CN1236070C - Peptide nucleic acid chip for detecting muatatonal site of hepatitis B virus and its preparing method - Google Patents
Peptide nucleic acid chip for detecting muatatonal site of hepatitis B virus and its preparing method Download PDFInfo
- Publication number
- CN1236070C CN1236070C CN 02135626 CN02135626A CN1236070C CN 1236070 C CN1236070 C CN 1236070C CN 02135626 CN02135626 CN 02135626 CN 02135626 A CN02135626 A CN 02135626A CN 1236070 C CN1236070 C CN 1236070C
- Authority
- CN
- China
- Prior art keywords
- connexon
- nucleic acid
- peptide nucleic
- pna
- hepatitis
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
Abstract
The present invention discloses a chip for detecting peptide nucleic acid at hepatitis b virus mutant sites and a preparation method thereof. The chip comprises a substrate, peptide nucleic acid probes in the array distribution and a control point coating layer, wherein the substrate is either a glass or a nylon membrane; the peptide nucleic acid probes and the control point coating layer comprises 24 detection probes (with known mutant sites and wild sites of a front core antigen region and a surface antigen region of hepatitis b), 2 positive control probes, 1 negative control probe and a bank point sample liquid control probe. The PCR amplification of hepatitis b virus DNA samples uses a primer with a T3 promoter, PCR products are labeled by fluorescence through in vitro transcription, obtained single-chain RNA is hybridized with a peptide nucleic acid chip through fragmentation, and the mutant sites are analyzed through the intensity of hybridization signals. The chip of the present invention simultaneously and parallelly detects the known mutant sites of the front core antigen region and the surface antigen region of the hepatitis b, and has the characteristics of high speed, high efficiency and accurate diagnosis.
Description
One, technical field
The present invention relates to the gene chip field, relate to low close chip of peptide nucleic acid(PNA) and preparation method thereof specifically, especially relate to the peptide nucleic acid(PNA) detection chip in hepatitis B mutational site and preparation method thereof.
Two, background technology
The demand that biochip technology is based on high-throughput, parallel analysis the earliest produces.It mainly is divided into chip of expression spectrum and oligonucleotide chip.Oligonucleotide chip has the potential advantage at aspects such as clinical diagnosis, the detection of disease resistance, gene types, and the sudden change detection of for example research of human mitochondrion 16.6kb genome polymorphism, BRCA I exons 11, cftr gene, ATM gene, HIV-1 reversed transcriptive enzyme and proteinase gene, branch bar be identification not of the same race and the plain resistance detection of sharp good fortune enzyme etc. in belonging to., advantages such as level of automation high, energy high throughput analysis testing sample few, highly sensitive in view of the required testing sample of gene chip, low close gene chip has broad prospects aspect medical diagnosis on disease.At present oligonucleotide chip mostly is oligodeoxynucleotide, because the secondary structure of himself and testing sample, length, Tm value etc. are not quite similar, oligodeoxynucleotide exists false positive and false negative phenomenon at aspects such as the single base differences of detection.And the assorted and dimeric stability of DNA and DNA will be lower than corresponding D NA/RNA, DNA/PNA and PNA/RNA.Based on these characteristics, the present invention intends adopting the RNA of mark and peptide nucleic acid(PNA), and (peptide nucleic acid, PNA) hybridization detects single base difference, improves the sensitivity and the specificity that detect.
Peptide nucleic acid(PNA) is by a kind of nucleic acid analog that is used for antisense, anti-gene therapy of people's synthetic such as Peter the earliest in 1991.It is that four kinds of bases link to each other with skeleton by the methylene radical carbonyl by the phosphopentose skeleton in the alternative dna molecular of N-(2-amino-ethyl) glycine.The physics and chemistry and the biological characteristics of PNA uniqueness have been given in the introducing of peptide chain backbone.PNA is boundless in the biology field prospect, it has been used to hybridize (pre-gelhybridization), auxiliary (PNA-assisted rare cleavage), nucleic acid purification, employing PCR hair clip (PCR clamping) the analysis list base mutation sheared of PNA before enhanced pcr amplification, the PNA glue, make probe with PNA and detect genetic mutation by capillary electrophoresis, development PNA derivative, fields such as biosensor.
Peptide nucleic acid(PNA) is achiral molecule, neutral, and stability is high, difficult to be degraded, stablize in very wide pH value scope by proteolytic enzyme and nuclease, following gas with combining of nucleic acid pauses-and crith gram (Waston-Crick) base complementrity pair principle.Because PNA contains neutral backbone, interchain does not have repulsive interaction, it with the formed crossbred thermostability of DNA, RNA than corresponding RNA-RNA, DNA-DNA, DNA-RNA height.It is 50 ℃ that the PNA of 10-mer and corresponding DNA are hybridized formed antiparallel dimeric Tm value, and the Tm value of 15-merPNA is 70 ℃.The binding specificity of PNA also will be higher than DNA and RNA, and the difference of a base just can make 8-20 ℃ of Tm value decline (15 ℃ of average out to) among the 15-mer PNA/DNA, and corresponding D NA/DNA Tm value drops to 4-16 ℃ (11 ℃ of average out to).And the hybridization of PNA does not rely on high salt ion intensity, a low salt ion intensity of need.Consider the characteristics such as pairing, combination and hybridization of PNA, the PNA probe has broad prospects at aspects such as identification form base mutation, microarraies.
Hepatitis is the Pandemic infection disease, and China is the hepatitis big country that generally acknowledges, the morbidity of hepatitis and sickness rate are all at the forefront in the world.The sudden change of hepatitis B virus gene different loci can cause immune evasion, antiviral therapy escape, makes clinical detection omission, inappropriate medication occur, so that delay treatment.The present invention adopts the RNA of mark and peptide nucleic acid(PNA) chip hybridization to detect the hepatitis B mutational site, can improve the sensitivity and the specificity that detect, does not appear in the newspapers so far.
