CN115247166A - Protease mutant - Google Patents

Abstract

The invention discloses a protease mutant, which has a protease activity in a region corresponding to SEQ ID NO:1 with an amino acid substitution at position 11; and the mutant has protease activity. The amino acid sequence of the protease mutant is shown as SEQ ID NO:2, respectively. In addition, through scientific mutation point scheme design and a large number of mutant screening experiments, the fermentation activity of the obtained protease mutant in host cells is remarkably increased compared with that of parent protease, the production cost of the protease is favorably reduced in industrial production, the protease product productivity of a factory is improved, a foundation is provided for wide application of the protease mutant in different fields, and the protease mutant has good application prospect and industrial value.

Description

Protease mutant

Technical Field

The invention belongs to the technical field of genetic engineering and enzyme engineering, relates to a protease mutant, and particularly relates to a protease (hereinafter referred to as 10R protease) mutant derived from Nocardiopsis sp NRRL 18262.

Background

The protease is an enzyme preparation for specifically hydrolyzing protein, is one of the largest industrial enzyme preparation products in the world in yield and market, and is widely applied to various fields of food, washing, feed and the like.

Proteins are essential nutritional factors for animals, and most livestock take essential proteins from plant sources (e.g., oilseed crops, legumes, and grains).

When vegetable protein materials such as soybean meal are added to the feed of monogastric animals such as pigs and poultry, a considerable proportion of the soy protein is not effectively digested (the apparent ileal protein digestibility in piglets, growing pigs and poultry is only around 80%). The exogenous protease is added to supplement the insufficient endogenous enzyme of animal organisms, improve the utilization rate of feed protein, reduce the feed cost, promote the growth of livestock and poultry and reduce environmental pollution.

Most protein digestion occurs in the small intestine of animals and proteases, acting as feed additives in the intestine of monogastric animals such as pigs and poultry, must go through two important steps, feed pelleting and transgastric. The feed granulation requires that the protease can still keep higher activity under the high temperature condition, and the transgastric requires that the protease has better stability under the strong acid condition.

Many proteases from Nocardiopsis sp have good performance in heat resistance and acid stability, and maintain high activity in the pH range of 6-7.5, and have potential feed industry application value. The 10R protease from Nocardiopsis species NRRL18262 is disclosed in the WO88/03947 patent. In addition, the 10R protease also has better application prospect in the fields of detergents, food processing and the like, and WO2005/035747 discloses the application of Nocardiopsis protease mutants in the field of detergents; the WO2008/077890 patent discloses a method of producing yeast extract with 10R protease; the WO2009/147105 patent discloses the use of a 10R protease in the production of casein hydrolysate.

However, it is very challenging to achieve large quantities of these proteases by recombinant expression in preferred Bacillus expression host cells, and thus improvements in the protease yield are also of high interest to the enzyme industry. The WO2004/111219 patent discloses increasing the protease production by adding an amino acid to the C-terminus of the Nocardiopsis 10R protease and/or modifying the existing C-terminus, the WO2005/123914 patent discloses increasing the production of the 10R protease in Bacillus by lowering the fermentation temperature, and the WO2005/123915 patent discloses increasing the production of the 10R protease by constructing multiple copies of at least two ORFs stably maintained in the same orientation in the same chromosomal location of Bacillus licheniformis. The further improvement of the 10R protease yield is still of great significance for reducing the production cost of industrial production.

Disclosure of Invention

In order to solve the defects of the prior art, the invention aims to provide a protease mutant, compared with wild protease, the fermentation activity of the protease mutant in host cells is obviously improved, and the production cost of the protease is favorably reduced in industrial production.

In one aspect, the invention provides a protease mutant which has a protease activity in a region corresponding to SEQ ID NO:1 with an amino acid substitution at position 11; and the mutant has protease activity.

Preferably, the mutant has an amino acid substitution at position 11 to I.

Preferably, the amino acid sequence of the mutant is:

(1) As shown in SEQ ID NO: 2;

(2) As shown in SEQ ID NO: 2;

(3) And SEQ ID NO:2, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more sequence identity; or

(4) As shown in SEQ ID NO:2, and (b) the amino acid sequence is obtained by adding, substituting, deleting or inserting one or a plurality of amino acids in the amino acid sequence shown in the formula 2.

Preferably, the parent protease of the protease mutant is derived from Nocardiopsis strain NRRL18262, and the amino acid sequence of the parent protease is as shown in SEQ ID NO:1 is shown.

In another aspect, the present invention also provides a polynucleotide encoding the protease mutant as described in any one of the above.

Preferably, the polynucleotide sequence of the protease mutant is:

(1) As shown in SEQ ID NO: 3;

(2) And SEQ ID NO:3, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more sequence identity;

(3) As shown in SEQ ID NO:3, adding, substituting, deleting or inserting one or several nucleotides into the polynucleotide sequence shown in the sequence table;

(4) A polynucleotide sequence that hybridizes under stringent conditions to the polynucleotide sequence of (1), (2) or (3) or to the full-length complement thereof; or

(5) The polynucleotide sequence which differs from the polynucleotide sequences in (1), (2), (3) and (4) due to the degeneracy of the genetic code.

In the present invention, the stringent conditions refer to prehybridization and hybridization at 42 ℃ in 5 XSSPE, 0.3% SDS, 200. Mu.g/ml sheared and denatured salmon sperm DNA, and 50% formamide, following standard southern blotting procedures for probes of at least 100 nucleotides in length, for 12 to 24 hours. The carrier material is finally washed three times each for 15 minutes using 2 XSSC, 0.2% SDS at 65 ℃.

The invention also provides a nucleic acid construct, an expression vector or an expression plasmid containing the polynucleotide; the polynucleotide is operably linked to one or more (several) control sequences that direct the production of the polypeptide in an expression host cell.

The invention also provides a host cell comprising the nucleic acid construct, expression vector or expression plasmid; the host cell is a gram-positive strain or a gram-negative strain.

The gram-positive bacterial strain is bacillus subtilis, bacillus licheniformis, bacillus amyloliquefaciens, bacillus lentus and the like.

The gram-negative strain is escherichia coli.

