolism of fat and lipoid.Therefore, also may be with compound treatment cell of inducing transient expression or people by activating the metabolism that tricarboxylic acid cycle improves fat and lipoid.Therefore, these compounds can be used as the medicine such as management of body weight.These results also shown the seen unique metabolic marker of Fig. 5 A-5C and wherein the transient expression of rotaring redyeing gene be enhanced and stable physiological status between contact.

In order to prepare nucleic acid, will cultivate at 32 days collect when finishing 2.8 * 10 ⁵Individual cell centrifugation through tryptic digestion does not have calcium and no magnesium PBS washing with 5ml, then with 1mlTRIZOL ^TM(Life Technologies) reagent at room temperature mixes.Then, at 4 ℃, will be suspended in TRIZOL ^TMIn cell insulation 10 minutes.At this moment, sample is frozen in-70 ℃.After melting, sample was placed 20 minutes in room temperature, added 200 μ l chloroforms again, acutely mixed 15 seconds, room temperature insulation 5-20 minute.Then, with 2,000xg with sample 4 ℃ centrifugal 15 minutes so that emulsion is divided into two-phase.

For isolation of RNA, carefully collect the upper strata water and do not contain any intermediate phase part, it is transferred in another test tube then with precipitated rna, the 0.5ml Virahol is mixed with this water, room temperature insulation 10-20 minute, then with 12,000xg was centrifugal to collect the RNA precipitation at 4 ℃ with test tube.With the careful washing precipitation of 1ml 70% (v/v) ethanol, at air at room temperature dry 5-10 minute, it being resuspended in 30 μ l did not then have in the water of RNAse (Five Prime Three Prime).

For DNA isolation, collect above-mentioned lower floor mutually and organic layer, and put upside down with 300 μ l, 100% ethanol and to mix, place 2-3 minute with deposit D NA in room temperature then.At 4 ℃, with 2,000xg collected the DNA precipitation in centrifugal 5 minutes, then, and with containing 10% alcoholic acid 0.1M Trisodium Citrate washed twice.For the second time after the washing, again at 4 ℃, with 2,000xg collected the DNA precipitation in centrifugal 5 minutes, washed by being resuspended in 75% ethanol 10-20 minute in room temperature then.Centrifugal collecting precipitation again, roughly dry, and resuspended and be dissolved in the 8mM sodium hydroxide.

In order to detect the existence of beta-galactosidase enzymes sequence, read the absorption value of 260nm and determine the concentration of RNA, the water with no RNAse dilutes the final concentration that RNA solution reaches 100 μ g/ml then.Then, 50: 50 37% formaldehyde of RNA solution and 150 μ l and the 20xSSC solution with 50 μ l dilution mixes.With sample be heated to 55-60 ℃ 20 minutes so that the target nucleic acid sex change is placed on sample on ice, add the water that 200 μ l do not have RNA.Vibration sample and roughly centrifugal with shard then, adds under light vacuum in the hole of slot blot device so that RNA is collected GeneScreen Plus ^TMOn the film (New England Nuclear).Wash each hole with 50 μ l, 10 * SSC, then film is exposed to UV-light so as to make RNA and film crosslinked, then about 90 ℃ with roasting 1 hour of film to remove formaldehyde.Except that not using the vacuum, use the same method DNA sample slot blot.

By with oligonucleotide hybridization corresponding to the 32P mark of a beta-galactosidase gene part in the transfection plasmid, determine beta-galactosidase enzymes DNA on the slot blot film or the existence of mRNA.The nucleotide sequence of this oligonucleotide is 5 ' CTCCAACGCAGCACCATCAC3 ' (SEQ ID NO:1).In order to hybridize, with 10ml hybridization buffer (1ml 50 * Denhardts solution, 10 μ l 10mg/ml polyadenylic acids, 12.5ml 20xSSC, 5ml 10% sodium lauryl sulphate and 2.5ml 0.5M NaPO ₄(pH6.5), final volume 50ml) be placed on the slot blot film and 1 * 10 that contains load ⁶Counting/ml ³²In the plastics bag of the probe of P-mark.With plastic bag sealing, 52-53 ℃ of incubated overnight.After the hybridization, in room temperature with described film with the damping fluid washed twice that contains 5xSSC and 0.1% sodium lauryl sulphate, each 5-10 minute.At 52-53 ℃, wash twice more then, each 20-30 minute, then X-ray film is exposed with same buffer.