Three, summary of the invention
At above-mentioned deficiency, the problem to be solved in the present invention provides the peptide nucleic acid(PNA) detection chip in a kind of hepatitis B virus mutational site and preparation method thereof, and the peptide nucleic acid(PNA) detection probes in hepatitis B known mutations site and positive and negative contrast probe openly simultaneously, be used for the upstream and downstream primer of pcr amplification.This peptide nucleic acid(PNA) detection chip has characteristics quick, efficient, accurate, parallel diagnosis, can provide important evidence for clinical application, treatment.
The peptide nucleic acid(PNA) detection chip in hepatitis B virus of the present invention mutational site comprises the peptide nucleic acid probe of substrate and array distribution and the some coating of contrast, and substrate is a glass substrate, one of nylon membrane.The coating of selecting of peptide nucleic acid probe and contrast is meant on substrate equally distributed, 24 peptide nucleic acid(PNA) detection probes that comprise the preceding core antigenic region (preceding C district) of hepatitis B and (S district) known mutations site, surface antigen district and wild site, article 2, positive peptide nucleic acid probe, 1 negative control probe and the contrast of blank sampling liquid.Wherein, the sequential structure of described 24 peptide nucleic acid(PNA) detection probes is respectively,
The S1:ACATAGAGGTTCCTTGA-O-connexon, the S2:ACATAGAGATTCCTTGA-O-connexon,
The S3:GGGAAACATAGAGGTTC-O-connexon, the S4:GGGAAACACAGAGGTTC-O-connexon,
The S5:AGGGAAACATAGAGGTT-O-connexon, the S6:AGGGAAACGTAGAGGTT-O-connexon,
The S7:GTTTCCGTCCGAAGG-O-connexon, the S8:GTTTCCGGCCGAAGG-O-connexon,
The S9:CAGTTTCCGTCCGAA-O-connexon, the S10:CAGTTTCTGTCCGAA-O-connexon,
The C1:ACAAAGACCTTTAACCTA-O-connexon, the C2:ACAAAGATCATTAACCTA-O-connexon,
The C3:GAACAGTAGGACATGA-O-connexon, the C4:GAACAGTGGGACATGA-O-connexon,
The C5:GCTTGAACAGTAGGAC-O-connexon, the C6:GCTTGAAAAGTAGGAC-O-connexon,
The C7:CATGCCCCAAAGCCA-O-connexon, the C8:CATGCCCTAAAGCCA-O-connexon,
The C9:CCATGCCCCAAAGC-O-connexon, the C10:CCATGCTCCAAAGC-O-connexon,
The C11:GTCCATGCCCCAAAG-O-connexon, the C12:GTCCATGTCCCAAAG-O-connexon,
The C13:ATGTCCACGCCCCAA-O-connexon, the C14:ATGTCCATGCCCCAA-O-connexon;
The sequential structure of described 2 positive peptide nucleic acid probes is PCS:TGGGATGGGAATACA-O-connexon, PCC:ATGCCTACAGCCTCC-O-connexon respectively;
The sequential structure of described negative probe is the NC:GAGCAACTGTACCAAGA-O-connexon;
Above-mentioned substrate is one of glass nude film, aldehyde radical sheet glass, amination slide and nylon membrane without any modification.
Above-mentioned aldehyde radical slide adopts saturated sodium bicarbonate solution as sampling liquid, amination, adopts hybridization solution as sampling liquid without the glass nude film and the nylon membrane of any chemically modified.
The size of the above-mentioned peptide nucleic acid(PNA) detection probes place array and the some coating of contrast can be according to the size of point, the variation of dot spacing and changing, and array can change according to the number of sample to be analyzed at on-chip distribution number.
Above-mentioned peptide nucleic acid(PNA) detection probes is arranged as shown in Figure 2, and the peptide nucleic acid probe spot diameter is 100 μ m, and when dot spacing was 300 μ m, peptide nucleic acid(PNA) detection probes place array was 1.6mm * 1.6mm with corresponding some coating size.
In 24 above-mentioned peptide nucleic acid(PNA) detection probes, comprise 12 mutational site peptide nucleic acid(PNA) detection probes and 12 wild site peptide nucleic acid(PNA) detection probes, wherein, the mutational site comprises known 5 mutational sites, S district, is respectively: 546C-T, 551A-G, 552T-C, 585A-C, 587G-A; With 7 known mutational sites, preceding C district, be respectively: 1896G-A, 1762A-T and 1764G-A unite sudden change, 1858C-T, 1862G-T, 1898G-A, 1899G-A, 1901G-A.
2 above-mentioned positive peptide nucleic acid(PNA) contrast probes, the nucleic acid conserved sequence in core antigenic region and surface antigen district before coming from respectively.
Above-mentioned negative peptide nucleic acid(PNA) contrast probe comes from the 17mer nucleotide sequence in the people ATM gene.
Above-mentioned peptide nucleic acid(PNA) detection probes and positive peptide nucleic acid probe are that length is the peptide nucleic acid(PNA) of 14-18mer, all design at the hepatitis B virus DNA antisense strand, its N-terminal is connected with O-connexon (O-linker, 8-amino-3, the 6-dioxy is sad), corresponding 3 ' end of DNA chain.
The preparation method of the peptide nucleic acid(PNA) detection chip in hepatitis B virus of the present invention mutational site may further comprise the steps:
1, the design of peptide nucleic acid(PNA) PNA detection probes and synthetic
The length of peptide nucleic acid probe is 14-18mer, all designs at the hepatitis B DNA antisense strand.The sudden change detection site designs the mid-way at peptide nucleic acid probe as far as possible, and the Tm value of all probes is pressed GC base percentage calculation, differs and is no more than 10 ℃.Its N-terminal is connected with the O-connexon, corresponding 3 ' end of DNA chain, and promptly PNA combines in antiparallel mode with sample DNA.Used peptide nucleic acid probe of this chip and sequence thereof see Table 1.The PNA probe is synthetic by German Mai Debao (MetabionGmbH) company.