The invention also provides a pUC57-10Rmut-Cm-amyE plasmid construction method, which comprises the following steps:

step one, carrying out linearization on pUC57-BsaI-free plasmid by using BamHI-HindIII, carrying out PCR amplification by using Bacillus subtilis ATCC6051a strain genome DNA as a template, and recombining three fragments to obtain pUC57-BsaI-free-amyE plasmid;

and step two, linearizing the pUC57-BsaI-free-amyE plasmid by BsaI, respectively carrying out PCR amplification by using a 10Rmut gene synthesis plasmid and the Bacillus licheniformis ATCC14580 genome DNA as templates, and recombining the three fragments to obtain the pUC57-10Rmut-Cm-amyE plasmid.

The invention also provides a construction method of the mutant strain 10Rmut, which comprises the following steps:

step one, modifying gram-positive strains and gram-negative strains as experimental host bacteria;

step two, preparing competent cells of experimental host bacteria;

and step three, transferring the pUC57-10Rmut-Cm-amyE plasmid into competent cells to obtain a mutant strain.

In the present invention, the terms and explanations are as follows:

protease: is a generic term for a class of enzymes that hydrolyze peptide chains of proteins. They are classified into endopeptidases and telopeptidases according to their way of degrading polypeptides. The former can cut polypeptide chain with large molecular weight from the middle to form albumen and peptone with smaller molecular weight; the latter are in turn divided into carboxypeptidases and aminopeptidases, which hydrolyze peptide chains one by one from the free carboxyl terminus or the free amino terminus, respectively, of the polypeptide to form amino acids.

Mature polypeptide: refers to the polypeptide in its final form after translation and any post-translational modifications, such as N-terminal treatment, C-terminal truncation, glycosylation, phosphorylation, etc. It is well known in the art that host cells can produce a mixture of two or more different mature polypeptides (i.e., having different C-terminal and/or N-terminal amino acids) expressed from the same polynucleotide.

Parent protease: refers to a protease that can produce a mutant of the invention after mutation as described in the invention, and the parent protease can be a naturally occurring (wild-type) protease or a mutant thereof prepared by a suitable method, and the parent can also be an allelic variant.

Protease mutants: refers to a mutated protease obtained by one or more mutations appearing in the sequence compared to the amino acid sequence of the parent protease, the expression of the mutant being carried out in a host cell after transfer of the mutant gene into a plasmid.

Host cell: refers to any cell type susceptible to transformation, transfection, transduction, and the like with a vector comprising a nucleic acid of the invention; any progeny of a parent cell that is not identical to the parent cell due to mutations that occur during replication is encompassed.

And (3) substitution: refers to the replacement of an original amino acid occupying a position with a different amino acid.

Protease activity: protease activity is expressed in units of protease activity, defined as the amount of enzyme that a protease converts its specific substrate to yield 1. Mu.g or 1. Mu. Mol of product in 1min, defined as 1 unit of protease activity. For example, in the present embodiment, it is defined as 1g or 1mL of enzyme, and under certain conditions of temperature and pH, 1min hydrolyzes casein to generate 1 μ g of tyrosine, i.e., 1 unit of enzyme activity, expressed as U/g (U/mL).

Sequence identity: the percentage of sequence identity is determined using a computer program based on a dynamic programming algorithm. Preferred computer programs within the scope of the present invention include the BLAST (basic local alignment Search Tool) Search program designed to explore all available sequence databases, regardless of whether the query is protein or DNA. BLAST version 2.0 (Gapped BLAST) of this search tool is already publicly available on the Internet (http:// www. Ncbi. Nlm. Nih. Gov/BLAST /). It uses an exploratory algorithm to search for local alignments rather than global alignments to enable detection of relationships between sequences sharing only discrete regions. The scores specified in the BLAST search have well-defined statistical interpretations. The program preferably runs with selectable parameters set to default values.

In describing the protease mutants of the present invention, the following nomenclature is used for ease of reference.

In all cases, the accepted IUPAC single character or three character amino acid abbreviations are used. For the substitution of amino acids, the following nomenclature is used: original amino acid, position, substituted amino acid. For example, substitution of threonine (threonine) with alanine (alanine) at position 16 is designated "Thr16Ala" or "T16A".

The beneficial effects of the invention include: according to the invention, through scientific mutation point scheme design and a large number of mutant screening experiments, the fermentation activity of the obtained protease mutant in host cells is remarkably increased compared with that of parent protease. The protease mutant provided by the invention is beneficial to reducing the production cost of protease in industrial production, improving the protease product productivity of factories, providing a basis for the wide application of the protease mutant in different fields, and having good application prospects and industrial values.

Drawings

FIG. 1 is a schematic diagram of pUC57-10Rmut-Cm-amyE plasmid.

Detailed Description

The present invention will be described in further detail with reference to the following specific examples and the accompanying drawings. The procedures, conditions, experimental methods and the like for carrying out the present invention are general knowledge and common general knowledge in the art except for the contents specifically mentioned below, and the present invention is not particularly limited.

EXAMPLE 1 construction of recombinant plasmids for proteases and mutants thereof

The amino acid sequence of the wild type 10R protease derived from Nocardioopsis sp.NRRL 18262 is shown as SEQ ID NO.1, and the polynucleotide sequence is shown as SEQ ID NO. 4; the 10R protease mutant has an amino acid sequence shown as SEQ ID NO.2, and the polynucleotide sequence of the 10R protease mutant is shown as SEQ ID NO. 3. The 10R protease gene and its mutant gene were expressed using the amyE gene promoter of ATCC6051a strain, which was contained at the end of the amyE-5' fragment, directly linked to the aprE signal peptide, and the promoter sequence was as follows:

the signal peptide is selected from the signal peptide of an alkaline protease gene (aprE) of the bacillus clausii, and the amino acid sequence (SEQ ID NO. 8) of the signal peptide is as follows:

the amino acid sequence of the 10R protease propeptide (SEQ ID NO. 9) is as follows:

the terminator is selected from the terminator sequence of the bacillus amyloliquefaciens alpha-amylase gene (amyQ) and the sequence is as follows: TAATCAAAAAAACGCTGTGCGGTTAAAGGGCACACAGGTTTTTTTTTGTGTAT (SEQ ID NO. 10)

The nucleotide sequences of the aprE signal peptide, the 10R protease (including the propeptide and the mature peptide), the wild-type and the M11I mutant were optimized according to the codon preference of Bacillus subtilis 168 strain (performed at http:// www.jcat. De/website) and submitted to Genscript for gene synthesis. A plasmid containing a 10R protease wild-type nucleotide gene synthesis fragment was designated as a 10R-wt plasmid, and a plasmid containing a 10R protease mutant nucleotide gene synthesis fragment was designated as a 10Rmut plasmid.