After radioautograph, signal exists and has the transfection DNA that contains beta-galactosidase gene in the cell that promptly shows collection in 32 days after transfection.Therefore, this DNA has kept quite high amount in 32 days process of the test.In addition, the radioautograph of RNA slot blot show with the beta-galactosidase enzymes probe hybridization after a surprising strong signal is arranged.Tests before many show induces in 2-3 days remove compound from substratum after, and the beta-galactosidase enzymes output of cell descends and also disappears.Therefore, obviously in this test, the lasting existence of detectable beta-galactosidase enzymes DNA and mRNA is not that the outgrowth owing to the cell of having integrated foreign DNA causes.In addition, the typical transformation period of mRNA only had an appointment 1-3 days, and therefore, the existence of beta-galactosidase enzymes mRNA illustrates that this mRNA is transcribed recently when soak finished in 32 days, so the foreign DNA of transfection must be to be present in test in 32 days all the time.

32 days insulation backs are detected beta-galactosidase enzymes DNA and are further illustrated in during this period, and foreign DNA may duplicate and quantity increases.Because cell continues growth and division in process of the test, people may estimate that the plasmid DNA that added at the 0th day is thinning, and therefore the cell of 32 days post analysis should only contain beta-galactosidase enzymes DNA seldom.But, exist the beta-galactosidase enzymes mRNA of easy detection limit and the DNA of DNA explanation transfection in process of the test to duplicate, this duplicating may be finished in plastosome.Embodiment 9 induces alkaline phosphatase in the cell with transient expression stabilization compound treatment

The explanation of following test-results, except that inducing tricarboxylic acid cycle, by the metabolic characteristics of the cell of embodiment 8 described processing also comprise induce in the SW480 cell, almost detect under the normal circumstances less than endogenous alkaline phosphatase activities.Cell is grown in plastics tissue culture ware, use with embodiment 8 described identical substratum transfectional cells then and make its propagation.Come feeder cell by add number ml raising substratum every a couple of days.Collect these dull and stereotyped media samples every day, after the transfection first day, collected altogether 14 days, press embodiment 8 described analysis glucose, lactic acid and ammonia concentration.Beyond thought is when analyzing the endogenous alkaline phosphatase activities of these samples, to find that its amount is very high.Compare with the SW480 cell of routine growth, observed rising degree is about 2 times to about 20 times.

It is as follows to be used to measure the active detection method of SEAP.With every kind of sample of 0.5ml and 2xSEAP damping fluid (1xSEAP damping fluid=1M diethanolamine, 0.50mM magnesium chloride, pH9.8) mixing.In contrast, detect Roll mucus alkaline phosphatase simultaneously.Prepare the ox alkaline phosphatase with 1xSEAP.The product look substrate of these tests is a 0.15M p-nitrophenyl phosphoric acid, with behind the alkaline phosphatase enzymatic lysis, this substrate produced a kind of can be at the detected product of 405nm.(100 μ l) adds in each testing tube with substrate, then with test tube 37 ℃ of placements.Then, per minute reads the absorption value of control sample, reads altogether 10 minutes, and reads the absorption value of each test sample at the 1st and 6 minute.Calculate the alkaline phosphatase units of every milliliter of test sample with following formula:

Wherein:

A405nm=is in the absorption value of 405nm,

The volume of V=test tubes,

The df=dilution factor,

VE=is added to the sample volume in the test tubes.

For this group test, V=1.1ml, df=2.2, VE=0.5ml.