2, the modification of slide and PNA probe is fixing
Handle glass slide with 95% acetone soln that contains the 1%-5%3-TSL 8330, promptly obtain the amination slide.The amination slide obtains the aldehyde radical slide after the glutaraldehyde solution of 5%-25% is handled 2-5 hour.Peptide nucleic acid(PNA) contains aminoterminal, combines with the aldehyde radical glass substrate by uncommon Fo Shi alkali reaction.The aldehyde radical slide adopts saturated NaHCO
3Solution is as sampling liquid, amination, adopts hybridization solution without the glass nude film and the nylon membrane of any chemically modified, and promptly the phosphate buffered saline buffer of the 10mM of pH7.0 (0.1mMNaCI, 5mMEDTA, 0.1%SDS) is as sampling liquid.
3, the extraction of hepatitis B sample DNA, pcr amplification and fluorescent mark
1) DNA extraction: get 20-100 μ l hepatitis B serum, add the lysate of 3 times of volumes, mixing.Add isopyknic chloroform, primary isoamyl alcohol solution (24: 1), centrifugal back adds the dehydrated alcohol of 2 times of volumes to drawing supernatant liquor, and freezing back is centrifugal, and the gained precipitation is cleaned 2 times with 70% ethanol.
2) pcr amplification: the PCR upstream and downstream primer that is adopted is respectively
Upstream primer: 5 '
ATTAACCCTCACTAAAGGGGAGGCATACTTCAAAGACTGT 3 '
The T3 promoter sequence
Downstream primer: 5 ' GATGGGATGGGAATACA 3 '
Upstream primer originates in 1700 sites (initiation site be to be for GeneBank number that the hepatitis B virus DNA of AF100308 is reference) of hepatitis B virus DNA positive-sense strand, and length is 21 bases, and 5 ' end is connected with the T3 promoter sequence of 19 bases.The length of downstream primer is 17 bases, originates in 601 sites of hepatitis B virus DNA positive-sense strand.The pcr amplification zone is 2133bp, has comprised all known mutations sites of preceding C district and S district.
Pcr amplification adopts U.S. MJ Research PTC-225PCR amplification instrument, and amplification system is 25 μ l.Program is as follows:
94 ℃ of 1 circulations in 1.5 minutes
94 ℃ 20 seconds, 55 ℃ 20 seconds, 72 ℃ 35 circulations altogether in 2.5 minutes
72 ℃ of 1 circulations in 8 minutes
The gained pcr amplification product is through the glass purifying of suckling.
3) in-vitro transcription mark: adopt the commercial test kit of Pu Luomaige (Promega) company, in the T3 in-vitro transcription, add the Cy3-UTP mark.
4, the hybridization of peptide nucleic acid(PNA) array and detection, signal analysis
The RNA that in-vitro transcription obtains behind fragmentation with the peptide nucleic acid(PNA) hybridization array.Hybridization temperature is 65 ℃-85 ℃, and the time is 1-3 hour.Hybridization solution adopts the phosphate buffered saline buffer pH7.0 of 10mM, includes 0.1mMNaCI, 5mMEDTA, 0.1%SDS.Scavenging solution adopts the phosphate buffered saline buffer of 10mM to wash 1 time, and the phosphate buffered saline buffer of 5mM is washed 2 times.
Peptide nucleic acid(PNA) chip after the hybridization is through laser scanner scans or fluorescence microscope and collect signal, according to scanning analysis or fluorescent quantitation, and negative control and the no fluorescent signal of sampling liquid contrast, the positive control probe has fluorescent signal.Determine according to the power of each site wild-type and mutant fluorescence probe signal whether this site has sudden change to take place.
The sequence of peptide nucleic acid probe in the peptide nucleic acid(PNA) detection chip in table 1 hepatitis B virus mutational site
| The mutational site | Length | Wild-type probe (direction: carboxyl is to aminoterminal) title: sequence | Mutant probe (direction: carboxyl is to aminoterminal) title: sequence |
| 546C-T | 17 | The S1:ACATAGAGGTTCCTTGA-O-connexon | The S2:ACATAGAGATTCCTTGA-O-connexon |
| 551A-G | 17 | The S3:GGGAAACATAGAGGTTC-O-connexon | The S4:GGGAAACACAGAGGTTC-O-connexon |
| 552T-C | 17 | The S5:AGGGAAACATAGAGGTT-O-connexon | The S6:AGGGAAACGTAGAGGTT-O-connexon |
| 585A-C | 15 | The S7:GTTTCCGTCCGAAGG-O-connexon | The S8:GTTTCCGGCCGAAGG-O-connexon |
| 587G-A | 15 | The S9:CAGTTTCCGTCCGAA-O-connexon | The S10:CAGTTTCTGTCCGAA-O-connexon |
| 1762A-T， 1764G-A | 18 | The C1:ACAAAGACCTTTAACCTA-O-connexon | The C2:ACAAAGATCATTAACCTA-O-connexon |
| 1858C-T | 16 | The C3:GAACAGTAGGACATGA-O-connexon | The C4:GAACAGTGGGACATGA-O-connexon |
| 1862G-T | 16 | The C5:GCTTGAACAGTAGGAC-O-connexon | The C6:GCTTGAAAAGTAGGAC-O-connexon |
| 1896G-A | 15 | The C7:CATGCCCCAAAGCCA-O-connexon | The C8:CATCCCCTAAAGCCA-O-connexon |
| 1898G-A | 14 | The C9:CCATGCCCCAAAGC-O-connexon | The C10:CCATGCTCCAMGC-O-connexon |
| 1899G-A | 15 | The C11:GTCCATGCCCCAAAG-O-connexon | The C12:GTCCATGTCCCAAAG-O-connexon |
| 1901G-A | 15 | The C13:ATGTCCACGCCCCAA-O-connexon | The C14:ATGTCCATGCCCCAA-O-connexon |
| Positive control | 15 | The PCS:TGGGATGGGAATACA-O-connexon | The PCC:ATGCCTACAGCCTCC-O-connexon |
| Negative control | 17 | The NC:GAGCAACTGTACCAAGA-O-connexon |
The base of black matrix mark is site to be detected in the table 1 peptide nucleic acid probe sequence.