Constructing by taking pUC57-BsaI-free plasmid (obtained by destroying BsaI restriction enzyme cutting site by pUC57 plasmid through point mutation) as a framework, linearizing the pUC57-BsaI-free plasmid by using BamHI-HindIII, recovering 2674bp fragment by using glue, amplifying amyE upstream homology arm (amyE-5 ') by taking Bacillus subtilis ATCC6051a strain genome DNA as a template and amyE-5' -F and amyE-5' -R as primers, wherein the size of a PCR product is 668bp; the downstream homology arm of amyE site (referred to as amyE-3' for short) was amplified using amyE-3' -F and amyE-3' -R as primers, and the PCR product size was 671bp, and the three fragments 2674bp, 668bp, and 671bp were subjected to three-fragment recombination using CloneZ recombinase (manufactured by Genscript Co., ltd.), and the resulting plasmid was named pUC57-BsaI-free-amyE, which was used for the subsequent plasmid construction by inserting 2 BsaI sites between amyE-5' and amy-3' fragments. Primer sequences are shown in Table 1.

Linearizing pUC57-BsaI-free-amyE plasmid by BsaI to obtain 3876bp fragments, amplifying by using 10R-wt plasmid as a template and 10R-F and 10R-R as primers to obtain a fragment containing aprE signal peptide, 10R protease (propeptide + mature peptide) wild-type sequence and amyQ terminator, wherein the size of PCR product is 1271bp (wt); taking the genome DNA of the bacillus licheniformis ATCC14580 as a template, and taking Cm-F and Cm-R as primers to amplify to obtain a chloramphenicol resistance gene expression cassette, wherein the size of a PCR product is 1264bp; the three fragments of 3876bp, 1271bp (wt) and 1264bp were subjected to three-fragment recombination using CloneZ recombinase (Genscript Co., ltd.), and the resulting plasmid was named pUC57-10Rwt-Cm-amyE, the primer sequence was shown in Table 1, and the entire sequence of the plasmid was shown in SEQ ID No.6.

Using 10Rmut plasmid as a template and 10R-F and 10R-R as primers to amplify to obtain a fragment containing aprE signal peptide, 10R protease (propeptide + mature peptide) M11I mutant sequence and amyQ terminator, wherein the size of a PCR product is 1271bp (mut); the three fragments of 3876bp, 1271bp (mut) and 1264bp were subjected to three-fragment recombination using CloneZ recombinase (Genscript Co., ltd.), and the resulting plasmid was named pUC57-10Rmut-Cm-amyE, the primer sequences are shown in Table 1, and the entire sequence of the plasmid is shown in SEQ ID NO.5.

TABLE 1 primer names and sequences (SEQ ID NO. 11-18)

Name of primer	Primer sequence (5 '→ 3')
		amyE-5′-F	tcggtacctcgcgaatgcatctagatatcggatccgcggcattatgtttgaatttccgtttaaag(SEQ ID NO.11)
amyE-5′-R	ctTgagacctttgagcttccgagactggtctcatcttgacactccttatttgattttttgaagac(SEQ ID NO.12)
		amyE-3′-F	aagatgagaccagtctcggaagctcaaaggtctcaagcgcccaagtgcccggtcagaatc(SEQ ID NO.13)
amyE-3′-R	acaggaaacagctatgaccatgattacgccaagcttcttcactaacgatgcctttgaaaatcttc(SEQ ID NO.14)
		10R-F	taagtcttcaaaaaatcaaataaggagtgtcaagaatgaaaaaacctcttggcaaaatcgttg(SEQ ID NO.15)
10R-R	agttgggtaacgccagggttttcccagtcacgacgttatacacaaaaaaacgctgtgccc(SEQ ID NO.16)
		Cm-F	aacgtcgtgactgggaaaacc(SEQ ID NO.17)
Cm-R	agccaggctgattctgaccgggcacttgggcgctttattggtatgactggttttaagcgc(SEQ ID NO.18)

Example 2 construction of Bacillus subtilis wild-type 10R protease expression Strain and its M11I mutant Strain

The experimental host bacterium A164 delta 4-comK is obtained by modifying bacillus subtilis ATCC6051a strain, and the modification relates to the inactivation of aprE, nprE, spo and amyE genes, wherein a comK gene for improving competence valence is integrated in an aprE locus and is operated by a xylose inducible promoter.

A164 Delta 4-comK competent cell was prepared as follows: the single clone was picked from the plate and inoculated into 50ml LB liquid medium (formulation: 1% tryptone, 0.5% Yeast extract, 1% NaCl), cultured overnight at 37 ℃ and 200rpm, the overnight-cultured bacterial liquid OD was diluted to about 1.0 with sterile LB liquid medium the following morning, 20ml of the diluted bacterial liquid was added to 1ml of 30% xylose solution and mixed uniformly, transferred to 250ml of sterile triangular flask, cultured at 37 ℃ and 200rpm for 2h, then 5ml of 50% glycerol was added and mixed uniformly to obtain competent cells for transformation, 100ul of competent cells/tube was dispensed, and transformed immediately or placed in a refrigerator at-80 ℃ for future use.

500ng of the pUC57-10Rwt-Cm-amyE plasmid and the pUC57-10Rmut-Cm-amyE plasmid which are constructed in the embodiment 1 of the invention are respectively transferred into A164 delta 4-comK competent cells, the cells are subjected to shaking culture at 37 ℃ and 200rpm for 2h, and then the bacterial liquid is diluted to 10 ^-2 Then 100ul of the resulting suspension was spread on LB solid medium (formulation: 1% tryptone, 0.5% Yeast extract, 1% NaCl, 1.5% agar) containing 2% skim milk and 5ng/ul chloramphenicol, and after 1-2 days of 37 ℃ culture, colonies with hydrolysis circles were selected for colony PCR and sequence verification, and the resulting 10R protease wild-type strain was designated as 10R-wt strain, and the resulting mutant strain was designated as 10Rmut strain.