Whether in order to detect the inductive alkaline phosphatase activities is heat sensitive, uses identical with above-mentioned SEAP damping fluid but contains the detection damping fluid of 0.01M L-homoarginine, and identical sample is carried out second group of detection.Before adding substrate, control enzyme sample and media samples are heated to 65 ℃ in this damping fluid, kept 5-10 minute.Known this thermal treatment can destroy this kind of enzyme of finding in most of mammalian cells of expressing alkaline phosphatase.This pre-treatment has destroyed the alkaline phosphatase in these samples and the control sample really, therefore, show the inductive alkaline phosphatase and usually the type of normal detected alkaline phosphatase is identical in zooblast, rather than the known heat tolerance kind that is present in the placenta.

Although illustrated and described the preferred embodiments of the invention, should understand and to carry out various changes therein and can not depart from the spirit and scope of the present invention.

Sequence table (1) physical data:

(ⅰ) applicant: Goffe, Randall A.

Goffe,Adeelia?S

(ⅱ) invention exercise question: stable transient gene expression

(ⅲ) sequence number: 1

(ⅳ) contact address:

(A) addressee: Christensen O ' Connor Johnson﹠amp; Kindness

(B) street: 1420 5th Ave., Suite2800

(C) city: Seattle

(D) state: WA

(E) country: the U.S.

(F) postcode: 98101-2347

(ⅴ) computer-reader form:

(A) media type: floppy disk

(B) computer: IBM PC compatible

(C) operating system: PC-DOS/MS-DOS

(D) software: PatentIn Release#1.0, Version#1.30

(ⅵ) current application materials: PCT

(A) application number:

(B) applying date:

(C) classification number:

(ⅷ) proxy/act on behalf of data:

(A) name: Sheiness, Diana K.

(B) registration number: 35,356

(C) file/number of documents: GSPN-1-11156

(ⅸ) communications data:

(A) phone: (206) 682-8100; (206) 224-0735, direct dialing

(B) fax: the data of (206) 224-0779 (2) SEQ ID NO:1:

(ⅰ) sequence signature:

(A) length: 20 Nucleotide

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ⅱ) molecule type: oligonucleotide

(ⅲ) hypothesis: do not have

(ⅳ) antisense: have

(ⅵ) source:

(A) organism: intestinal bacteria

(ⅹ ⅰ) sequence description: SEQ ID NO:1:CTCCAACGCA GCACCATCAC 20

Claims (50)

1. improve the method for the transient expression of foreign gene in eukaryotic cell, described method comprises:

The form transfered cell of exogenous DNA molecule with coded protein can in cell, expressing; With

Before importing DNA, in the process or afterwards, described cell is contacted with the transient expression rising agent.

2. the process of claim 1 wherein that described reagent inducing cell utilizes protein or amino acid as its main energy sources.

3. the process of claim 1 wherein that described transient expression rising agent comprises at least a carboxylic acid derivative with following formula:

R wherein ₁Be:

CHNH ₂R ₃, R wherein ₃It is the side chain of natural amino acid;

C ₆H ₄R ₄, R wherein ₄Be H, CH ₃, (CH ₂) _nCH ₃, NH ₂, COCH ₃, CO (CH ₂) _nCH ₃, C (CH ₃) ₃, CH (CH ₃) ₂, (CH ₂) _nCH (CH ₃) ₂, (CH ₂) _nCOCH ₃, OCH ₃, or O (CH ₂) _nCH ₃, n=1-3 wherein;

CHNH ₂(CH ₂) _nR ₅, n=1-7 wherein, R ₅Be CH ₃, OH, CONH ₂, C ₆H ₄OH or CONHNH ₂

(CH ₂) _nR ₆, n=1-9 wherein, R ₆Be indyl, NCH ₃C (=NH) NH ₂, SCH ₃, NH ₂, CH ₃, CO ₂H, CONH ₂Or NHC (=NH) NH ₂

(CH ₂) _nCHNH ₂CO ₂H, wherein n=1-8;

CH(CO ₂H)NHCONH ₂；

C ₅H ₄N; And

R wherein ₂Be selected from H, CH ₃, (CH ₂) _nCH ₃, n=1-8 wherein, (CH ₂) _xO (CH ₂) _yCH ₃Or (CH ₂) _xCO (CH ₂) _yCH ₃, x+y=2-7 wherein, perhaps M, wherein M is metal balance ion or lower molecular weight organic cation.

