CN1204259C - Production process of human lysozyme as AIDS treating medicine with plant as bioreactor - Google Patents

Abstract

The present invention provides a method for producing human lysozyme by using a plant as a bioreactor, which has the steps that a human lysozyme gene is cloned in a human placenta, and the human lysozyme gene is constructed in a prokaryotic expression vector and is effectively expressed in pronucleus; then, a plant expression vector is constructed and is successfully introduced into an asparagus lettuce (lettuce) kernel genome; the human lysozyme gene can be expressed in advanced plants, and asparagus lettuce containing the human lysozyme is obtained. The lysozyme produced in large scale in the method can be used for treating AIDS, tumors, virus diseases, etc.

Description

A kind of medicinal recombinant human N,O-Diacetylmuramidase fusion gene and obtain the method for this pharmaceutical protein

1. technical field:

The present invention relates to a kind of proteinic preparation method.Specifically relate to produce for " bio-reactor " human lysozyme protein's method with plant.

2. background technology:

Acquired immune deficiency syndrome (AIDS) (AIDS, acquired immunodeficiency syndrome) is by human immunodeficiency virus (HIV, human immunodeficiency virus), the just caused transmissible disease of hiv virus.Hiv virus will pass through the several years after entering human body, even reaches 10 years or just morbidity after longer latent period.Hiv virus havoc immune function of human body, patient is because of the ability of the resist the disease multiple disease of superinfection that extremely descends, as zoster, Fungi Infection of Oral, pulmonary tuberculosis, the enteritis that the specific disease pathogenic microorganism causes, pneumonia, encephalitis and other infection, malignant tumour usually takes place in the later stage.Finally because of muscle power consumes for a long time, whole body dies of exhaustion and dies.According to statistics, by the present fashion trend of acquired immune deficiency syndrome (AIDS), increase 16000 routine HIV the infecteds every day newly, wherein 90% new the infected is in developing country, estimate the next year ends ten, the number of patients of global acquired immune deficiency syndrome (AIDS) is about to break through 100,000,000, and China will enter the acquired immune deficiency syndrome (AIDS) high-incidence season at 10-15 from now on.The acquired immune deficiency syndrome (AIDS) that is called as " contemporary pestilence and super cancer " has caused the great attention of The World Health Organization (WHO) and national governments, no matter is that the input of personnel and funds is all put in the first place; China has listed it in the Class B Notifiable disease, and is one of border monitoring of hygiene transmissible disease.Owing to also do not treat the specifics of acquired immune deficiency syndrome (AIDS) so far, not can be used for the effective vaccine that prevents yet.In case morbidity, under the current medical condition of China, the patient can be dead in the not long time.So at present acquired immune deficiency syndrome (AIDS) still is a kind of case fatality rate up to 100% very serious transmissible disease (Chen Shengxi, external medical microbiotic fascicle, 2000,23 (4): 155-157.).

Treatment for acquired immune deficiency syndrome (AIDS), at drug treatment, the first kind is an efabirenz, existing 6 kinds: zidovudine, didanosine, zalcitabine, stavudine, lamivudine and Abacavir, such medicine can combine with reversed transcriptive enzyme competitively with deoxynucleoside, thereby suppresses duplicating of HIV; Second class is a non-nucleoside reverse transcriptase inhibitor, can mainly contain nevirapine, Delavirdine and Efavirenz (Adkins JC et al.1998 by combining the activity that suppresses hiv reverse transcriptase with the non-substrate binding site of reversed transcriptive enzyme; Chen Sheng former times, external medical microbiotic fascicle, 2000,23 (4): 155-157.); The 3rd class is the HIV hydrolase inhibitor, can suppress the active of HIV lytic enzyme fully or the activity of this enzyme is dropped to extremely low level, thereby the wrapping process that suppresses virus, mainly contain Saquinavir, ritonavir, Indinavir, Nelfinavir, Amprenavir and Lopinayir (Noble S, Goa KL, Drugs, 2000,60 (6): 1383-1385.; Chen Sheng former times, external medical microbiotic fascicle, 2000,23 (4): 155-157.).Aspect the HIV virus vaccines, ALVAC vaccine, gp120 vaccine, HIV dna vaccination and HIV living vaccine (Peters BS, Antivir ChemChemother, 2000,11 (5): 311-313. have been developed; O ' Hagan D et al., 2001; Rose NF etal., 2001; Re MC et al., 2001).At present in the world to the treatment plan trend combination therapy (drug cocktail therapy (treatment)) of acquired immune deficiency syndrome (AIDS), but existing medicine is difficult to eradicate to intravital HIV virus, so in case infected by HIV need take medicine all the life.And anti-AIDS drug not only costs an arm and a leg at present, make that general patient is unable to be born, more be difficult to promote in developing country, and easily cause allergic reaction, untoward reaction such as pancreatitis, lesions of liver and kidney, steatosis and nervous system lesion, excessive and the long-time medication of dosage can make untoward reaction increase, even causes death.And on the other hand, because HIV virus very easily makes a variation, lack and the on all four immune animal model of human AIDS pathogenesis in addition, make the research and the clinical verification of HIV virus vaccines be restricted, so far also can really be applied to clinical (Wei Wenqing without any a HIV virus vaccines, external medicine and pharmacology pharmacy fascicle, 2001,28 (5): 294-297.).So that people are continuing to seek is cheap, anti-AIDS drug safely and effectively always.

In March, 1999, people's such as the professor Li Xiaofeng of department of biochemistry of medical college of New York University the mankind's research group finds: N,O-Diacetylmuramidase, this tears that are present in the pregnant woman in a large number that are widely known by the people and the protein in the urine are a kind of effective anti-HIV materials.This achievement provides new direction for present acquired immune deficiency syndrome (AIDS) research, and it has explained why to kiss and shake hands and can not infect acquired immune deficiency syndrome (AIDS) that the mother who catches acquired immune deficiency syndrome (AIDS) not necessarily can give this doubt of fetus with viral communication.Simultaneously, this breakthrough has also disclosed the new function of human body protein, for the treatment acquired immune deficiency syndrome (AIDS) provides new approach (Lee-Huang S, et al., Proc Natl Acad Sci USA, 1999,96 (6): 2678-2681.).Studies show that subsequently, N,O-Diacetylmuramidase can with intravital DNA and RNA combination, confirmed that N,O-Diacetylmuramidase can be used as " killer protein " of anti-AIDS (Steinrauf LK, Biochem Biophys Res Commun, 1999,266 (2): 366-370.).

N,O-Diacetylmuramidase (Lysozyme) international numbering is E3.2.1.17., formally name and be N-acetylhexosamine enzyme (N-acetylhexosaminodase), belong to muramidase (muramidase), claim N-acetylmuramide glycanohydrla (N-acetylmuramic glycanchydrolase) again.It finds that by Britain cytologist Fu Laiming (Alexander Fleming) nineteen thirty-seven Abrabam separates, makes crystal in nineteen twenty-two from egg white first in the nose mucus.N,O-Diacetylmuramidase extensively is present in various microorganisms, protozoon, people and the animal and plant tissue of occurring in nature.But the N,O-Diacetylmuramidase of different sources, its antimicrobial spectrum also is not quite similar.Tradition studies show that (Holer E et al., 1975; Valerie AP, Cunningham FE, FoodScience and Nutrition, 1988,26 (4): 359-395.; Zhang Zongyan, 1995), N,O-Diacetylmuramidase is a kind of polypeptidase that can decompose mucopolysaccharide, can dissolve the cell walls of gram positive bacterium and have bacteriolysis, its reason be its can hydrolyzing N-acetylglucosamine and H-second junket teichoic acid between β-1,4 glycosidic link.This is the general basis of using of N,O-Diacetylmuramidase, also is the reason that it is gained the name.