EXAMPLE 3 Shake flask fermentation

The 10Rmut strain obtained in example 2 of the present invention and the 10R-wt wild-type strain were subjected to shake flask fermentation together. The experimental method is as follows: respectively selecting a proper amount of thalli, inoculating the thalli into a 250ml triangular flask containing 50ml of LB liquid seed culture medium, culturing overnight at 37 ℃ and 220rpm, then inoculating the thalli into a 250ml triangular flask containing 50ml of AKP fermentation culture medium (the formula is 10% glucose, 6% bean cake powder and 1% anhydrous disodium hydrogen phosphate) according to the inoculation amount of 1%, culturing for 96 hours at 37 ℃ and 220rpm, taking 2ml of fermentation liquor, centrifuging at 12000rpm for 2 minutes, taking the supernatant, and detecting the activity of alkaline protease.

The enzyme activity detection is carried out according to the detection method of the alkaline protease preparation in GB 1886.174-2016 (national food safety Standard) food additive food industry enzyme preparation). The protease activity is expressed in protease activity units, defined as 1g or 1mL of enzyme, and under the condition of certain temperature and pH, 1min hydrolyzes casein to generate 1 mug of tyrosine, namely 1 enzyme activity unit, expressed in U/g (U/mL). The detection principle is as follows: hydrolyzing casein substrate by protease at certain temperature and pH to generate amino acid containing phenolic group (such as tyrosine, tryptophan, etc.), reducing the Forlin reagent under alkaline condition to generate molybdenum blue and tungsten blue, and measuring absorbance of the solution at 680nm with spectrophotometer. The enzyme activity is proportional to the absorbance, and thus the enzyme activity of the product can be calculated.

The shake flask fermentation results are shown in Table 2 below, where the fermentation activity of the 10R-wt strain is defined as 1.00 and the fermentation activity of the 10Rmut strain is converted by comparison with the fermentation activity of 10R-wt.

TABLE 2 10Rmut results of shake-flask fermentation

As can be seen from Table 2, the shake flask fermentation activity of the 10Rmut strain is about 60% higher than that of the 10R-wt strain, which indicates that the M11I point mutation has a very significant effect on improving the 10R protease fermentation enzyme activity.

The protection content of the present invention is not limited to the above embodiments. Variations and advantages that may occur to those skilled in the art are intended to be included within the present invention without departing from the spirit and scope of the inventive concept and are intended to be protected by the following claims.