Advantage of the present invention and effect
1) PNA and DNA, RNA are hybridized the dimeric Tm value of formed PNA-DNA, PNA-RNA, stability will be higher than corresponding D NA-DNA, DNA-RNA, have the difference of a base, and the Tm value of PNA-DNA will reduce 8-20 ℃.Thereby the PNA chip has special advantages aspect the identification form base difference.
2) the dimeric stability of the hybridization of PNA and RNA will be higher than PNA-DNA, so the present invention adopts RNA.Long single stranded RNA is easier to the carrying out that hybridize behind fragmentation.
3) the formed dimeric stability of the antiparallel combination of PNA and DNA, RNA (aminoterminal of PNA corresponding 3 ' end of DNA) will be higher than the parallel combination of its forward (carboxyl terminal of PNA corresponding 3 ' end of DNA),
The present invention adopts antiparallel combination just.
Four, description of drawings
Fig. 1 is the synoptic diagram of the peptide nucleic acid(PNA) detection chip in hepatitis B virus mutational site.
Wherein, 1 is substrate, and 2 is the some coating of peptide nucleic acid probe and contrast.
Fig. 2 is a peptide nucleic acid probe distribution plan in the peptide nucleic acid(PNA) detection chip.
Wherein, A1, A6, F1, F6 all represent positive control PCS, and B1, B6, E1, E6 all represent positive control PCC; C1 and C6 all represent negative control NC; D1 and D6 are the sampling liquid contrast; A2,3,4,5 represents probe S1, S3, S5, S7 respectively; B2,3,4,5 represents probe S2, S4, S6, S8 respectively; C2,3,4,5 represents probe S9, C1, C3, C5 respectively; D2,3,4,5 represents probe S10, C2, C4, C6 respectively; E2,3,4,5 represents probe C7,9,11,13 respectively; F2,3,4,5 represents probe C8,10,12,14 respectively.Fig. 3 is the resulting PCR product of a upstream and downstream primer amplification hepatitis B DNA electrophoretogram.
Wherein, the white ribbon of swimming lane 1 is the purpose amplified fragments, and length is 2136bp.Swimming lane 2 is TaKaRaDL-2000 molecular weight markers, and white ribbon length from top to bottom is respectively 2000bp, 1000bp, 750bp, 500bp, 250bp, 100bp.
Fig. 4 is that the partial peptide detection of nucleic acids probe hybridization of partial fixing on the aldehyde radical slide is after laser confocal scanning instrument Scanarray4000 (laser intensity is 80, and the PMT gain is 80) scanning result figure.
Three points of last row are respectively scanning result behind the wild probe hybridization in 1896,1762 and 1764 associating sites, 1,862 three sites.Three points of following row are to put scanning result after the hybridization of corresponding mutant probe with last ranking.According to the power of fluorescent signal, can conclude not undergo mutation in 1896 and 1862 sites of test sample, undergo mutation in 1762 and 1764 associating sites.
Five, embodiment
Embodiment 1: structure as shown in Figure 1:
Array is evenly distributed with the some coating 2 of peptide nucleic acid probe and contrast on substrate 1, wherein contains 24 detection probes in the preceding C district of hepatitis B and known mutations site, S district and wild site, 2 positive control probes, 1 negative control probe and the contrast of blank sampling liquid.Positive probe all be positioned at array around, it is not only the effect of positive control, can be used as positive signal simultaneously, the location array.Hepatitis B DNA sample P CR amplified production behind the in-vitro transcription mark with the peptide nucleic acid(PNA) hybridization array, obtain a result by laser confocal scanning instrument scanning, and analyze and judge.
Embodiment 2: the modification of slide and peptide nucleic acid probe fixing
1, the modification of slide
The blank glass slide glass is cleaned with 10%NaOH, wash with the 1%HCI acid solution, the washing back dries, and promptly obtains clean glass nude film.With handling 30 minutes in 95% acetone soln of 1%3-TSL 8330, clean 3 times with acetone then, each 5 minutes, 80 ℃ were toasted the amination slide that obtains 15 minutes.Continue to handle 30 minutes, clean with distilled water then, obtain the slide of aldehyde radical modification after the vacuum-drying with 10% glutaraldehyde water solution.
2, fixing (is example with the aldehyde radical slide) of peptide nucleic acid(PNA) detection probes
The design and the selection of peptide nucleic acid(PNA) detection probes are shown in Table 1.
Peptide nucleic acid(PNA) detection probes fixing on the aldehyde radical slide is with saturated NaHCO
3Solution is as sampling liquid.The peptide nucleic acid(PNA) detection probe concentrations is 50 μ M, puts (the peptide nucleic acid(PNA) detection probes is seen accompanying drawing 2 at on-chip distribution plan) on the corresponding slide through point sample instrument, and spot diameter is 100 μ m, and dot spacing is 300 μ m.The size of peptide nucleic acid(PNA) array is 1.6mm * 1.6mm.The peptide nucleic acid(PNA) chip that obtains behind the point sample is put in the wet box 37 ℃ of hydrations 2 hours.Carry out following processing then:
1) slide is cleaned twice with 0.2% SDS solution, each 5 minutes, to remove unconjugated peptide nucleic acid(PNA).
2) slide is dipped in cleans twice in the pure water, each 5 minutes.
3) slide was handled 5 minutes with 0.26% sodium borohydride solution (phosphoric acid salt with 75%, 25% ethanolic soln configuration), sealed unreacted aldehyde radical.
4) with slide with 0.2% SDS solution-treated 3 times, each 1 minute.
5) pure water that slide is handled with diethylpyrocarbonate (DEPC) cleans twice, each 1 minute.
6) use dull and stereotyped whizzer, 800rpm 10 minutes dries slide, uses with hybridization.
Embodiment 3: the extraction of hepatitis B sample DNA, pcr amplification and mark
1, the extraction of hepatitis B sample DNA
1) get 100 μ l hepatitis B serum, and the lysate of 3 times of volumes of adding (4M guanidine thiocyanate, mercaptoethanol, 0.1MTris-CI, pH7.5), mixing.