4. the method for claim 3, wherein said transient expression rising agent comprise and are selected from following amino acid derivative: 3-methyl-L-Histidine, α-Tong Wuersuan; Beta-alanine, carnosine, citrulline; creatine; folic acid, gsh, urobenzoic acid; homoserine; N-(4-aminobenzyl)-L-glutamate diethyl ester, N-carbamyl aspartic acid, N-formyl radical-L-methionine(Met) and ornithine.

5. the method for claim 3, wherein R ₁Be nonpolar and hydrophobic.

6. the process of claim 1 wherein that described transient expression rising agent comprises the sulfonic acid with following formula: R ₇-SO ₂-OR ₈

R wherein ₇Be low alkyl group, aryl, the low alkyl group of replacement or the aryl of replacement of low alkyl group, aryl, replacement; With

R ₈Be hydrogen, metal balance ion, or low-molecular-weight organic cation.

7. the method for claim 6, wherein R ₇Be amino low alkyl group that replaces or the amino aryl that replaces.

8. the method for claim 6, wherein said sulfonic acid is selected from 3-aniline sulfonic acid, taurine and their salt.

9. the process of claim 1 wherein that described transient expression rising agent comprises the sulfonated glycosaminoglycan.

10. the method for claim 9, wherein said sulfonated glycosaminoglycan comprises the acetylizad glycosaminoglycan of N-.

11. the method for claim 10, the acetylizad glycosaminoglycan of wherein said N-are selected from chrondroitin-6-sulfuric acid and melon that glycan.

12. the method for claim 10, your glycan of wherein said melon is the hydroxypropyl guar glycan.

13. the process of claim 1 wherein that described transient expression rising agent comprises is selected from suprarenin, a kind of compound of actimide and methyl cobalamin.

14. the method for claim 3, the concentration of wherein said transient expression rising agent is 1-15mM.

15. the method for claim 6, the concentration of wherein said transient expression rising agent is 1-15mM.

16. the method for claim 9, the concentration of wherein said transient expression rising agent is 0.01-0.5mM.

17. the method for claim 11, the acetylizad glycosaminoglycan of wherein said N-are molecular weight is about 4000 daltonian chrondroitin-6-sulfuric acid.

18. the process of claim 1 wherein that described transient expression rising agent comprises that pH is the aqueous solution of 4.5-9.0.

19. the process of claim 1 wherein before, after the process neutralization, this cell contacted with first kind of transient expression rising agent that wherein said reagent comprises at least a compound with following formula with the foreign DNA transfered cell: R wherein ₁Be:

CHNH ₂R ₃, R wherein ₃It is the side chain of natural amino acid;

C ₆H ₄R ₄, R wherein ₄Be H, CH ₃, (CH ₂) _nCH ₃, NH ₂, COCH ₃, CO (CH ₂) _nCH ₃, C (CH ₃) ₃, CH (CH ₃) ₂, (CH ₂) _nCH (CH ₃) ₂, (CH ₂) _nCOCH ₃, OCH ₃, or O (CH ₂) _nCH ₃, n=1-3 wherein;

CHNH ₂(CH ₂) _nR ₅, n=1-7 wherein, R ₅Be CH ₃, OH, CONH ₂, C ₆H ₄OH or CONHNH ₂

(CH ₂) _nR ₆, n=1-9 wherein, R ₆Be indyl, NCH ₃C (=NH) NH ₂, SCH ₃, NH ₂, CH ₃, CO ₂H, CONH ₂Or NHC (=NH) NH ₂

(CH ₂) _nCHNH ₂CO ₂H, wherein n=1-8;

CH(CO ₂H)NHCONH ₂；

C ₅H ₄N; And R wherein ₂Be H, CH ₃, (CH ₂) _nCH ₃, n=1-8 wherein, (CH ₂) _xO (CH ₂) _yCH ₃Or (CH ₂) _xCO (CH ₂) _yCH ₃, wherein x+y=2-7, or M, wherein M is metal balance ion or lower molecular weight organic cation;