SEQUENCE LISTING

<110> Nanjing Baismin bioengineering GmbH, jinan Baismin bioengineering GmbH

<120> a protease mutant

<160> 18

<170> PatentIn version 3.3

<210> 1

<211> 188

<212> PRT

<213> Artificial sequence

<400> 1

Ala Asp Ile Ile Gly Gly Leu Ala Tyr Thr Met Gly Gly Arg Cys Ser

1 5 10 15

Val Gly Phe Ala Ala Thr Asn Ala Ala Gly Gln Pro Gly Phe Val Thr

20 25 30

Ala Gly His Cys Gly Arg Val Gly Thr Gln Val Thr Ile Gly Asn Gly

35 40 45

Arg Gly Val Phe Glu Gln Ser Val Phe Pro Gly Asn Asp Ala Ala Phe

50 55 60

Val Arg Gly Thr Ser Asn Phe Thr Leu Thr Asn Leu Val Ser Arg Tyr

65 70 75 80

Asn Thr Gly Gly Tyr Ala Thr Val Ala Gly His Asn Gln Ala Pro Ile

85 90 95

Gly Ser Ser Val Cys Arg Ser Gly Ser Thr Thr Gly Trp His Cys Gly

100 105 110

Thr Ile Gln Ala Arg Gly Gln Ser Val Ser Tyr Pro Glu Gly Thr Val

115 120 125

Thr Asn Met Thr Arg Thr Thr Val Cys Ala Glu Pro Gly Asp Ser Gly

130 135 140

Gly Ser Tyr Ile Ser Gly Thr Gln Ala Gln Gly Val Thr Ser Gly Gly

145 150 155 160

Ser Gly Asn Cys Arg Thr Gly Gly Thr Thr Phe Tyr Gln Glu Val Thr

165 170 175

Pro Met Val Asn Ser Trp Gly Val Arg Leu Arg Thr

180 185

<210> 2

<211> 188

<212> PRT

<213> Artificial sequence

<400> 2

Ala Asp Ile Ile Gly Gly Leu Ala Tyr Thr Ile Gly Gly Arg Cys Ser

1 5 10 15

Val Gly Phe Ala Ala Thr Asn Ala Ala Gly Gln Pro Gly Phe Val Thr

20 25 30

Ala Gly His Cys Gly Arg Val Gly Thr Gln Val Thr Ile Gly Asn Gly

35 40 45

Arg Gly Val Phe Glu Gln Ser Val Phe Pro Gly Asn Asp Ala Ala Phe

50 55 60

Val Arg Gly Thr Ser Asn Phe Thr Leu Thr Asn Leu Val Ser Arg Tyr

65 70 75 80

Asn Thr Gly Gly Tyr Ala Thr Val Ala Gly His Asn Gln Ala Pro Ile

85 90 95

Gly Ser Ser Val Cys Arg Ser Gly Ser Thr Thr Gly Trp His Cys Gly

100 105 110

Thr Ile Gln Ala Arg Gly Gln Ser Val Ser Tyr Pro Glu Gly Thr Val

115 120 125

Thr Asn Met Thr Arg Thr Thr Val Cys Ala Glu Pro Gly Asp Ser Gly

130 135 140

Gly Ser Tyr Ile Ser Gly Thr Gln Ala Gln Gly Val Thr Ser Gly Gly

145 150 155 160

Ser Gly Asn Cys Arg Thr Gly Gly Thr Thr Phe Tyr Gln Glu Val Thr

165 170 175

Pro Met Val Asn Ser Trp Gly Val Arg Leu Arg Thr

180 185

<210> 3

<211> 567

<212> DNA

<213> Artificial sequence

<400> 3

gctgatatca tcggcggcct tgcttacaca atcggcggcc gttgctctgt tggcttcgct 60

gctacaaacg ctgctggcca acctggcttc gttacagctg gccattgcgg ccgtgttggc 120

acacaagtta caatcggcaa cggccgtggc gttttcgaac aatctgtttt ccctggcaac 180

gatgctgctt tcgttcgtgg cacatctaac ttcacactta caaaccttgt ttctcgttac 240

aacacaggcg gctacgctac agttgctggc cataaccaag ctcctatcgg ctcttctgtt 300

tgccgttctg gctctacaac aggctggcat tgcggcacaa tccaagctcg tggccaatct 360

gtttcttacc ctgaaggcac agttacaaac atgacacgta caacagtttg cgctgaacct 420

ggcgattctg gcggctctta catctctggc acacaagctc aaggcgttac atctggcggc 480

tctggcaact gccgtacagg cggcacaaca ttctaccaag aagttacacc tatggttaac 540

tcttggggcg ttcgtcttcg tacataa 567

<210> 4

<211> 567

<212> DNA

<213> Artificial sequence

<400> 4

gctgatatca tcggcggcct tgcttacaca atgggcggcc gttgctctgt tggcttcgct 60

gctacaaacg ctgctggcca acctggcttc gttacagctg gccattgcgg ccgtgttggc 120

acacaagtta caatcggcaa cggccgtggc gttttcgaac aatctgtttt ccctggcaac 180

gatgctgctt tcgttcgtgg cacatctaac ttcacactta caaaccttgt ttctcgttac 240

aacacaggcg gctacgctac agttgctggc cataaccaag ctcctatcgg ctcttctgtt 300

tgccgttctg gctctacaac aggctggcat tgcggcacaa tccaagctcg tggccaatct 360

gtttcttacc ctgaaggcac agttacaaac atgacacgta caacagtttg cgctgaacct 420

ggcgattctg gcggctctta catctctggc acacaagctc aaggcgttac atctggcggc 480

tctggcaact gccgtacagg cggcacaaca ttctaccaag aagttacacc tatggttaac 540

tcttggggcg ttcgtcttcg tacataa 567

<210> 5

<211> 6306

<212> DNA

<213> Artificial sequence

<400> 5

tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60

cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120

ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180

accatatgcg gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc atcaggcgcc 240