At present, N,O-Diacetylmuramidase has very high practical value clinically in medical treatment.Can with germ or viral combination the in the blood, and have antibiotic, antiviral, hemostasis, detumescence and accelerate effect such as organized renewing function.Can be used for the treatment of chronic rhinitis, acute, chronic throat, stomatocace, varicella, zoster and verruca plana etc. clinically.Preventing dental caries also there is certain effect.N,O-Diacetylmuramidase still is the intravital non-specific immunity factor of people, can improve the immunizing power of human body, and with the natural defense factor of other cationic antibacterial peptide classes good synergy is arranged.The antineoplastic pharmacological experiments of relevant N,O-Diacetylmuramidase shows that N,O-Diacetylmuramidase can be used as a kind of stronger immune-regulating factor and is used for prevention and treatment malignant tumour, even the malignant tumour patients with terminal is still had certain curative effect (Zhang Yun's ripple etc., 2001).

Biological characteristics according to human lysozyme, with human lysozyme as anti-AIDS drug, compare with the traditional anti-AIDS drug of present listing, following advantage is arranged: 1. human lysozyme has multiple drug effects such as antibiotic, antiviral, antitumor, has certain advantage at the disease of immune system of this class complexity of acquired immune deficiency syndrome (AIDS).2. Ren Lei secretory product has become the jinx of acquired immune deficiency syndrome (AIDS) cause of disease, and the medicine of making just unlikely produces the side effect of antibody, and this is more effective to treatment of AIDS.3. human lysozyme is the human body natural product, does not produce resistance, can solve the resistance difficult problem that microbiotic brings.4. human lysozyme itself is a kind of natural protein, and safety non-toxic easily is absorbed by the body, and is not residual in vivo.

But, still there is not suitability for industrialized production at present in the world because of human lysozyme source difficulty.Utilize plant as reactor, produce human lysozyme and be used as anti-AIDS drug, do not see domestic and international report so far.

And the fast development of plant genetic engineering, for the large-scale industrial production of human lysozyme is had laid a good foundation.In the world, a new development trend of plant genetic engineering research utilizes transgenic plant to produce medicine exactly, by the gene transfered plant of the coding active polypeptide of reorganization, utilizes plant as reactor, produces these pharmaceutical proteins in a large number.In numerous expression system such as bacterium, fungi, mammalian cell, insect cell, transgenic animal and plant, transgenic plant have the advantage of himself as emerging bio-reactor.

At first transgenic plant carry out its output height of production of foreign protein as bio-reactor.Test the result demonstration of each expression system to 130 kinds of proteic expressions, the expressing quantity that foreign gene produces in transgenic plant can reach the 4-5% of soluble proteins.

Secondly, the process of utilizing transgenic plant to produce as bio-reactor is simple, quick, flexible, cost is low.This point is very favorable for large-scale commercial applications production.Especially can reduce the production cost of high at present AIDS drug.Transgenic plant are exactly a plant bioreactor.And the agricultural infrastructure that can utilize an existing cover to cultivate, gather in the crops, process, store.

Three, another outstanding advantage of utilizing transgenic plant to produce some industry and medical protein results that are vegetable material, long storage and transportation are very convenient, and especially seed storage of plant and transportation are basically without any need for the management of complexity and monitoring.

Four, we know, proteinic 3-d modelling is determining proteic function.Because transgenic plant are eukaryotic expression systems, can carry out correct the transcribing, translate, process of gene, make foreign protein form normal 3-d modelling, thereby have guaranteed that proteic function is unaffected.

In a word, no matter, utilize plant bioreactor production AIDS drug albumen, all have incomparable advantage from the management and the security aspect of production cost, production.And as the representative of leaf vegetables, leaf accounts for the large percentage of complete stool with the blade of lettuce, its leaf can directly be eaten raw, utilize the lettuce transformed plant to come expression alien gene, its expression product not only can extract in a large number, and can be used by directly edible mode, this is very favourable to expressed AIDS drug albumen.

3, summary of the invention:

The present invention has obtained a kind of by human lysozyme gene (sequence is shown in SEQ ID NO:1) and green fluorescent protein (GFP, sequence is shown in SEQ ID NO:3) the fusion human lysozyme gene sequence (sequence is shown in SEQ ID NO:4) that obtains of gene series connection, and be built into prokaryotic expression carrier and the plant expression vector (seeing Fig. 1 and Fig. 2) that contains human lysozyme and GFP fusion gene.The human lysozyme fusion rotein that efficiently expresses and the lettuce that has transformed the human lysozyme fusion gene have been obtained.

The present invention also provides a kind of method of utilizing plant as reactor production human lysozyme, can be used for producing in a large number antitumor and AIDS resisting virus drugs.

Prokaryotic expression carrier and plant expression vector for making up Human Lysozyme cDNA and GFP fusion gene do not appear in the newspapers both at home and abroad as yet.

The plant expression vector of the Human Lysozyme cDNA (sequence is shown in SEQ IN NO 1) that the present invention is constructed, the human lysozyme gene is in plant nuclear strong promoter 35S downstream, and a Ω sequence that plays enhancement is arranged between 35S and this gene, can strengthen the genetic expression after the conversion.In constructed plant conversion carrier, comprised the expression cassette of selection markers expression of gene box and marker gene green fluorescence protein gene (GFP) simultaneously.The Agrobacterium that contains these two expression cassettes can and send green fluorescence in growth on the kantlex substratum under blue streak excites, and GFP gene itself is again the formal representation with a kind of fusion rotein, therefore, the genetic transformation that is used for plant as reporter gene safely and effectively is then more quick, and it can carry out the detection of transformed plant easily.The selection markers gene comes from the NPTII genes encoding neomycin phosphotransferase (Neomycin phosphtransferase) of bacterium, the ability that can give the anti-kantlex of cell, and this is a kind of selection markers commonly used in transforming.

4. description of drawings:

Fig. 1. the structure schema of human lysozyme gene and GFP gene fusion gene prokaryotic carrier

Fig. 2. the structure of human lysozyme gene and GFP gene fusion gene plant expression vector

H：HindIII；B：BamHI；N：NcoI；S：SalI；E：EcoRI；

5. embodiment:

Embodiment 1. expression of human lysozyme cDNA in intestinal bacteria

1, the structure of the coli expression carrier of human lysozyme cDNA:

(1) clone of N,O-Diacetylmuramidase cDNA: from people's placenta, extract total mRNA, carry out the RT-PCR reaction.Design primer (AudioCodes bio-engineering corporation in Beijing is synthetic) according to the disclosed lysozyme gene sequence of Genebank (HSU25677):

Primer 1:5 '-GCG GCTAGCATGAAGGCTCTCATTGTTCTG-3 '

Primer 2: 5 '-GCG CTCGAGGCTTACACTCCACAACCTTGA-3 '

Obtain the cDNA fragment of coding human lysozyme maturation protein.

(2) this human lysozyme maturation protein cDNA fragment is building up among the pET-28a (Novegon company product) that contains the Lac promotor: earlier the cDNA fragment of human lysozyme maturation protein is cut through Nco I/EcoR I enzyme, be connected into same in the colibacillus expression plasmid pET-28a that NcoI I/EcoR I enzyme is cut.