Or described first kind of transient expression rising agent comprises the compound with following formula: R ₇-SO ₂-OR ₈

R wherein ₇It is the aryl of low alkyl group, aryl or the replacement of low alkyl group, aryl, replacement; With

R ₈Be hydrogen, metal balance ion, or lower molecular weight organic cation;

After importing foreign DNA, cell is contacted with second kind of transient expression rising agent, wherein said second kind of reagent contains the sulfonated glycosaminoglycan.

20. the process of claim 1 wherein before, described cell contacted with described reagent with the foreign DNA transfered cell.

21. the process of claim 1 wherein in process, described cell contacted with described reagent with the foreign DNA transfered cell.

22. the process of claim 1 wherein after, described cell continued to contact with described reagent with the foreign DNA transfered cell.

23. the process of claim 1 wherein that described cell is a culturing cell.

24. the method for claim 23, wherein said culturing cell is a primary culture.

25. the method for claim 24, wherein said culturing cell is selected from the cell of stable conversion, tumor cell line and hybridoma.

26. the method for claim 25, wherein said culturing cell are the SW480P3 cells.

27. the process of claim 1 wherein that described reagent is biocompatibility.

28. the process of claim 1 wherein and collect by described foreign gene encoded protein matter.

29. the process of claim 1 wherein that described cell is present among the host alive, and the transient expression rising agent imported in this host by oral or injection.

30. the process of claim 1 wherein by following method the foreign DNA transfered cell: fat dyes method, virus vector contacts cell with co-precipitation with calcium phosphate, and has transfection under the condition of starburst polymkeric substance.

31. the method for claim 30, wherein by virus vector with the DNA transfered cell, and this virus vector is derived from adenovirus.

32. the method for claim 27, wherein said reagent contain at least one hydrophobic part and at least one acid moieties, and described acid groups can be formed salt or ester by modification.

33. the method for claim 32, wherein said acid moieties are hydrophobic and organic.

34. screening contains the reagent of at least a compound to determine whether described reagent can improve the method for the transient expression of foreign gene in eukaryotic cell, wherein said reagent is biocompatibility, and containing at least one hydrophobic part and at least one acid moieties, described method comprises the steps:

At the 0th day, with exogenous DNA molecule first and second parts of SW480 P3 cells of form importing of coded protein in cell, expressing;

Before importing DNA, in the process or afterwards, described second part of cell contacted with described reagent;

At 0-4 days or 4-7 days, or cumulative bad was measured in two parts of cells from foreign DNA expressed proteins quality between 4-14 days, then with this tittle according to formula definite respectively X, G ₇Or G ₁₄Value: X or G ₇Or $G_{14}=100-\frac{(A\×100)}{C}$

Wherein " A " be in first part of cell, express by foreign gene encoded protein quality, " C " is expressed proteins quality in second part of cell; With

If X or G ₇Or G ₁₄Greater than 10, determine that this reagent can improve transient expression.

35. the method for claim 34, wherein X or G ₇Or G ₁₄Greater than 25.

36. improve the method for the transient expression of foreign gene in cell, described method comprises: with the form transfered cell of exogenous DNA molecule expressing in cell of coded protein; With

X or G when assessing with cell and according to the mensuration of claim 33 ₇Or G ₁₄Reagent contact greater than 25.

37. the control cellular metabolism is with the method for the glucose consumption that reduces cell, described method comprises utilizes protein or amino acid to contact as the reagent of its main energy sources described cell and inducing cell.

38. the method for claim 37, wherein said reagent be the endogenous alkaline phosphatase activities of abduction delivering also.