attcgccatt caggctgcgc aactgttggg aagggcgatc ggtgcgggcc tcttcgctat 300

tacgccagct ggcgaaaggg ggatgtgctg caaggcgatt aagttgggta acgccagggt 360

tttcccagtc acgacgttgt aaaacgacgg ccagtgaatt cgagctcggt acctcgcgaa 420

tgcatctaga tatcggatcc gcggcattat gtttgaattt ccgtttaaag aatgggctgc 480

aagccttgtg tttttgttca tcattatctt atattactgc atcagggctg cggcatccgg 540

aatgctcatg ccgagaatag acaccaaaga agaactgcaa aaacgggtga agcagcagcg 600

aatagaatca attgcggtcg cctttgcggt agtggtgctt acgatgtacg acagggggat 660

tccccataca ttcttcgctt ggctgaaaat gattcttctt tttatcgtct gcggcggcgt 720

tctgtttctg cttcggtatg tgattgtgaa gctggcttac agaagagcgg taaaagaaga 780

aataaaaaag aaatcatctt ttttgtttgg aaagcgaggg aagcgttcac agtttcgggc 840

agcttttttt ataggaacat tgatttgtat tcactctgcc aagttgtttt gatagagtga 900

ttgtgataat tttaaatgta agcgttaaca aaattctcca gtcttcacat cggtttgaaa 960

ggaggaagcg gaagaatgaa gtaagaggga tttttgactc cgaagtaagt cttcaaaaaa 1020

tcaaataagg agtgtcaaga atgaaaaaac ctcttggcaa aatcgttgct tctacagctc 1080

ttcttatctc tgttgctttc tcttcttcta tcgcttctgc tgctacaggc gctcttcctc 1140

aatctcctac acctgaagct gatgctgttt ctatgcaaga agctcttcaa cgtgatcttg 1200

atcttacatc tgctgaagct gaagaacttc ttgctgctca agatacagct ttcgaagttg 1260

atgaagctgc tgctgaagct gctggcgatg cttacggcgg ctctgttttc gatacagaat 1320

ctcttgaact tacagttctt gttacagatg ctgctgctgt tgaagctgtt gaagctacag 1380

gcgctggcac agaacttgtt tcttacggca tcgatggcct tgatgaaatc gttcaagaac 1440

ttaacgctgc tgatgctgtt cctggcgttg ttggctggta ccctgatgtt gctggcgata 1500

cagttgttct tgaagttctt gaaggctctg gcgctgatgt ttctggcctt cttgctgatg 1560

ctggcgttga tgcttctgct gttgaagtta caacatctga tcaacctgaa ctttacgctg 1620

atatcatcgg cggccttgct tacacaatcg gcggccgttg ctctgttggc ttcgctgcta 1680

caaacgctgc tggccaacct ggcttcgtta cagctggcca ttgcggccgt gttggcacac 1740

aagttacaat cggcaacggc cgtggcgttt tcgaacaatc tgttttccct ggcaacgatg 1800

ctgctttcgt tcgtggcaca tctaacttca cacttacaaa ccttgtttct cgttacaaca 1860

caggcggcta cgctacagtt gctggccata accaagctcc tatcggctct tctgtttgcc 1920

gttctggctc tacaacaggc tggcattgcg gcacaatcca agctcgtggc caatctgttt 1980

cttaccctga aggcacagtt acaaacatga cacgtacaac agtttgcgct gaacctggcg 2040

attctggcgg ctcttacatc tctggcacac aagctcaagg cgttacatct ggcggctctg 2100

gcaactgccg tacaggcggc acaacattct accaagaagt tacacctatg gttaactctt 2160

ggggcgttcg tcttcgtaca taataatcaa taaaaaaacg ctgtgcggtt aaagggcaca 2220

gcgttttttt gtgtataacg tcgtgactgg gaaaaccctg gcgttaccca acttaatcgc 2280

cttgcagcac atcccccttt cgccagctgg cgtaatagcg aagaggcccg caccgatcgc 2340

ccttcccaac agttgcgcag cctgaatggc gaatggcgct agcagcacgc catagtgact 2400

ggcgatgctg tcggaatgga cgacggcaat agttaccctt attatcaaga taagaaagaa 2460

aaggattttt cgctacgctc aaatccttta aaaaaacaca aaagaccaca ttttttaatg 2520

tggtctttta ttcttcaact aaagcaccca ttagttcaac aaacgaaaat tggataaagt 2580

gggatatttt taaaatatat atttatgtta cagtaatatt gacttttaaa aaaggattga 2640

ttctaatgaa gaaagcagac aagtaagcct cctaaattca ctttagataa aaatttagga 2700

ggcatatcaa atgaacttta ataaaattga tttagacaat tggaagagaa aagagatatt 2760

taatcattat ttgaaccaac aaacgacttt tagtataacc acagaaattg atattagtgt 2820

tttataccga aacataaaac aagaaggata taaattttac cctgcattta ttttcttagt 2880

gacaagggtg ataaactcaa atacagcttt tagaactggt tacaatagcg acggagagtt 2940

aggttattgg gataagttag agccacttta tacaattttt gatggtgtat ctaaaacatt 3000

ctctggtatt tggactcctg taaagaatga cttcaaagag ttttatgatt tatacctttc 3060

tgatgtagag aaatataatg gttcggggaa attgtttccc aaaacaccta tacctgaaaa 3120

tgctttttct ctttctatta ttccatggac ttcatttact gggtttaact taaatatcaa 3180

taataatagt aattaccttc tacccattat tacagcagga aaattcatta ataaaggtaa 3240

ttcaatatat ttaccgctat ctttacaggt acatcattct gtttgtgatg gttatcatgc 3300

aggattgttt atgaactcta ttcaggaatt gtcagatagg cctaatgact ggcttttata 3360

atatgagata atgccgactg tactttttac agtcggtttt ctaacgatac attaataggt 3420