2) add isopyknic chloroform, primary isoamyl alcohol solution (24: 1), fully mixing.12000rpm is centrifugal 15 minutes under the room temperature.
3) carefully supernatant liquor is moved in another 1.5ml centrifuge tube, add the dehydrated alcohol of 2 times of volumes.Placed 2 hours for-20 ℃.4 ℃, centrifugal 15 minutes of 12000rpm.
4) gained precipitation in centrifugal back is with 70% ethanol cleaning 2 times, at every turn at 4 ℃, and centrifugal 10 minutes of 12000rpm.
5) be dissolved in the 16 μ l pure water after the precipitation seasoning.
2, segmental amplification of PCR purpose and purifying
1) the pcr amplification system is 25 μ l, comprising
10 * PCR damping fluid, 2.5 μ l
2mM dNTP 2.5μl
Upstream primer (5 μ M) 2.0 μ l
Downstream primer (5 μ M) 2.0 μ l
Taq archaeal dna polymerase (5u/ μ l) 0.25 μ l
Hepatitis B DNA 16.0 μ l
25.0μl
Wherein the composition of 10 * PCR damping fluid is 500mM Tris-CI (pH8.3), 20mM MgCI
2, 0.75% bovine serum albumin.
2) pcr amplification adopts MJ Research PTC-225PCR amplification instrument, and program is
94 ℃ of 1 circulations in 1.5 minutes
94 ℃ 20 seconds, 55 ℃ 20 seconds, 72 ℃ 35 circulations altogether in 2.5 minutes
72 ℃ of 1 circulations in 8 minutes
3) get 5 μ l PCR products, agarose gel electrophoresis detected result with 0.8%.As shown in Figure 3.
4) purifying of PCR product adopts glass milk purifying.
3, the in-vitro transcription fluorescent mark of PCR product
Adopt Promega company's T 3 transcript reagent boxes, the in-vitro transcription reaction system is 10 μ l, and Cy3-UTP purchases in peace. Pharmacia (Amersham Phamacia) company.Concrete steps are as follows
1) the T3 responsive transcription comprises
T35 * transcribe damping fluid 2 μ l
The ATP of 100mM, CTP, each 0.75 μ l of GTP
The UTP 0.5 μ l of 100mM
100mM Cy3-UTP， 0.25μl
PCR purified product 4 μ l (5-50ng)
10μl
2) with the reaction mixture mixing, 37 ℃ of incubations 1 hour.
3) RNA that obtains of in-vitro transcription makes it to be dissolved in the MgCI of 30mM through adjusting concentration
2Solution, thus the RNA that obtained fragmentation in 30 minutes hatched in 94 ℃.
Embodiment 4: the hybridization of peptide nucleic acid(PNA) array and detection, signal analysis
1. the hybridization of peptide nucleic acid(PNA) array
1) RNA of 1 μ l fragmentation mark is diluted to 10 μ l be preheating in advance hybridization temperature in the peptide nucleic acid(PNA) hybridization solution that DEPC handled (the phosphate buffered saline buffer pH7.0 of 10mM includes 0.1mMNaCI, 5mMEDTA, 0.1%SDS), mixing.
2) above-mentioned fluorescently-labeled RNA sample is dripped to the central authorities of peptide nucleic acid(PNA) chip probe region, in the array region covered.
3) this slide is put into the wet box (purchasing Sigma company) that is preheating to hybridization temperature, fills pure water, to avoid the array drying in Sigma.
4) slide is placed hybrid heater, hybridization temperature is 75 ℃, and the time is 1.5 hours.
5) phosphate buffered saline buffer of handling through DEPC of slide being put into 10mM after hybridization finishes cleaned 5 minutes.
6) put into the phosphate buffered saline buffer of handling through DEPC 2 times of 5mM then.Each 5 minutes.
7) at room temperature, use dull and stereotyped whizzer under 800rpm centrifugal 5 minutes, slide is dried.
2. the detection of peptide nucleic acid(PNA) array and interpretation of result
Peptide nucleic acid(PNA) chip after the hybridization is through the array region at laser confocal scanning instrument ScanArray4000 scan-probe place and collect signal, analyzing and testing result.Scanning result shows: negative control and the no fluorescent signal of sampling liquid contrast, positive control has fluorescent signal, distinguishes the generation whether this site has sudden change according to the corresponding fluorescent signal power normal and mutant probe of contrast.Accompanying drawing 4 is that preceding C district 1896,1762 and 1764 associating sites, 1,862 three sites amount to 6 peptide nucleic acid probe hybridization after the figure as a result after the laser confocal scanning instrument Scanarray4000 scanning (laser intensity is 80, and the PMT gain is 80).Three points of last row are respectively scanning results behind the wild probe hybridization in 1896,1762 and 1764 associating sites, 1,862 three sites.Three points of following row are to put scanning result after the hybridization of corresponding mutant probe with last ranking.According to the power of fluorescent signal, can conclude not undergo mutation in 1896 and 1862 sites of test sample, 1762 and 1764 sites are united by original 1762A, 1764G and are sported 1762T, 1764A.
Embodiment 5: be the peptide nucleic acid(PNA) detection chip in the hepatitis B virus mutational site of substrate with one of glass nude film, amination slide or nylon membrane
With one of glass nude film, amination slide or nylon membrane is the peptide nucleic acid(PNA) detection chip in the hepatitis B virus mutational site of substrate, the modification of the preparation of glass nude film and amination slide such as embodiment 2 step 1 slides.Amination and the phosphate buffered saline buffer (0.1mMNaCI, 5mMEDTA, 0.1%SDS) of 10mM that adopts hybridization solution pH7.0 without the nude film of chemically modified, nylon membrane are as sampling liquid.The peptide nucleic acid(PNA) detection probe concentrations is 50 μ M, puts (the peptide nucleic acid(PNA) detection probes is seen accompanying drawing 2 at on-chip distribution plan) on the corresponding slide through point sample instrument, and spot diameter is 100 μ m, and dot spacing is 300 μ m.The size of peptide nucleic acid(PNA) array is 1.6mm * 1.6mm.Glass nude film behind the point sample, amination slide or nylon membrane can be directly used in hybridization after UV-crosslinked 5 minutes.The extraction of hepatitis B sample DNA, pcr amplification and mark are with embodiment 3, and embodiment 4 is seen in the hybridization of peptide nucleic acid(PNA) array and detection, signal analysis.