39. the method for claim 37, wherein said reagent can improve the transient expression of foreign gene in cell, wherein said reagent comprises at least a compound with following formula: R wherein ₁Be:

CHNH ₂R ₃, R wherein ₃It is the side chain of natural amino acid;

C ₆H ₄R ₄, R wherein ₄Be H, CH ₃, (CH ₂) _nCH ₃, NH ₂, COCH ₃, CO (CH ₂) _nCH ₃, C (CH ₃) ₃, CH (CH ₃) ₂, (CH ₂) _nCH (CH ₃) ₂, (CH ₂) _nCOCH ₃, OCH ₃, or O (CH ₂) _nCH ₃, n=1-3 wherein;

CHNH ₂(CH ₂) _nR ₅, n=1-7 wherein, R ₅Be CH ₃, OH, CONH ₂, C ₆H ₄OH or CONHNH ₂

(CH ₂) _nR ₆, n=1-9 wherein, R ₆Be indyl, NCH ₃C (=NH) NH ₂, SCH ₃, NH ₂, CH ₃, CO ₂H, CONH ₂Or NHC (=NH) NH ₂

(CH ₂) _nCHNH ₂CO ₂H, wherein n=1-8;

CH(CO ₂H)NHCONH ₂；

C ₅H ₄N; And R wherein ₂Be H, CH ₃, (CH ₂) _nCH ₃, n=1-8 wherein, (CH ₂) _xO (CH ₂) _yCH ₃Or (CH ₂) _xCO (CH ₂) _yCH ₃, wherein x+y=2-7, or M, wherein M is metal balance ion or lower molecular weight organic cation; Perhaps

Sulfonic acid with following formula: R ₇-SO ₂-OR ₈

R wherein ₇It is the lower aryl of low alkyl group, aryl or the replacement of low alkyl group, aryl, replacement; With

R ₈Be hydrogen atom, metal balance ion, or lower molecular weight organic cation; Perhaps

The sulfonated glycosaminoglycan.

40. comprising, the method for claim 39, wherein said reagent be selected from following compound: phenylformic acid, 4-ethyl benzoate, benzoate damping fluid and chrondroitin-6-sulfuric acid.

41. the method for claim 39, wherein said reagent is administered to Mammals in vivo.

42. improve cell attachment in the method for culture basic unit, wherein the sulfonated glycosaminoglycan added in the substratum of culturing cell.

43. the method for claim 42, wherein said cell are to need feeder layer usually so that the cell of growing in culture.

44. the method for claim 42, wherein said cell is a liver cell, and described sulfonated glycosaminoglycan is chrondroitin-6-sulfuric acid.

45. the process of claim 1 wherein before, in the process or afterwards with the foreign DNA transfered cell, cell is contacted with first kind of reagent, wherein said first kind of reagent comprises at least a compound with following formula: R wherein ₁Be:

CHNH ₂R ₃, R wherein ₃It is the side chain of natural amino acid;

C ₆H ₄R ₄, R wherein ₄Be H, CH ₃, (CH ₂) _nCH ₃, NH ₂, COCH ₃, CO (CH ₂) _nCH ₃, C (CH ₃) ₃, CH (CH ₃) ₂, (CH ₂) _nCH (CH ₃) ₂, (CH ₂) _nCOCH ₃, OCH ₃, or O (CH ₂) _nCH ₃, n=1-3 wherein;

CHNH ₂(CH ₂) _nR ₅, n=1-7 wherein, R ₅Be CH ₃, OH, CONH ₂, C ₆H ₄OH or CONHNH ₂

(CH ₂) _nR ₆, n=1-9 wherein, R ₆Be indyl, NCH ₃C (=NH) NH ₂, SCH ₃, NH ₂, CH ₃, CO ₂H, CONH ₂Or NHC (=NH) NH ₂

(CH ₂) _nCHNH ₂CO ₂H, wherein n=1-8;

CH(CO ₂H)NHCONH ₂；

C ₅H ₄N; R wherein ₂Be H, CH ₃, (CH ₂) _nCH ₃, n=1-8 wherein, (CH ₂) _xO (CH ₂) _yCH ₃Or (CH ₂) _xCO (CH ₂) _yCH ₃, wherein x+y=2-7, or M, wherein M is metal balance ion or lower molecular weight organic cation; Perhaps