acgaaaaagc aacttttttt gcgcttaaaa ccagtcatac caataaagcg cccaagtgcc 3480

cggtcagaat cagcctggct ttgattacgt gctaaatggt ttatataatg actcgggctt 3540

aagcggttct cttccccatt gagggcaagg ctagacggga cttaccgaaa gaaaccatca 3600

atgatggttt cttttttgtt cataaatcag acaaaacttt tctcttgcaa aagtttgtga 3660

agtgttgcac aatataaatg tgaaatactt cacaaacaaa aagacatcaa agagaaacat 3720

accctggaag gatgattaat gatgaacaaa catgtaaata aagtagcttt aatcggagcg 3780

ggttttgttg gaagcagtta tgcatttgcg ttaattaacc aaggaatcac agatgagctt 3840

gtggtcattg atgtaaataa agaaaaagca atgggcgatg tgatggattt aaaccacgga 3900

aaggcgtttg cgccacaacc ggtcaaaaca tcttacggaa catatgaaga ctgcaaggat 3960

gctgatattg tctgcatttg cgccggagca aaccaaaaac ctggtgagac acgccttgaa 4020

ttagtagaaa agaacttgaa gattttcaaa ggcatcgtta gtgaagaagc ttggcgtaat 4080

catggtcata gctgtttcct gtgtgaaatt gttatccgct cacaattcca cacaacatac 4140

gagccggaag cataaagtgt aaagcctggg gtgcctaatg agtgagctaa ctcacattaa 4200

ttgcgttgcg ctcactgccc gctttccagt cgggaaacct gtcgtgccag ctgcattaat 4260

gaatcggcca acgcgcgggg agaggcggtt tgcgtattgg gcgctcttcc gcttcctcgc 4320

tcactgactc gctgcgctcg gtcgttcggc tgcggcgagc ggtatcagct cactcaaagg 4380

cggtaatacg gttatccaca gaatcagggg ataacgcagg aaagaacatg tgagcaaaag 4440

gccagcaaaa ggccaggaac cgtaaaaagg ccgcgttgct ggcgtttttc cataggctcc 4500

gcccccctga cgagcatcac aaaaatcgac gctcaagtca gaggtggcga aacccgacag 4560

gactataaag ataccaggcg tttccccctg gaagctccct cgtgcgctct cctgttccga 4620

ccctgccgct taccggatac ctgtccgcct ttctcccttc gggaagcgtg gcgctttctc 4680

atagctcacg ctgtaggtat ctcagttcgg tgtaggtcgt tcgctccaag ctgggctgtg 4740

tgcacgaacc ccccgttcag cccgaccgct gcgccttatc cggtaactat cgtcttgagt 4800

ccaacccggt aagacacgac ttatcgccac tggcagcagc cactggtaac aggattagca 4860

gagcgaggta tgtaggcggt gctacagagt tcttgaagtg gtggcctaac tacggctaca 4920

ctagaagaac agtatttggt atctgcgctc tgctgaagcc agttaccttc ggaaaaagag 4980

ttggtagctc ttgatccggc aaacaaacca ccgctggtag cggtggtttt tttgtttgca 5040

agcagcagat tacgcgcaga aaaaaaggat ctcaagaaga tcctttgatc ttttctacgg 5100

ggtctgacgc tcagtggaac gaaaactcac gttaagggat tttggtcatg agattatcaa 5160

aaaggatctt cacctagatc cttttaaatt aaaaatgaag ttttaaatca atctaaagta 5220

tatatgagta aacttggtct gacagttacc aatgcttaat cagtgaggca cctatctcag 5280

cgatctgtct atttcgttca tccatagttg cctgactccc cgtcgtgtag ataactacga 5340

tacgggaggg cttaccatct ggccccagtg ctgcaatgat accgcgagat ccacgctcac 5400

cggctccaga tttatcagca ataaaccagc cagccggaag ggccgagcgc agaagtggtc 5460

ctgcaacttt atccgcctcc atccagtcta ttaattgttg ccgggaagct agagtaagta 5520

gttcgccagt taatagtttg cgcaacgttg ttgccattgc tacaggcatc gtggtgtcac 5580

gctcgtcgtt tggtatggct tcattcagct ccggttccca acgatcaagg cgagttacat 5640

gatcccccat gttgtgcaaa aaagcggtta gctccttcgg tcctccgatc gttgtcagaa 5700

gtaagttggc cgcagtgtta tcactcatgg ttatggcagc actgcataat tctcttactg 5760

tcatgccatc cgtaagatgc ttttctgtga ctggtgagta ctcaaccaag tcattctgag 5820

aatagtgtat gcggcgaccg agttgctctt gcccggcgtc aatacgggat aataccgcgc 5880

cacatagcag aactttaaaa gtgctcatca ttggaaaacg ttcttcgggg cgaaaactct 5940

caaggatctt accgctgttg agatccagtt cgatgtaacc cactcgtgca cccaactgat 6000

cttcagcatc ttttactttc accagcgttt ctgggtgagc aaaaacagga aggcaaaatg 6060

ccgcaaaaaa gggaataagg gcgacacgga aatgttgaat actcatactc ttcctttttc 6120

aatattattg aagcatttat cagggttatt gtctcatgag cggatacata tttgaatgta 6180

tttagaaaaa taaacaaata ggggttccgc gcacatttcc ccgaaaagtg ccacctgacg 6240

tctaagaaac cattattatc atgacattaa cctataaaaa taggcgtatc acgaggccct 6300

ttcgtc 6306

<210> 6

<211> 6306

<212> DNA

<213> Artificial sequence

<400> 6

tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60

cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120

ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180

accatatgcg gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc atcaggcgcc 240