(3) recombinant vectors with above-mentioned connection adopts Calcium Chloride Method to import e. coli bl21 (available from Beijing ancient cooking vessel state biotech firm), screening recombinant conversion.(seeing Sambrook " molecular cloning " test direction)

(4) recombinant fragment to the clone checks order: order-checking adopts the two deoxidation cessation method of Sanger to carry out sequencing on ABI377 dna sequencing instrument, the cDNA fragment that obtains the coding human lysozyme maturation protein is 456 base pairs, concrete nucleotide sequence and is derived its amino acid sequence coded (SEQ ID NO 2) shown in SEQ ID NO 1.Thus, proved that the purpose fragment correctly inserts escherichia coli cloning expression plasmid pET-28a, with this plasmid vector called after pET-lyz; PET-lyz is cut with EcoR I/Sal I enzyme, GFP gene (the Genebank that cuts with same EcoR I/Sal I enzyme, Cloning vector pGreen A19 complete sequence.U56997, the efficient coding fragment of 2942 bpDNA circular, sequence is seen one of the information in SEQ ID NO 3 sequences sources) the PCR product connect, constitute another prokaryotic expression plasmid vector pET-lyzg (Fig. 1) of Human Lysozyme cDNA.

2, the abduction delivering of N,O-Diacetylmuramidase cDNA in intestinal bacteria:

1) conversion of expression plasmid: with prokaryotic expression carrier pET-lyz, pET-lyzg transformed into escherichia coli BL21D.

2) with connecing the mono-clonal reorganization bacterium colony that collarium picking from the flat board has transformed pET-lyz, pET-lyzg, be inoculated in 1ml and contain in the LB substratum of penbritin, put into the Tempeerature-constant air shaking table, 37 ℃ of shaking culture 12 hours.

3) draw the bacterium liquid 50 μ l of incubated overnight, be inoculated in the 5ml kantlex LB substratum, the inoculation ratio is that 1%, 37 ℃ of thermal agitation is cultivated, 2-4 hour, and make bacterium be in logarithmic growth mid-term, the OD600 value is about 0.6-1.0.

4) get 1ml from 5ml logarithmic phase bacterium liquid and do contrast, add 1mol/L IPTG solution 4 μ l in all the other 4ml bacterium liquid, making its ultimate density is 1mmol/L.

5) continue to cultivate 1-4 hour, got 1ml every 1 hour, the centrifugal 10min of 1000Xg gets supernatant and preserves stand-by respectively with precipitation.Last centrifugal results bacterium.

6) separation and purification albumen, use SDS-PAGE, (above each step is all with reference to Sambrook in Coomassie brilliant blue R-250 dyeing, " molecular cloning experiment guide " book carries out), identify the molecular weight and the expression level of expression product, the result shows that expression product is present in the born of the same parents with the form of inclusion body, induce the climax that reached expression amount in 3 hours, the expression of recombinant proteins level that pET-lyz, pET-lyzg express all accounts for about 20% of bacterial protein.Show that goal gene can realize efficiently expressing.

3. the separation and purification of human lysozyme and evaluation

(1) use the Histidine mark separation and purification of protein test kit of Novegon company to carry out separation and purification, the operation of step by specification.

(1) above-mentioned products therefrom dialyse according to a conventional method, lyophilize, obtain human lysozyme dry powder.

(2) 0.9% sodium-chlor dissolving human lysozyme dry powder is done Northern hybridization by " molecular cloning experiment guide " described method, and proving really is human lysozyme.

4. the activity of human lysozyme detects

Method with reference to Chen Fengzhen etc. detects (Guangdong silk communication, 1988 (3): the 35-42) recombinant protein of pET-lyz, pET-lyzg expression, substrate is the bacterium powder of the micrococcus lysodeikticus of Sigma company, make suspension liquid with the 0.1MPH6.2 phosphoric acid buffer, standard enzyme liquid is the hen egg white lysozyme (43000 units/mg albumen) of Sigma company, by formula antalzyme activity (U/mg)=OD450nm/ (0.001*mg enzyme/ml reaction solution) calculates antalzyme activity, recording average antalzyme activity is 41500 units/mg albumen, can be used for medicinal fully.

The structure of the plant expression vector of embodiment 2. human lysozyme genes

In the present embodiment, the gene of coding human lysozyme is connected plant nuclear strong promoter 35S downstream, and a Ω sequence that plays enhancement is arranged between 35S and this gene, can strengthen the genetic expression after the conversion.In constructed plant conversion carrier, comprised the expression cassette of selection markers expression of gene box and marker gene green fluorescence protein gene (GFP) simultaneously.

A, be used for the structure of particle gun plant transformed expression vector pBlyzg

1. plasmid pUC-18 is with BamHI and SalI double digestion, and electrophoresis reclaims the linear plasmid that cuts.

2. (with pBluescript SK (+) is basic plasmid to plant consideration convey plasmid pBTu, and required multiple clone site on the structure, and comprise plant nuclear strong promoter 35S plays the Ω sequence of enhancement, the expression cassette of selection markers kanamycin gene.) also use BamHI and SalI double digestion, electrophoresis reclaims the 1.1kb fragment of downcutting.

3. utilize the T4DNA ligase enzyme to reclaim fragment with above-mentioned two and connect, obtain intermediate carrier precursor plasmid pPBl, this plasmid has a NcoI point of contact between BamHI and SalI.

4. utilize this intermediate carrier precursor plasmid of NcoI and SalI double digestion pPBl, electrophoresis reclaims the 2.7kb carrier segments.

Why so do be since pBTu as plant expression vector, but the point of contact that a plurality of NcoI are arranged on it, can't directly utilize, so can only cut next fragment from plasmid pBTu with BamHI and SalI earlier, after pBTu being gone up the 1.1kb fragment of downcutting and the pUC-18 plasmid that same enzyme is cut being connected with BamHI and SalI, precursor plasmid pPBl in the middle of obtaining, utilize then its in downstream, BamHI enzyme point of contact a back to back NcoI point of contact, again with a NcoI and SalI enzyme carrier pPBl that hits, the main body that so just goal gene can be inserted into pPBl is that the size of pBTu plasmid is between the enzyme point of contact of the NcoI of 2.7kb and SalI, thereby constructs needed vector plasmid.

With above-mentioned 2.7kb carrier segments with downcut human lysozyme gene (containing the GFP fragment) with NcoI I/Sal I from colibacillus expression plasmid pET-lyzg and utilize the T4DNA ligase enzyme to be connected, obtain to constitute the carrier for expression of eukaryon pBlyzg that can be used for the particle gun conversion of human lysozyme gene.(see figure 2)

The structure of B, Agrobacterium-mediated Transformation method plant expression vector:

1. adopting in a small amount, alkaline process extracts plant nuclear expression vector plasmid PBG plasmid (the Agrobacterium carrier for expression of eukaryon that this laboratory makes up based on pBI121, comprise plant nuclear strong promoter 35S, play the Ω sequence of enhancement, the expression cassette of selection markers kanamycin gene, the foreign gene part is all on the T-DNA of pBI121) and above-mentioned plasmid pBlyzg, utilize BamHI and these plasmids of SalI double digestion, electrophoresis reclaims the carrier segments and the carrier pBlyzg 1 that contains the human lysozyme gene, the gene fragment of 200bp of about 10kb of plasmid PBG cutting-out.

2. utilize the T4DNA ligase enzyme that the PBG carrier segments of above-mentioned recovery is connected with the human lysozyme gene fragment, thereby can obtain the expression vector plasmid PBGlyzg that particle gun transforms that is used for of human lysozyme gene.