First kind of reagent comprises at least a compound with following formula: R ₇-SO ₂-OR ₈

R wherein ₇Be the low alkyl group of low alkyl group, aryl, replacement or the lower aryl of replacement; With

R ₈Be hydrogen, metal balance ion, or lower molecular weight organic cation;

After importing foreign DNA, described cell is contacted with second kind of reagent, wherein said second kind of reagent contains at least a sulfonated glycosaminoglycan or wherein said second kind of reagent contains at least a compound with following formula: R wherein ₁Be:

CHNH ₂R ₃, R wherein ₃It is the side chain of natural amino acid;

C ₆H ₄R ₄, R wherein ₄Be H, CH ₃, (CH ₂) _nCH ₃, NH ₂, COCH ₃, CO (CH ₂) _nCH ₃, C (CH ₃) ₃, CH (CH ₃) ₂, (CH ₂) _nCH (CH ₃) ₂, (CH ₂) _nCOCH ₃, OCH ₃, or O (CH ₂) _nCH ₃, n=1-3 wherein;

CHNH ₂(CH ₂) _nR ₅, n=1-7 wherein, R ₅Be CH ₃, OH, CONH ₂, C ₆H ₄OH or CONHNH ₂

(CH ₂) _nR ₆, n=1-9 wherein, R ₆Be indyl, NCH ₃C (=NH) NH ₂, SCH ₃, NH ₂, CH ₃, CO ₂H, CONH ₂Or NHC (=NH) NH ₂

(CH ₂) _nCHNH ₂CO ₂H, wherein n=1-8;

CH(CO ₂H)NHCONH ₂；

C ₅H ₄N; And R wherein ₂Be H, CH ₃, (CH ₂) _nCH ₃, n=1-8 wherein, (CH ₂) _xO (CH ₂) _yCH ₃Or (CH ₂) _xCO (CH ₂) _yCH ₃, wherein x+y=2-7, or M, wherein M is metal balance ion or lower molecular weight organic cation;

Or described second kind of reagent comprises at least a compound with following formula: R ₇-SO ₂-OR ₈

R wherein ₇Be the low alkyl group of low alkyl group, aryl, replacement or the lower aryl of replacement; With

R ₈Be hydrogen atom, metal balance ion, or lower molecular weight organic cation; With

Wherein said first kind of reagent is when calculating the X value with following formula, and X is greater than a kind of reagent of 25: $X=100-\frac{(A\×100)}{C}$

Wherein said second kind of reagent is G ₇Or G ₁₄Value is greater than a kind of reagent of 25, wherein G ₇Or G ₁₄Be calculated as follows: G ₇Or $G_{14}=100-\frac{(A\×100)}{C}$

Wherein for X and G ₇Or G ₁₄, " A " be with first part of cell that first and second kinds of reagent contact in express by foreign gene encoded protein quality, " C " be not with second part of cell that first or second kind of reagent contact in the expressed proteins quality.

46. the method for claim 45, wherein said first kind of reagent is the benzoate damping fluid, and described second kind of reagent is chrondroitin-6-sulfuric acid.

47. the method for claim 45, wherein said first kind of reagent comprises phenylformic acid and 4-ethyl benzoate, and described second kind of reagent comprises benzoate damping fluid and chrondroitin-6-sulfuric acid.

48. the method for claim 45, wherein said first kind of reagent comprises benzoate damping fluid and L-glutamic acid, and described second kind of reagent comprises chrondroitin-6-sulfuric acid.

49. the method for claim 45 wherein before with the foreign DNA transfered cell, contacts about 20-24 hour with cell with first kind of reagent.

50. the process of claim 1 wherein that described reagent is: phenylformic acid and 4-ethyl benzoate; Or benzoate damping fluid and chrondroitin-6-sulfuric acid; Or benzoate damping fluid and L-glutamic acid; Or gsh, methionine(Met), glycine, alpha-amino group butanic acid, taurine, phenylalanine, benzoate damping fluid and L-Ala.

Images