Sequence table
＜110〉Shandong Provincial Pharmaceutical Biological Tech. Research Center
＜120〉sequence table sample (the peptide nucleic acid(PNA) detection chip in hepatitis B virus mutational site and preparation method thereof)
<140>021356262
<141>2002-10-14
<160>27
<170>PatentIn Version 2.1
<210>1
<211>17
<212>PNA
＜213〉hepatitis B virus (Orthohepadnavirus, Hepatitis B Virus)
<220>
<221>misc_feature
<222>(1)…(17)
＜223〉aminoterminal is connected with O-connexon (8-amino-3,6-dioxaoctanoic acid)
<400>1
agttccttgg agataca 17
<210>2
<211>17
<212>PNA
＜213〉hepatitis B virus (Orthohepadnavirus, Hepatitis B Virus)
<220>
<221>misc_feature
<222>(1)…(17)
＜223〉aminoterminal is connected with O-connexon (8-amino-3,6-dioxaoctanoic acid)
<400>2
agttccttag agataca 17
<210>3
<211>17
<212>PNA
＜213〉hepatitis B virus (Orthohepadnavirus, Hepatitis B Virus)
<220>
<221>misc_feature
<222>(1)…(17)
＜223〉aminoterminal is connected with O-connexon (8-amino-3,6-dioxaoctanoic acid)
<400>3
cttggagata caaaggg 17
<210>4
<211>17
<212>PNA
＜213〉hepatitis B virus (Orthohepadnavirus, Hepatitis B Virus)
<220>
<221>misc_feature
<222>(1)…(17)
＜223〉aminoterminal is connected with O-connexon (8-amino-3,6-dioxaoctanoic acid)
<400>4
cttggagaca caaaggg 17
<210>5
<211>17
<212>PNA
＜213〉hepatitis B virus (Orthohepadnavirus, Hepatitis B Virus)
<220>
<221>misc_feature
<222>(1)…(17)
＜223〉aminoterminal is connected with O-connexon (8-amino-3,6-dioxaoctanoic acid)
<400>5
ttggagatac aaaggga 17
<210>6
<211>17
<212>PNA
＜213〉hepatitis B virus (Orthohepadnavirus, Hepatitis B Virus)
<220>
<221>misc_feature
<222>(1)…(17)
＜223〉aminoterminal is connected with O-connexon (8-amino-3,6-dioxaoctanoic acid)
<400>6
ttggagatgc aaaggga 17
<210>7
<211>15
<212>PNA
＜213〉hepatitis B virus (Orthohepadnavirus, Hepatitis B Virus)
<220>
<221>misc_feature
<222>(1)…(15)
＜223〉aminoterminal is connected with O-connexon (8-amino-3,6-dioxaoctanoic acid)
<400>7
ggaagcctgc ctttg 15
<210>8
<211>15
<212>PNA
＜213〉hepatitis B virus (Orthohepadnavirus, Hepatitis B Virus)
<220>
<221>misc_feature
<222>(1)…(15)
＜223〉aminoterminal is connected with O-connexon (8-amino-3,6-dioxaoctanoic acid)
<400>8
ggaagccggc ctttg 15
<210>9
<211>15
<212>PNA
＜213〉hepatitis B virus (Orthohepadnavirus, Hepatitis B Virus)
<220>
<221>misc_feature
<222>(1)…(15)
＜223〉aminoterminal is connected with O-connexon (8-amino-3,6-dioxaoctanoic acid)
<400>9
aagcctgcct ttgac 15
<210>10
<211>15
<212>PNA
＜213〉hepatitis B virus (Orthohepadnavirus, Hepatitis B Virus)
<220>
<221>misc_feature
<222>(1)…(15)
＜223〉aminoterminal is connected with O-connexon (8-amino-3,6-dioxaoctanoic acid)
<400>10
aagcctgtct ttgac 15
<210>11
<211>18
<212>PNA
＜213〉hepatitis B virus (Orthohepadnavirus, Hepatitis B Virus)
<220>
<221>misc_feature
<222>(1)…(18)
＜223〉aminoterminal is connected with O-connexon (8-amino-3,6-dioxaoctanoic acid)
<400>11
atccaatttc cagaaaca 18
<210>12
<211>18
<212>PNA
＜213〉hepatitis B virus (Orthohepadnavirus, Hepatitis B Virus)
<220>
<221>misc_feature
<222>(1)…(18)
＜223〉aminoterminal is connected with O-connexon (8-amino-3,6-dioxaoctanoic acid)
<400>12
atccaattac tagaaaca 18
<210>13
<211>16
<212>PNA
＜213〉hepatitis B virus (Orthohepadnavirus, Hepatitis B Virus)
<220>
<221>misc_feature
<222>(1)…(16)
＜223〉aminoterminal is connected with O-connexon (8-amino-3,6-dioxaoctanoic acid)
<400>13
agtacaggat gacaag 16
<210>14
<211>16
<212>PNA
＜213〉hepatitis B virus (Orthohepadnavirus, Hepatitis B Virus)
<220>
<221>misc_feature
<222>(1)…(16)
＜223〉aminoterminal is connected with O-connexon (8-amino-3,6-dioxaoctanoic acid)
<400>14
agtacagggt gacaag 16
<210>15
<211>16
<212>PNA
＜213〉hepatitis B virus (Orthohepadnavirus, Hepatitis B Virus)
<220>
<221>misc_feature
<222>(1)…(16)
＜223〉aminoterminal is connected with O-connexon (8-amino-3,6-dioxaoctanoic acid)
<400>15
caggatgaca agttcg 16
<210>16
<211>16
<212>PNA
＜213〉hepatitis B virus (Orthohepadnavirus, Hepatitis B Virus)
<220>
<221>misc_feature
<222>(1)…(16)
＜223〉aminoterminal is connected with O-connexon (8-amino-3,6-dioxaoctanoic acid)
<400>16
caggatgaaa agttcg 16
<210>17
<211>15
<212>PNA
＜213〉hepatitis B virus (Orthohepadnavirus, Hepatitis B Virus)
<220>
<221>misc_feature
<222>(1)…(15)
＜223〉aminoterminal is connected with O-connexon (8-amino-3,6-dioxaoctanoic acid)
<400>17
accgaaaccc cgtac 15
<210>18
<211>15
<212>PNA
＜213〉hepatitis B virus (Orthohepadnavirus, Hepatitis B Virus)
<220>
<221>misc_feature
<222>(1)…(15)
＜223〉aminoterminal is connected with O-connexon (8-amino-3,6-dioxaoctanoic acid)