The acquisition of embodiment 3. transgenic plant

1. the Agrobacterium-mediated Transformation method imports lettuce with lysozyme gene

A: plasmid PBGlyzg is transformed Agrobacterium

(1) preparation of the competent cell of Agrobacterium LBA4404:

Picking agrobacterium tumefaciens lba4404 list colony inoculation is in the 5ml YEP substratum of (containing Rifampin 20mg/L, Streptomycin sulphate 30mg/L), and 28 ℃, 200rpm shakes overnight incubation.

The bacterium liquid of 2ml incubated overnight is added to 50ml contains same antibiotic YEP substratum, 28 ℃, 220rpm shakes 3-4h soon, makes OD ₆₀₀=0.5.

The centrifugal 5min of 5000rpm removes supernatant, adds 10ml 0.15mol/L NaCl suspension cell, ice bath 20min.

4 ℃, the centrifugal 5min of 5000rpm removes supernatant, adds the 20mmol/L CaCl of 1ml precooling ₂Re-suspended cell (15% glycerol), be sub-packed in the 1.5ml Eppendorf pipe (200 μ l/ pipe) be stored in-70 ℃ stand-by.

(2) conversion reaction of Agrobacterium LBA4404: adopt freeze-thaw method to transform Agrobacterium.

Get the plasmid pBGlyzg that 5 μ l contain target DNA and join in the 200 μ l LBA4404 competent cells ice bath 30min.

Quick-frozen 5min in the liquid nitrogen, 37 ℃ melt 5min.

Add 1ml YEP substratum, 28 ℃ of 150rpm jog 2-3h.

Collect thalline and coat on the YEP flat board that contains kantlex (50mg/L) and Rifampin (100mg/L), cultivated 2-3 days for 28 ℃.

(3) transformed the evaluation of Agrobacterium-mediated Transformation of plasmid pBGlyzg

Choose single bacterium colony, in a small amount prepare plasmid after the liquid culture, the size of electrophoretic examinations plasmid pBGlyzg, and further utilize the GFP primer to carry out pcr amplification to determine that pBGlyzg's changes Agrobacterium over to.

The PCR detection method:

The PCR system: 10 μ l PCR premixed liquid Master (Premix Extaq Dalian Bao Sheng company), GFP3 ' primer and each 30ng of GFP5 ' primer, the 10ng plasmid DNA adds water to 20 μ l

The PCR program:

94 ℃ of sex change connect 25 loop bodies after 2 minutes: 94 ℃ 30 seconds, 55 ℃ 30 seconds, 72 ℃ 1.5 minutes, 72 ℃ were extended 5 minutes.

PCR carries out on BioMetre PCR instrument.

B. utilize the Agrobacterium-mediated Transformation lettuce that contains lysozyme gene

(1) cultivation of acceptor material and pre-treatment

Lactuca sativa seeds, is sowed and treated that on the MS substratum its germinating growth, growth conditions are 2000lux illumination (16 hours/day) after 15 minutes with the sterilization of 20% clorox, and its true leaf blade of clip and petiole are as recipient plant after 1 month.

(2) with agrobacterium-mediated transformation lysozyme gene is imported lettuce

(single colony inoculation is on the YEP flat board that contains Kam50 for above-mentioned Agrobacterium-mediated Transformation that transforms plasmid pBGlyzg of picking, cultivate after 24 hours for 28 ℃ and scrape the lawn that takes a morsel, put into little centrifuge tube, with an amount of YEP liquid nutrient medium dilution, utilize the 1mL sterile syringe draw the good conversion of dilution the bacterium liquid inductance of Agrobacterium of plasmid pBGlyzg dye the true leaf blade of lettuce, petiole, be put in dark the cultivation 2 days on the common MS substratum then, then the blade of coinfection Agrobacterium and petiole are changed on the Pyocianil MB2 substratum of the kantlex that is added with 50mg/L and 500mg/L over to illumination and cultivate, change on the MB5 substratum of additional kantlex 100mg/L and Pyocianil 250mg/L illumination after 4 weeks over to and cultivate.

The regeneration plant of anti-kantlex demonstrates green.After green plant screened, be inoculated into once more on the screening culture medium, continue to cultivate, finally obtain stable green seedling.Pcr amplification detection and the Southern hybridization detection of green seedling being carried out genomic dna all demonstrate positive reaction, and this shows that goal gene has been incorporated in the lettuce genome.Utilize the Agrobacterium-mediated Transformation method to produce the lettuce that has transformed human lysozyme gene thus

2. the particle gun conversion method imports lettuce with lysozyme gene

(1) explant is prepared

Aseptic seedling: with lactuca sativa seeds with 0.1% mercuric chloride sterilization 15 minutes after, sowing after treating its germinating growth on the MS substratum, get its tender leaf be tiled in cultivate on the MS substratum 2-3 days standby.

The sterilization blade: water planting lettuce tender leaf with 4% clorox sterilization 15 minutes after, it is standby to be tiled on the MS substratum cultivation 5 days.

Callus: the aseptic seedling blade is put in green that the continuous induction cultivation formed more than 30 days on the MB2 substratum

The look callus

(2) plasmid prepares in a large number

Be used for the carrier for expression of eukaryon pBlyzg that particle gun transforms, after spending the night with 100mlLB liquid nutrient medium amplification cultivation, collect thalline and use alkaline lysis method of extracting plasmid DNA, extract plasmid DNA through agarose gel electrophoresis and UV spectrophotometer measuring purity and concentration.

3. plant culture:

MS:MS basal component, sucrose 3%, inositol 0.1g/L, agar 0.5%, PH5.8.

MB1：MS+6-BA?1mg/L，pH5.8

MB2:MS basal component+6-BA0.2mg/L+IAA1.0mg/L, sucrose 3%, inositol 0.1g/L, agar 0.5%, PH5.8.

MB5:MS basal component+6-BA0.5mg/L+IAA1.0, sucrose 3%, inositol 0.1g/L, agar 0.5%, PH5.8.

MB6:MS basal component+6-BA 6mg/L, pH5.8

MN: sucrose 3%, inorganic salt 1/2MS, inositol 0.1g/L, agar 0.5%, PH5.8.

4. particle gun bullet preparation:

(1) preparation of tungsten powder suspension

60mg tungsten powder (Φ 0.8UW) is placed on and adds dehydrated alcohol in the centrifuge tube, and is hot to temperature with 30 seconds one minor ticks of ultrasonic grinding machine 1 minute, leaves standstill 5 minutes, removes supernatant in centrifugal 10000rpm5 minute;

Add 1ml dehydrated alcohol vortex 5 minutes, left standstill 1 minute, removed supernatant in centrifugal 10000rpm5 minute;

Add 1ml sterilized water vortex 3 minutes, and removed supernatant (repeating 3 times) in centrifugal 10000rpm5 minute;

Add 50% glycerine 1ml in sedimentary tungsten powder, concussion becomes suspension, and packing 50 μ l/ pipe is put in 4 ℃ of preservations.

(2) preparation of little bullet

Get 1 pipe, 50 μ l tungsten powders and add 5 μ l plasmid LBG-A concussion 30 seconds, add 20 μ l spermidines (0.1M) concussion 30 seconds, add 50 μ lCaCl ²(2.5M) vortex is 60 seconds, leave standstill 1 minute centrifugal 3000rpm30 and remove supernatant second, add 150 μ l70% ethanol and wash precipitation, centrifugal 3000rpml0 removes supernatant second, add dehydrated alcohol 150 μ l and do not destroy precipitation and removed supernatant in static 1 minute, it is resuspended to add 60 μ l dehydrated alcohols.Every rifle is got 10 μ l during bombardment.

5. particle gun transforms: particle gun is the PDS-1000/HeBiolistic particle delivery system that is produced by U.S. BIO-RAD company.The parameter that is adopted is: vacuum tightness 28inches.Hg, target distance 9cm, helium pressure 1100psi transform.