<400>18
accgaaatcc cgtac 15
<210>19
<211>14
<212>PNA
＜213〉hepatitis B virus (Orthohepadnavirus, Hepatitis B Virus)
<220>
<221>misc_feature
<222>(1)…(14)
＜223〉aminoterminal is connected with O-connexon (8-amino-3,6-dioxaoctanoic acid)
<400>19
cgaaaccccg tacc 14
<210>20
<211>14
<212>PNA
＜213〉hepatitis B virus (Orthohepadnavirus, Hepatitis B Virus)
<220>
<221>misc_feature
<222>(1)…(14)
＜223〉aminoterminal is connected with O-connexon (8-amino-3,6-dioxaoctanoic acid)
<400>20
cgaaacctcg tacc 14
<210>21
<211>15
<212>PNA
＜213〉hepatitis B virus (Orthohepadnavirus, Hepatitis B Virus)
<220>
<221>misc_feature
<222>(1)…(15)
＜223〉aminoterminal is connected with O-connexon (8-amino-3,6-dioxaoctanoic acid)
<400>21
gaaaccccgt acctg 15
<210>22
<211>15
<212>PNA
＜213〉hepatitis B virus (Orthohepadnavirus, Hepatitis B Virus)
<220>
<221>misc_feature
<222>(1)…(15)
＜223〉aminoterminal is connected with O-connexon (8-amino-3,6-dioxaoctanoic acid)
<400>22
gaaaccctgt acctg 15
<210>23
<211>15
<212>PNA
＜213〉hepatitis B virus (Orthohepadnavirus, Hepatitis B Virus)
<220>
<221>misc_feature
<222>(1)…(15)
＜223〉aminoterminal is connected with O-connexon (8-amino-3,6-dioxaoctanoic acid)
<400>23
aaccccgcac ctgta 15
<210>24
<211>15
<212>PNA
＜213〉hepatitis B virus (Orthohepadnavirus, Hepatitis B Virus)
<220>
<221>misc_feature
<222>(1)…(15)
＜223〉aminoterminal is connected with O-connexon (8-amino-3,6-dioxaoctanoic acid)
<400>24
aaccccgtac ctgta 15
<210>25
<211>15
<212>PNA
＜213〉hepatitis B virus (Orthohepadnavirus, Hepatitis B Virus)
<220>
<221>misc_feature
<222>(1)…(15)
＜223〉aminoterminal is connected with O-connexon (8-amino-3,6-dioxaoctanoic acid)
<400>25
acataagggt agggt 15
<210>26
<211>15
<212>PNA
＜213〉hepatitis B virus (Orthohepadnavirus, Hepatitis B Virus)
<220>
<221>misc_feature
<222>(1)…(15)
＜223〉aminoterminal is connected with O-connexon (8-amino-3,6-dioxaoctanoic acid)
<400>26
cctccgacat ccgta 15
<210>27
<211>17
<212>PNA
＜213〉hepatitis B virus (Orthohepadnavirus, Hepatitis B Virus)
<220>
<221>misc_feature
<222>(1)…(17)
＜223〉aminoterminal is connected with O-connexon (8-amino-3,6-dioxaoctanoic acid)
<400>27
agaaccatgt caacgag 17
Claims (5)
1. the peptide nucleic acid(PNA) detection chip in a hepatitis B virus mutational site, comprise the peptide nucleic acid probe of substrate and array distribution and the some coating of contrast, described substrate is a glass substrate, one of nylon membrane, it is characterized in that, described substrate is the glass nude film without any modification, one of aldehyde radical sheet glass and amination slide, the coating of selecting of described peptide nucleic acid probe and contrast is meant on substrate equally distributed, 24 peptide nucleic acid(PNA) detection probes that comprise the preceding core antigenic region (preceding C district) of hepatitis B and (S district) known mutations site, surface antigen district and wild site, article 2, positive peptide nucleic acid probe, article 1, negative probe and blank sampling liquid contrast, wherein, the sequential structure of described 24 peptide nucleic acid(PNA) detection probes is respectively
The S1:ACATAGAGGTTCCTTGA-O-connexon, the S2:ACATAGAGATTCCTTGA-O-connexon,
The S3:GGGAAACATAGAGGTTC-O-connexon, the S4:GGGAAACACAGAGGTTC-O-connexon,
The S5:AGGGAAACATAGAGGTT-O-connexon, the S6:AGGGAAACGTAGAGGTT-O-connexon,
The S7:GTTTCCGTCCGAAGG-O-connexon, the S8:GTTTCCGGCCGAAGG-O-connexon,
The S9:CAGTTTCCGTCCGAA-O-connexon, the S10:CAGTTTCTGTCCGAA-O-connexon,
The C1:ACAAAGACCTTTAACCTA-O-connexon, the C2:ACAAAGATCATTAACCTA-O-connexon,
The C3:GAACAGTAGGACATGA-O-connexon, the C4:GAACAGTGGGACATGA-O-connexon,
The C5:GCTTGAACAGTAGGAC-O-connexon, the C6:GCTTGAAAAGTAGGAC-O-connexon,
The C7:CATGCCCCAAAGCCA-O-connexon, the C8:CATGCCCTAAAGCCA-O-connexon,
The C9:CCATGCCCCAAAGC-O-connexon, the C10:CCATGCTCCAAAGC-O-connexon,
The C11:GTCCATGCCCCAAAG-O-connexon, the C12:GTCCATGTCCCAAAG-O-connexon,
The C13:ATGTCCACGCCCCAA-O-connexon, the C14:ATGTCCATGCCCCAA-O-connexon;
The sequential structure of described 2 positive peptide nucleic acid probes is PCS:TGGGATGGGAATACA-O-connexon, PCC:ATGCCTACAGCCTCC-O-connexon respectively;
The sequential structure of described negative probe is the NC:GAGCAACTGTACCAAGA-O-connexon;
The size of the some coating of described peptide nucleic acid(PNA) detection probes and contrast is: when spot diameter is 100 μ m, when dot spacing was 300 μ m, the size of peptide nucleic acid(PNA) array was 1.6mm * 1.6mm.
2. the peptide nucleic acid(PNA) detection chip in hepatitis B virus as claimed in claim 1 mutational site, it is characterized in that, in described 24 peptide nucleic acid(PNA) detection probes, comprise 12 mutational site peptide nucleic acid(PNA) detection probes and 12 wild site peptide nucleic acid(PNA) detection probes, wherein, the mutational site comprises known 5 mutational sites, S district, is respectively: 546C-T, 551A-G, 552T-C, 585A-C, 587G-A; With 7 known mutational sites, preceding C district, be respectively: 1896G-A, 1762A-T and 1764G-A unite sudden change, 1858C-T, 1862G-T, 1898G-A, 1899G-A, 1901G-A.
3. the peptide nucleic acid(PNA) detection chip in hepatitis B virus as claimed in claim 1 or 2 mutational site, it is characterized in that, described peptide nucleic acid(PNA) detection probes and positive peptide nucleic acid probe are that length is the peptide nucleic acid(PNA) of 14-18mer, all design at the hepatitis B DNA antisense strand, its N-terminal is connected with the O-connexon, corresponding 3 ' end of DNA chain.
4. the peptide nucleic acid(PNA) detection chip in hepatitis B virus as claimed in claim 3 mutational site is characterized in that, described positive peptide nucleic acid probe is positioned at the hepatitis B DNA antisense strand, is the nucleic acid conserved sequence in C district before the hepatitis B or S district.
5. the peptide nucleic acid(PNA) detection chip in hepatitis B virus as claimed in claim 1 mutational site is characterized in that, the peptide nucleic acid sequence of the 17mer in the described negative peptide nucleic acid probe behaviour ATM gene.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 02135626 CN1236070C (en) | 2002-10-14 | 2002-10-14 | Peptide nucleic acid chip for detecting muatatonal site of hepatitis B virus and its preparing method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 02135626 CN1236070C (en) | 2002-10-14 | 2002-10-14 | Peptide nucleic acid chip for detecting muatatonal site of hepatitis B virus and its preparing method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1431318A CN1431318A (en) | 2003-07-23 |
| CN1236070C true CN1236070C (en) | 2006-01-11 |
Family
ID=4748283
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 02135626 Expired - Fee Related CN1236070C (en) | 2002-10-14 | 2002-10-14 | Peptide nucleic acid chip for detecting muatatonal site of hepatitis B virus and its preparing method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1236070C (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN100339488C (en) * | 2004-12-07 | 2007-09-26 | 中山大学达安基因股份有限公司 | Detection method of hepatitis B virus genome drug resistance mutation |
| WO2020072843A1 (en) * | 2018-10-05 | 2020-04-09 | Dots Technology Corp. | Systems and methods for allergen detection |
-
2002
- 2002-10-14 CN CN 02135626 patent/CN1236070C/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN1431318A (en) | 2003-07-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1197962C (en) | Thermal stable DNA polyase for detecting change of frequency | |
| CN1034673C (en) | Method of detecting nucleotide sequences | |
| CN1198943C (en) | Method for characterisation of nucleic acid molecules involving generation of extendable upstream DNA fragments resulting from the cleavage of nucleic acid of an abasic site | |
| CN1711357A (en) | One step real-time RT PCR kits for the universal detection of organisms in industrial products | |
| CN1589331A (en) | Diagnostic probe detection system | |
| CN100351393C (en) | Method of detecting nucleotide polymorphism | |
| CN1156587C (en) | Chinese dendrobe plant and its medicinal materials DNA molecular diagnosis method | |
| CN1687454A (en) | Method for sceening viral nucleic acid of blood through isothermal amplification based on loop mediated technique | |
| CN100345980C (en) | PCR primer set for detecting hepatitis b virus, method for detecting hepatitis b using the primer set, and hepatitis b virus detection kit including the primer set | |
| CN101048515A (en) | Nucleic acid analysis method | |
| CN1169824C (en) | Polytype gene of MXA protein and application thereof | |
| CN1748028A (en) | Signal amplification method for detecting mutant gene | |
| CN1616676A (en) | Stable hybrid | |
| CN1798842A (en) | Nucleic acid detection | |
| CN1813064A (en) | Method of detecting SARS coronavirus | |
| CN1537954A (en) | Expressing genetic analysis method and probe reagent box for expressing genetic analysng | |
| CN1697883A (en) | Method of detecting target nucleotide sequence, detection target structure to be used in embodying the method, process for producing the same and assay kit for detecting target nucleotide sequence | |
| CN1236070C (en) | Peptide nucleic acid chip for detecting muatatonal site of hepatitis B virus and its preparing method | |
| CN1205340C (en) | Transgenic agricultural product detection kit | |
| CN1152139C (en) | Method of genetic varietal differentiation of hop | |
| CN1727497A (en) | Gene chip for detecting B group of streptococcus, detection method and kit for detection | |
| CN1173989C (en) | DNA sequence of dendrobium and method for discriminating its veriety and judging if it is true or false | |
| CN1276094C (en) | DNA chip for diagnosing Mediterranean anemia and its prepn | |
| CN1186457C (en) | Homogeneous genetic matrix | |
| CN100351374C (en) | Oligonucleotides for detecting tubercle bacillus and method therefor |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20060111 Termination date: 20121014 |