Bombardment back explant is put in common MS substratum last 2 day, transform to contain on the kantlex substratum then and cultivate, at first usefulness is the MB2 substratum, through inducing and screening and culturing of about 2-4 time-of-week, or explant changes on the MB5 substratum when having callus to occur, and continues to cultivate, and after three weeks the green bud clump of the resistance that obtains changed over to the screening division culture medium of the additional kantlex of MB6, continuous subculture twice on this substratum, each three weeks.The green bud that will obtain then changes MB over to ₁The division culture medium of additional kantlex, the regrowth of growing up on this substratum change the root media of the additional kantlex of MN over to, and the root system development good stand is planted in the engagement soil.Get the induced bud that induces, under long-wave ultra violet lamp or under fluorescent microscope (OlmpusBX51), excite and to send green fluorescence with blue streak, the proof foreign gene obtains expressing in plant, molecular Biological Detection result has also confirmed this point: human lysozyme gene fragment PCR augmentation detection and the Southern hybridization detection of green seedling being carried out genomic dna all demonstrate positive reaction, and this shows that goal gene has been incorporated in the lettuce genome.

The detection of embodiment 4. transgenic plant expressing proteins

1. positive anti-source preparation: with prokaryotic expression carrier plasmid pET-lyzg, with reference to relevant pET product description the transformant thalline is carried out inducing culture, collect thalline, separated product is positive anti-source after the SDS protein electrophoresis detects purity.Albumen also can downcut from SDS-PAGE glue in addition, and the injection rabbit obtains corresponding antiserum(antisera) after the drying and crushing.

2.Western blotting analyzes

(1) from the transgenosis lettuce, extracts the human lysozyme of expressing

The proteic extraction of expression of plants: get 100mg vegetable material transgenosis lettuce, add grinding buffer solution (0.001%PMSF, pH 8.0 for 10mM Tris.Cl, 0.02 NaN) 200 μ l; Be ground into homogenate in the ice bath, under the 5000rpm room temperature centrifugal 10 minutes, get supernatant ,-20 ℃ of preservations are stand-by.

(2) SDS-PAGE electrophoresis

SDS-PAGE electrophoresis detection: the expression product human lysozyme is carried out the SDS-PAGE electrophoresis according to a conventional method, resolving gel concentration 8%, Coomassie brilliant blue R-250 dyeing, methyl alcohol-acetate decolouring.

The result shows that institute's leach protein size is confirmed to be target protein at 44KD.

(3) preparation of solution

Electrotransfer damping fluid: contain the 39mmol/L glycine, 48mmol/L TrisHCL (pH 6.8), 037%SDS, 20% methyl alcohol.

Preparation 1000mL: take by weighing glycine 2.9g, Tris alkali 5.8g, SDS 0.37g, be dissolved in the 750mL redistilled water after, add 200mL methyl alcohol, be settled to 1000mL.

Washing lotion solution: 150mmol/L NaCL, 50mmol/L Tris HCL pH7.5;

Confining liquid: 10mL PBST+0.3g BSA;

0.5% amino black 10B dye liquor: take by weighing amino black 10B 0.5g, add methyl alcohol 45mL, ice ethanol 10mL, redistilled water 45mL;

The ethanol of amino black rinsing liquid: 45mL 95%, 5mL glacial acetic acid, 50mL deionized water;

Substrate solution (30mL): DAB (diaminobenzidine) and the 9mg CoCL of dissolving 15mg among the 30mL PBST ₂, add 10 μ L 30%H again ₂O ₂

(4) electrotransfer

Cut 6 and above-mentioned running gel filter paper of the same size and a NC film, and soak 3-5min with transfering buffering liquid.Successively sponge, 3 of filter paper, gel, NC film, 3 of filter paper, sponge are put well, fix with sieve tray then, insert in the electrotransfer groove, add transfering buffering liquid, determine gel at negative electrode, the NC film is in anode direction.Connect power supply, voltage is 50-100V, 4 ℃ of following electrophoresis 2-3h.Electrotransfer finishes, and takes out the NC film, with pencil or cut off one jiao of direction with label film.Downcut standard molecular weight Marker,, put the amino black dye liquor and contaminate 5min, take out the back with the rinsing liquid decolouring, take off to the greatest extent until blue background.All the other NC films wash with PBS, add the 10mL confining liquid and soak, and room temperature concussion 1-3h is to seal the not site of adsorbed proteins.

(5) immunology detection

After sealing finishes, with the NC film that has changeed target protein PBS rinsing liquid rinsing 4-5 time, each 5min.

The NC film is gone in the plastics bag, add the anti-human lysozyme antiserum(antisera) of test antibody-rabbit (utilizing positive protein notes rabbit to produce) 10mL (0.1mL/cm ²), seal.37 ℃ slightly shake in conjunction with 1.5hr, with PBST flushing 4-5 time, slowly shake at shaking table at every turn.Add the anti-sheep IgG of rabbit (two is anti-) of dilution in 1: 800 then, jog is hatched 1h under the room temperature, takes out with PBST flushing 3-4 time each 10min.Anti-to remove unconjugated two.

The NC film is transferred to substrate solution, and room temperature lucifuge jog 5-10min observes the colour developing situation, waits when band occurring, changes PBST damping fluid termination reaction immediately over to.The result confirms that the human lysozyme gene has obtained expression really in lettuce.

The information of SEQ ID NO 1

Sequence signature:

(A) length: 456 base pairs

(B) type: nucleic acid

(C) chain: two strands

(D) topological framework: linearity

Sequence description: SEQ ID NO 1:

1 ATGAAGGCTC?TCATTGTTCT?GGGGCTTGTC?CTCCTTTCTG?TTACGGTCCA?GGGCAAGGTC

61 TTTGAAAGGT?GTGAGTTGGC?CAGAACTCTG?AAAAGATTGG?GAATGGATGG?CTACAGGGGA

121 ATCAGCCTAG?CAAACTGGAT?GTGTTTGGCC?AAATGGGAGA?GTGGTTACAA?CACACGAGCT

181 ACAAACTACA?ATGCTGGAGA?CAGAAGCACT?GATTATGGGA?TATTTCAGAT?CAATAGCCGC

241 TACTGGTGTA?ATGATGGCAA?AACCCCAGGA?GCAGTTAATG?CCTGTCATTT?ATCCTGCAGT

301 GCTTTGCTGC?AAGATAACAT?CGCTGATGCT?GTAGCTTGTG?CAAAGAGGGT?TGTCCGTGAT

361 CCACAAGGCA?TTAGAGCATG?GGTGGCATGG?AGAAATCGTT?GTCAAAACAG?AGATGTCCGT

421 CAGTATGTTC?AAGGTTGTGG?AGTGTAACGA?GTCGAC

The information of SEQ ID NO 2

Sequence signature:

(A) length: 148 amino acid

(B) type: amino acid

(C) chain: strand

(D) topological framework: linearity

Sequence description: SEQ ID NO 2:

1 M?K?A?L?I?V?L?G?L?A?L?L?S?V?T?V?Q?G?K?V

21 F?E?R?C?E?L?A?R?T?L?K?R?L?G?M?D?G?Y?R?G

41 I?S?L?A?N?W?M?C?L?A?K?W?E?S?G?Y?N?T?R?A

61 T?N?Y?N?A?G?D?R?S?T?D?Y?G?I?F?Q?I?N?S?R

81 Y?W?C?N?D?G?K?T?P?G?A?V?N?A?C?H?L?S?C?S

101 A?L?L?Q?D?N?I?A?D?A?A?A?C?A?K?R?V?V?R?D

121 P?Q?G?V?R?A?W?A?A?W?R?N?R?C?Q?D?R?D?V?R

141 Q?Y?V?Q?G?C?G?V

The information in SEQ ID NO 3 sequences source

1. from Genebank, the information that U56997 obtains GFP gene clone carrier pGreen A19 complete sequence is as follows:

(A) length: (GFP gene clone carrier pGreen A19 complete sequence is seen Genebank, U56997) to 2942bp ring-type efficient coding fragment

(B) type: Nucleotide

(C) chain: two strands

(D) topological framework: linearity

(E) the 2942bp complete sequence of GFP gene clone carrier pGreen A19 is described:

1 TTATTTGTAT?AGTTCATCCA?TGCCATGTGT?AATCCCAGCA?GCTGTTACAA?ACTCAAGAAG

61 GATCATGTGA?TCTCTCTTTT?CGTTGGGATC?TTTGGAAAGG?GCAGATTGTG?TGGACAGGTA

121 IATGGTTGTC?TGGTAAAAGG?ACAGGGCCAT?CGCCAATTGG?AGTATTTTGT?TGATAATGGT

181 CTGCTAATTG?AACGCTTCCA?TCTTTAATGT?TGTGTCTAAT?TTTGAAGTTA?ACTTTGATTC

241 CATTCTTTGG?TTTGTCTGCC?ATGATGTATA?CATTATGTGA?GTTATAGTTG?TATTCCATTT

301 TGTGTCCAAG?AATGTTTCCA?TCTTCTTTAA?AATCAATACC?TTTTAACTGA?TTCTATTAAC

361 AAGGGTATCA?CCTTCAAACT?TGACTTCAGC?ACGTGTCTTG?TAGTTCCCGT?CATCTTTGTA

421 AAATATAGTT?CTTTCCTGTA?CATAACCTTC?GGGCATGGCA?CTCTTGAAAA?AGTCATGCTG

481 TTTCATATGA?TCTGGGTATC?TTGAAAAGCA?TTGAACACCG?TAAGCGAAAG?TAGTAACGAG

541 TGTTGGCCAT?GGAACAGGTA?GCTTCCCAGT?AGTGCAAATA?AATTTAAGGG?TAAGTTTTCC

601 GTATGTTGCA?TCACCTTCAC?CCTCTCCACT?GACAGAGAAT?TTTTGCCCAT?TAACATCGCC

661 ATCTAATTCA?ACAAGAATTG?GGACAACTCC?AGTGAAAAGT?TCTTCTCCTT?TACTGGAATT

721 CGAGCTCGGT?ACCCGGGGAT?CCTCTAGAGT?CGACCTGCAG?GCATGCAAGC?TTGGCGTAAT

781 CATGGTCATA?GCTGTTTCCT?GTGTGAAATT?GTTATCCGCT?CACAATTCCA?CACAACATAC

841 GAGCCGGAAG?CATAAAGTGT?AAAGCCTGGG?GTGCCTAATG?AGTGAGCTAA?CTCACATTAA

901 TTGCGTTGCG?CTCACTGCCC?GCTTTCCAGT?CGGGAAACCT?GTCGTGCCAG?CTGCATTAAT

961 GAATCGGCCA?ACGCGCGGGG?AGAGGCGGTT?TGCGTATTGG?GCGCTCTTCC?GCTTCCTCGC

1021 TCACTGACTC?GCTGCGCTCG?GTCGTTCGGC?TGCGGCGAGC?GGTATCAGCT?CACTCAAAGG

1081 CGGTAATACG?GTTATCCACA?GAATCAGGGG?ATAACGCAGG?AAAGAACATG?TGAGCAAAAG

1141 GCCAGCAAAA?GGCCAGGAAC?CGTAAAAAGG?CCGCGTTGCT?GGCGTTTTTC?CATAGGCTCC

1201 GCCCCCCTGA?CGAGCATCAC?AAAAATCGAC?GCTCAAGTCA?GAGGTGGCGA?AACCCGACAG

1261 GACTATAAAG?ATACCAGGCG?TTTCCCCCTG?GAAGCTCCCT?CGTGCGCTCT?CCTGTTCCGA

1321 CCCTGCCGCT?TACCGGATAC?CTGTCCGCCT?TTCTCCCTTC?GGGAAGCGTG?GCGCTTTCTC

1381 ATAGCTCACG?CTGTAGGTAT?CTCAGTTCGG?TGTAGGTCGT?TCGCTCCAAG?CTGGGCTGTG

1441 TGCACGAACC?CCCCGTTCAG?CCCGACCGCT?GCGCCTTATC?CGGTAACTAT?CGTCTTGAGT

1501 CCAACCCGGT?AAGACACGAC?TTATCGCCAC?TGGCAGCAGC?CACTGGTAAC?AGGATTAGCA

1561 GAGCGAGGTA?TGTAGGCGGT?GCTACAGAGT?TCTTGAAGTG?GTGGCCTAAC?TACGGCTACA

1621 CTAGAAGGAC?AGTATTTGGT?ATCTGCGCTC?TGCTGAAGCC?AGTTACCTTC?GGAAAAAGAG

1681 TTGGTAGCTC?TTGATCCGGC?AAACAAACCA?CCGCTGGTAG?CGGTGGTTTT?TTTGTTTGCA

1741 AGCAGCAGAT?TACGCGCAGA?AAAAAAGGAT?CTCAAGAAGA?TCCTTTGATC?TTTTCTACGG

1801 GGTCTGACGC TCAGTGGAAC?GAAAACTCAC?GTTAAGGGAT TTTGGTCATG?AGATTATCAA

1861 AAAGGATCTT?CACCTAGATC?CTTTTAAATT?AAAAATGAAG TTTTAAATCA?ATCTAAAGTA

1921 TATATGAGTA?AACTTGGTCT?GACAGTTACC?AATGCTTAAT?CAGTGAGGCA?CCTATCTCAG

1981 CGATCTGTCT?ATTTCGTTCA?TCCATAGTTG?CCTGACTCCC?CGTCGTGTAG?ATAACTACGA

2041 TACGGGAGGG?CTTACCATCT?GGCCCCAGTG?CTGCAATGAT?ACCGCGAGAC?CCACGCTCAC

2101 CGGCTCCAGA?TTTATCAGCA?ATAAACCAGC?CAGCCGGAAG?GGCCGAGCGC?AGAAGTGGTC

2161 CTGCAACTTT?ATCCGCCTCC?ATCCAGTCTA?TTAATTGTTG?CCGGGAAGCT?AGAGTAAGTA

2221 GTTCGCCAGT?TAATAGTTTG?CGCAACGTTG?TTGCCATTGC?TACAGGCATC?GTGGTGTCAC

2281 GCTCGTCGTT?TGGTATGGCT?TCATTCAGCT?CCGGTTCCCA?ACGATCAAGG?CGAGTTACAT

2341 GATCCCCCAT?GTTGTGCAAA?AAAGCGGTTA?GCTCCTTCGG?TCCTCCGATC?GTTGTCAGAA

2401 GTAAGTTGGC?CGCAGTGTTA?TCACTCATGG?TTATGGCAGC?ACTGCATAAT?TCTCTTACTG

2461 TCATGCCATC?CGTAAGATGC?TTTTCTGTGA?CTGGTGAGTA?CTCAACCAAG?TCATTCTGAG

2521 AATAGTGTAT?GCGGCGACCG?AGTTGCTCTT?GCCCGGCGTC?AATACGGGAT?AATACCGCGC

2581 CACATAGCAG?AACTTTAAAA?GTGCTCATCA?TTGGAAAACG?TTCTTCGGGG?CGAAAACTCT

2641 CAAGGATCTT?ACCGCTGTTG?AGATCCAGTT?CGATGTAACC?CACTCGTGCA?CCCAACTGAT

2701 CTTCAGCATC?TTTTACTTTC?ACCAGCGTTT?CTGGGTGAGC?AAAAACAGGA?AGGCAAAATG

2761 CCGCAAAAAA?GGGAATAAGG?GCGACACGGA?AATGTTGAAT?ACTCATACTC?TTCCTTTTTC

2821 AATATTATTG?AAGCATTTAT?CAGGGTTATT?GTCTCATGAG?CGGATACATA?TTTGAATGTA

2881 TTTAGAAAAA?TAAACAAATA?GGGGTTCCGC?GCACATTTCC?CCGAAAAGTG?CCACCTGACG

2941 TC

From the U56997 carrier subclone to obtain the GFP cloned genomic fragment as follows:

SEQ ID NO 3 sequences

EcoR I restriction enzyme site (subclone obtains following GFP fragment from the U56997 carrier, referring to NCBI U56997)

G↓AATTC

1 AGTAAAGGAG?AAGAACTTTT?CACTGGAGTT?GTCCCAATTC?TTGTTGAATT?AGATGGCGAT

61 GTTAATGGGC?AAAAATTCTC?TGTCAGTGGA?GAGGGTGAAG?GTGATGCAAC?ATACGGAAAA

121 CTTACCCTTA?AATTTATTTG?CACTACTGGG?AAGCTACCTG?TTCCATGGCC?AACACTCGTT

181 ACTACTTTCG?CTTACGGTGT?TCAATGCTTT?TCAAGATACC?CAGATCATAT?GAAACAGCAT

241 GACTTTTTCA?AGAGTGCCAT?GCCCGAAGGT?TATGTACAGG?AAAGAACTAT?ATTTTACAAA

301 GATGACGGGA?ACTACAAGAC?ACGTGCTGAA?GTCAAGTTTG?AAGGTGATAC?CCTTGTTAAT

361 AGAATCGAGT?TAAAAGGTAT?TGATTTTAAA?GAAGATGGAA?ACATTCTTGG?ACACAAAATG

421 GAATACAACT?ATAACTCACA?TAATGTATAC?ATCATGGCAG?ACAAACCAAA?GAATGGAATC

481 AAAGTTAACT?TCAAAATTAG?ACACAACATT?AAAGATGGAA?GCGTTCAATT?AGCAGACCAT

541 TATCAACAAA?ATACTCCAAT?TGGCGATGGC?CCTGTCCTTT?TACCAGACAA?CCATTACCTG

601 TCCACACAAT?CTGCCCTTTC?CAAAGATCCC?AACGAAAAGA?GAGATCACAT?GATCCTTCTT

661 GAGTTTGTAA?CAGCTGCTGG?GATTACACAT?GGCATGGATG?AACTATACAA?ATAA

The SalI restriction enzyme site

G↓TCGAC

3. the information with human lysozyme gene and GFP gene fusion is as follows:

Nco I restriction enzyme site

↓

C CATGGCG

1 ATGAAGGCTC?TCATTGTTCT?GGGGCTTGCC?CTCCTTTCTG?TTACGGTCCA?GGGCAAGGTC

61 TTTGAAAGGT?GTGAGTTGGC?CAGAACTCTG?AAAAGATTGG?GAATGGATGG?CTACAGGGGA

121 ATCAGCCTAG?CAAACTGGAT?GTGTTTGGCC?AAATGGGAGA?GTGGCTACAA?CACACGAGCT

181 ACAAACTACA?ATGCTGGAGA?CAGAAGCACT?GATTATGGGA?TATTTCAGAT?CAATAGCCGC

241 TACTGGTGTA?ATGATGGCAA?AACCCCAGGA?GCAGTTAATG?CCTGTCATTT?ATCCTGCAGT

301 GCTTTGCTGC?AAGATAACAT?CGCTGATGCT?GCAGCTTGTG?CAAAGAGGGT?TGTCCGTGAT

361 CCACAAGGCG?TTAGAGCATG?GGCGGCATGG?AGAAATCGTT?GTCAAGACAG?AGATGTCCGT

421 CAGTATGTTC AAGGTTGTGG AGTG (when connecting, removing terminator codon and non-coding sequence)

EcoR I restriction enzyme site (subclone obtains following GFP fragment from the U56997 carrier, referring to NCBI U56997)

G↓AATTC

1 AGTAAAGGAG?AAGAACTTTT?CACTGGAGTT?GTCCCAATTC?TTGTTGAATT?AGATGGCGAT

61 GTTAATGGGC?AAAAATTCTC?TGTCAGTGGA?GAGGGTGAAG?GTGATGCAAC?ATACGGAAAA

121 CTTACCCTTA?AATTTATTTG?CACTACTGGG?AAGCTACCTG?TTCCATGGCC?AACACTCGTT

181 ACTACTTTCG?CTTACGGTGT?TCAATGCTTT?TCAAGATACC?CAGATCATAT?GAAACAGCAT

241 GACTTTTTCA?AGAGTGCCAT?GCCCGAAGGT?TATGTACAGG?AAAGAACTAT?ATTTTACAAA

301 GATGACGGGA?ACTACAAGAC?ACGTGCTGAA?GTCAAGTTTG?AAGGTGATAC?CCTTGTTAAT

361 AGAATCGAGT?TAAAAGGTAT?TGATTTTAAA?GAAGATGGAA?ACATTCTTGG?ACACAAAATG

421 GAATACAACT?ATAACTCACA?TAATGTATAC?ATCATGGCAG?ACAAACCAAA?GAATGGAATC

481 AAAGTTAACT?TCAAAATTAG?ACACAACATT?AAAGATGGAA?GCGTTCAATT?AGCAGACCAT

541 TATCAACAAA?ATACTCCAAT?TGGCGATGGC?CCTGTCCTTT?TACCAGACAA?CCATTACCTG

601 TCCACACAAT?CTGCCCTTTC?CAAAGATCCC?AACGAAAAGA?GAGATCACAT?GATCCTTCTT

661 GAGTTTGTAA?CAGCTGCTGG?GATTACACAT?GGCATGGATG?AACTATACAA?ATAA

The SalI restriction enzyme site

G↓TCGAC

The complete sequence of gene is described after human lysozyme gene and the GFP gene fusion:

1 CCATGGCGAT?GAAGGCTCTC?ATTGTTCTGG?GGCTTGCCCT?CCTTTCTGTT?ACGGTCCAGG

61 GCAAGGTCTT?TGAAAGGTGT?GAGTTGGCCA?GAACTCTGAA?AAGATTGGGA?ATGGATGGCT

121 ACAGGGGAAT?CAGCCTAGCA?AACTGGATGT?GTTTGGCCAA?ATGGGAGAGT?GGCTACAACA

181 CACGAGCTAC?AAACTACAAT?GCTGGAGACA?GAAGCACTGA?TTATGGGATA?TTTCAGATCA

241 ATAGCCGCTA?CTGGTGTAAT?GATGGCAAAA?CCCCAGGAGC?AGTTAATGCC?TGTCATTTAT

301 CCTGCAGTGC?TTTGCTGCAA?GATAACATCG?CTGATGCTGC?AGCTTGTGCA?AAGAGGGTTG

361 TCCGTGATCC?ACAAGGCGTT?AGAGCATGGG?CGGCATGGAG?AAATCGTTGT?CAAGACAGAG

421 ATGTCCGTCA?GTATGTTCAA?GGTTGTGGAG?TGGAATTCAG?TAAAGGAGAA?GAACTTTTCA

481 CTGGAGTTGT?CCCAATTCTT?GTTGAATTAG?ATGGCGATGT?TAATGGGCAA?AAATTCTCTG

541 TCAGTGGAGA?GGGTGAAGGT?GATGCAACAT?ACGGAAAACT?TACCCTTAAA?TTTATTTGCA

601 CTACTGGGAA?GCTACCTGTT?CCATGGCCAA?CACTCGTTAC?TACTTTCGCT?TACGGTGTTC

661 AATGCTTTTC?AAGATACCCA?GATCATATGA?AACAGCATGA?CTTTTTCAAG?AGTGCCATGC

721 CCGAAGGTTA?TGTACAGGAA?AGAACTATAT?TTTACAAAGA?TGACGGGAAC?TACAAGACAC

781 GTGCTGAAGT?CAAGTTTGAA?GGTGATACCC?TTGTTAATAG?AATCGAGTTA?AAAGGTATTG

841 ATTTTAAAGA?AGATGGAAAC?ATTCTTGGAC?ACAAAATGGA?ATACAACTAT?AACTCACATA

901 ATGTATACAT?CATGGCAGAC?AAACCAAAGA?ATGGAATCAA?AGTTAACTTC?AAAATTAGAC

961 ACAACATTAA?AGATGGAAGC?GTTCAATTAG?CAGACCATTA?TCAACAAAAT?ACTCCAATTG

1021 GCGATGGCCC?TGTCCTTTTA?CCAGACAACC?ATTACCTGTC?CACACAATCT?GCCCTTTCCA

1081 AAGATCCCAA?CGAAAAGAGA?GATCACATGA?TCCTTCTTGA?GTTTGTAACA?GCTGCTGGGA

1141 TTACACATGG?CATGGATGAA?CTATACAAAT?AAGTCGAC

The nucleotide sequence of SEQ ID NO 4

Describe with the aminoacid sequence SEQ ID NO 5 that derives:

The warm albumen coded sequence of Translation of lyz-gfp (1-1170)

Universal?code

Total amino acid number:389 (comprising human lysozyme protein and GFP Argine Monohydrochloride sequence).

MW (molecular weight)=43579

Max?ORF?starts?at?AA?pos?1(may?be?DNA?pos?1)for?389?AA(1167?bases)，MW＝43579

1 ATGGCGATGAAGGCTCTCATTGTTCTGGGGCTTGCCCTCCTTTCTGTTACGGTCCAGGGC

1 M A M K A L I V L G L A L L S V T V Q G

61 AAGGTCTTTGAAAGGTGTGAGTTGGCCAGAACTCTGAAAAGATTGGGAATGGATGGCTAC

21 K V F E R C E L A R T L K R L G M D G Y

121 AGGGGAATCAGCCTAGCAAACTGGATGTGTTTGGCCAAATGGGAGAGTGGCTACAACACA

41 R G I S L A N W M C L A K W E S G Y N T

181 CGAGCTACAAACTACAATGCTGGAGACAGAAGCACTGATTATGGGATATTTCAGATCAAT

61 R A T N Y N A G D R S T D Y G I F Q I N

241 AGCCGCTACTGGTGTAATGATGGCAAAACCCCAGGAGCAGTTAATGCCTGTCATTTATCC

81 S R Y W C N D G K T P G A V N A C H L S

301 TGCAGTGCTTTGCTGCAAGATAACATCGCTGATGCTGCAGCTTGTGCAAAGAGGGTTGTC

101 C S A L L Q D N I A D A A A C A K R V V

361 CGTGATCCACAAGGCGTTAGAGCATGGGCGGCATGGAGAAATCGTTGTCAAGACAGAGAT

121 R D P Q G V R A W A A W R N R C Q D R D

421 GTCCGTCAGTATGTTCAAGGTTGTGGAGTGGAATTCAGTAAAGGAGAAGAACTTTTCACT

141 V R Q Y V Q G C G V E F S K G E E L F T

481 GGAGTTGTCCCAATTCTTGTTGAATTAGATGGCGATGTTAATGGGCAAAAATTCTCTGTC

161 G V V P I L V E L D G D V N G Q K F S V

541 AGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACT

181 S G E G E G D A T Y G K L T L K F I C T

601 ACTGGGAAGCTACCTGTTCCATGGCCAACACTCGTTACTACTTTCGCTTACGGTGTTCAA

201 T G K L P V P W P T L V T T F A Y G V Q

661 TGCTTTTCAAGATACCCAGATCATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCC

221 C F S R Y P D H M K Q H D F F K S A M P

721 GAAGGTTATGTACAGGAAAGAACTATATTTTACAAAGATGACGGGAACTACAAGACACGT

241 E G Y V Q E R T I F Y K D D G N Y K T R

781 GCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGAT

261 A E V K F E G D T L V N R I E L K G I D

841 TTTAAAGAAGATGGAAACATTCTTGGACACAAAATGGAATACAACTATAACTCACATAAT

281 F K E D G N I L G H K M E Y N Y N S H N

901 GTATACATCATGGCAGACAAACCAAAGAATGGAATCAAAGTTAACTTCAAAATTAGACAC

301 V Y I M A D K P K N G I K V N F K I R H

961 AACATTAAAGATGGAAGCGTTCAATTAGCAGACCATTATCAACAAAATACTCCAATTGGC

321 N I K D G S V Q L A D H Y Q Q N T P I G

1021 GATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCCAAA

341 D G P V L L P D N H Y L S T Q S A L S K

1081 GATCCCAACGAAAAGAGAGATCACATGATCCTTCTTGAGTTTGTAACAGCTGCTGGGATT

361 D P N E K R D H M I L L E F V T A A G I

1141 ACACATGGCATGGATGAACTATACAAATAA

380 T H G M D E L Y K *

Claims (9)

1. a human lysozyme gene and the green fluorescent protein GFP gene fusion human lysozyme gene of connecting and obtaining, this gene has nucleotide sequence shown in the SEQ ID NO:4.

2. the human lysozyme gene fusion rotein that the fusion gene that obtains is derived of connecting with the GFP gene has the aminoacid sequence shown in the SEQ ID NO:5.

3. prokaryotic expression carrier that comprises described human lysozyme of claim 1 and green fluorescent protein fusion gene.

4. carrier for expression of eukaryon, it is characterized in that: this expression vector comprises the fusion gene of human lysozyme and green fluorescent protein, and this gene has nucleotide sequence shown in the SEQ ID NO:4.

5. carrier for expression of eukaryon, it is characterized in that: the expressing protein of the human lysozyme fusion gene that this expression vector comprises, this albumen have aminoacid sequence shown in the SEQ ID NO:5.

6. one kind is the method that bio-reactor is produced the human lysozyme fusion rotein with the plant, it is characterized in that: any described plant expression vector of claim 4-5 is imported in the plant, make it produce coding human lysozyme fusion rotein.

7. one kind as being the method that bio-reactor is produced the human lysozyme fusion rotein with the plant as described in the claim 6, and it is characterized in that: this plant is a lettuce.

8. a human lysozyme fusion rotein is characterized in that, this fusion rotein is that the method by claim 6 or 7 obtains.

9. the purposes of a human lysozyme fusion rotein that obtains with claim 6 or 7 described methods, this fusion rotein is as the application of preparation treatment acquired immune deficiency syndrome (AIDS), cancer and bacterium, virogenetic disease medicament.

Images