attcgccatt caggctgcgc aactgttggg aagggcgatc ggtgcgggcc tcttcgctat 300

tacgccagct ggcgaaaggg ggatgtgctg caaggcgatt aagttgggta acgccagggt 360

tttcccagtc acgacgttgt aaaacgacgg ccagtgaatt cgagctcggt acctcgcgaa 420

tgcatctaga tatcggatcc gcggcattat gtttgaattt ccgtttaaag aatgggctgc 480

aagccttgtg tttttgttca tcattatctt atattactgc atcagggctg cggcatccgg 540

aatgctcatg ccgagaatag acaccaaaga agaactgcaa aaacgggtga agcagcagcg 600

aatagaatca attgcggtcg cctttgcggt agtggtgctt acgatgtacg acagggggat 660

tccccataca ttcttcgctt ggctgaaaat gattcttctt tttatcgtct gcggcggcgt 720

tctgtttctg cttcggtatg tgattgtgaa gctggcttac agaagagcgg taaaagaaga 780

aataaaaaag aaatcatctt ttttgtttgg aaagcgaggg aagcgttcac agtttcgggc 840

agcttttttt ataggaacat tgatttgtat tcactctgcc aagttgtttt gatagagtga 900

ttgtgataat tttaaatgta agcgttaaca aaattctcca gtcttcacat cggtttgaaa 960

ggaggaagcg gaagaatgaa gtaagaggga tttttgactc cgaagtaagt cttcaaaaaa 1020

tcaaataagg agtgtcaaga atgaaaaaac ctcttggcaa aatcgttgct tctacagctc 1080

ttcttatctc tgttgctttc tcttcttcta tcgcttctgc tgctacaggc gctcttcctc 1140

aatctcctac acctgaagct gatgctgttt ctatgcaaga agctcttcaa cgtgatcttg 1200

atcttacatc tgctgaagct gaagaacttc ttgctgctca agatacagct ttcgaagttg 1260

atgaagctgc tgctgaagct gctggcgatg cttacggcgg ctctgttttc gatacagaat 1320

ctcttgaact tacagttctt gttacagatg ctgctgctgt tgaagctgtt gaagctacag 1380

gcgctggcac agaacttgtt tcttacggca tcgatggcct tgatgaaatc gttcaagaac 1440

ttaacgctgc tgatgctgtt cctggcgttg ttggctggta ccctgatgtt gctggcgata 1500

cagttgttct tgaagttctt gaaggctctg gcgctgatgt ttctggcctt cttgctgatg 1560

ctggcgttga tgcttctgct gttgaagtta caacatctga tcaacctgaa ctttacgctg 1620

atatcatcgg cggccttgct tacacaatgg gcggccgttg ctctgttggc ttcgctgcta 1680

caaacgctgc tggccaacct ggcttcgtta cagctggcca ttgcggccgt gttggcacac 1740

aagttacaat cggcaacggc cgtggcgttt tcgaacaatc tgttttccct ggcaacgatg 1800

ctgctttcgt tcgtggcaca tctaacttca cacttacaaa ccttgtttct cgttacaaca 1860

caggcggcta cgctacagtt gctggccata accaagctcc tatcggctct tctgtttgcc 1920

gttctggctc tacaacaggc tggcattgcg gcacaatcca agctcgtggc caatctgttt 1980

cttaccctga aggcacagtt acaaacatga cacgtacaac agtttgcgct gaacctggcg 2040

attctggcgg ctcttacatc tctggcacac aagctcaagg cgttacatct ggcggctctg 2100

gcaactgccg tacaggcggc acaacattct accaagaagt tacacctatg gttaactctt 2160

ggggcgttcg tcttcgtaca taataatcaa taaaaaaacg ctgtgcggtt aaagggcaca 2220

gcgttttttt gtgtataacg tcgtgactgg gaaaaccctg gcgttaccca acttaatcgc 2280

cttgcagcac atcccccttt cgccagctgg cgtaatagcg aagaggcccg caccgatcgc 2340

ccttcccaac agttgcgcag cctgaatggc gaatggcgct agcagcacgc catagtgact 2400

ggcgatgctg tcggaatgga cgacggcaat agttaccctt attatcaaga taagaaagaa 2460

aaggattttt cgctacgctc aaatccttta aaaaaacaca aaagaccaca ttttttaatg 2520

tggtctttta ttcttcaact aaagcaccca ttagttcaac aaacgaaaat tggataaagt 2580

gggatatttt taaaatatat atttatgtta cagtaatatt gacttttaaa aaaggattga 2640

ttctaatgaa gaaagcagac aagtaagcct cctaaattca ctttagataa aaatttagga 2700

ggcatatcaa atgaacttta ataaaattga tttagacaat tggaagagaa aagagatatt 2760

taatcattat ttgaaccaac aaacgacttt tagtataacc acagaaattg atattagtgt 2820

tttataccga aacataaaac aagaaggata taaattttac cctgcattta ttttcttagt 2880

gacaagggtg ataaactcaa atacagcttt tagaactggt tacaatagcg acggagagtt 2940

aggttattgg gataagttag agccacttta tacaattttt gatggtgtat ctaaaacatt 3000

ctctggtatt tggactcctg taaagaatga cttcaaagag ttttatgatt tatacctttc 3060

tgatgtagag aaatataatg gttcggggaa attgtttccc aaaacaccta tacctgaaaa 3120

tgctttttct ctttctatta ttccatggac ttcatttact gggtttaact taaatatcaa 3180

taataatagt aattaccttc tacccattat tacagcagga aaattcatta ataaaggtaa 3240

ttcaatatat ttaccgctat ctttacaggt acatcattct gtttgtgatg gttatcatgc 3300

aggattgttt atgaactcta ttcaggaatt gtcagatagg cctaatgact ggcttttata 3360

atatgagata atgccgactg tactttttac agtcggtttt ctaacgatac attaataggt 3420

acgaaaaagc aacttttttt gcgcttaaaa ccagtcatac caataaagcg cccaagtgcc 3480

cggtcagaat cagcctggct ttgattacgt gctaaatggt ttatataatg actcgggctt 3540

aagcggttct cttccccatt gagggcaagg ctagacggga cttaccgaaa gaaaccatca 3600

atgatggttt cttttttgtt cataaatcag acaaaacttt tctcttgcaa aagtttgtga 3660

agtgttgcac aatataaatg tgaaatactt cacaaacaaa aagacatcaa agagaaacat 3720

accctggaag gatgattaat gatgaacaaa catgtaaata aagtagcttt aatcggagcg 3780

ggttttgttg gaagcagtta tgcatttgcg ttaattaacc aaggaatcac agatgagctt 3840

gtggtcattg atgtaaataa agaaaaagca atgggcgatg tgatggattt aaaccacgga 3900

aaggcgtttg cgccacaacc ggtcaaaaca tcttacggaa catatgaaga ctgcaaggat 3960

gctgatattg tctgcatttg cgccggagca aaccaaaaac ctggtgagac acgccttgaa 4020

ttagtagaaa agaacttgaa gattttcaaa ggcatcgtta gtgaagaagc ttggcgtaat 4080

catggtcata gctgtttcct gtgtgaaatt gttatccgct cacaattcca cacaacatac 4140

gagccggaag cataaagtgt aaagcctggg gtgcctaatg agtgagctaa ctcacattaa 4200

ttgcgttgcg ctcactgccc gctttccagt cgggaaacct gtcgtgccag ctgcattaat 4260

gaatcggcca acgcgcgggg agaggcggtt tgcgtattgg gcgctcttcc gcttcctcgc 4320

tcactgactc gctgcgctcg gtcgttcggc tgcggcgagc ggtatcagct cactcaaagg 4380

cggtaatacg gttatccaca gaatcagggg ataacgcagg aaagaacatg tgagcaaaag 4440

gccagcaaaa ggccaggaac cgtaaaaagg ccgcgttgct ggcgtttttc cataggctcc 4500

gcccccctga cgagcatcac aaaaatcgac gctcaagtca gaggtggcga aacccgacag 4560

gactataaag ataccaggcg tttccccctg gaagctccct cgtgcgctct cctgttccga 4620

ccctgccgct taccggatac ctgtccgcct ttctcccttc gggaagcgtg gcgctttctc 4680

atagctcacg ctgtaggtat ctcagttcgg tgtaggtcgt tcgctccaag ctgggctgtg 4740

tgcacgaacc ccccgttcag cccgaccgct gcgccttatc cggtaactat cgtcttgagt 4800

ccaacccggt aagacacgac ttatcgccac tggcagcagc cactggtaac aggattagca 4860

gagcgaggta tgtaggcggt gctacagagt tcttgaagtg gtggcctaac tacggctaca 4920

ctagaagaac agtatttggt atctgcgctc tgctgaagcc agttaccttc ggaaaaagag 4980

ttggtagctc ttgatccggc aaacaaacca ccgctggtag cggtggtttt tttgtttgca 5040

agcagcagat tacgcgcaga aaaaaaggat ctcaagaaga tcctttgatc ttttctacgg 5100

ggtctgacgc tcagtggaac gaaaactcac gttaagggat tttggtcatg agattatcaa 5160

aaaggatctt cacctagatc cttttaaatt aaaaatgaag ttttaaatca atctaaagta 5220

tatatgagta aacttggtct gacagttacc aatgcttaat cagtgaggca cctatctcag 5280

cgatctgtct atttcgttca tccatagttg cctgactccc cgtcgtgtag ataactacga 5340

tacgggaggg cttaccatct ggccccagtg ctgcaatgat accgcgagat ccacgctcac 5400

cggctccaga tttatcagca ataaaccagc cagccggaag ggccgagcgc agaagtggtc 5460

ctgcaacttt atccgcctcc atccagtcta ttaattgttg ccgggaagct agagtaagta 5520

gttcgccagt taatagtttg cgcaacgttg ttgccattgc tacaggcatc gtggtgtcac 5580

gctcgtcgtt tggtatggct tcattcagct ccggttccca acgatcaagg cgagttacat 5640

gatcccccat gttgtgcaaa aaagcggtta gctccttcgg tcctccgatc gttgtcagaa 5700

gtaagttggc cgcagtgtta tcactcatgg ttatggcagc actgcataat tctcttactg 5760

tcatgccatc cgtaagatgc ttttctgtga ctggtgagta ctcaaccaag tcattctgag 5820

aatagtgtat gcggcgaccg agttgctctt gcccggcgtc aatacgggat aataccgcgc 5880

cacatagcag aactttaaaa gtgctcatca ttggaaaacg ttcttcgggg cgaaaactct 5940

caaggatctt accgctgttg agatccagtt cgatgtaacc cactcgtgca cccaactgat 6000

cttcagcatc ttttactttc accagcgttt ctgggtgagc aaaaacagga aggcaaaatg 6060

ccgcaaaaaa gggaataagg gcgacacgga aatgttgaat actcatactc ttcctttttc 6120

aatattattg aagcatttat cagggttatt gtctcatgag cggatacata tttgaatgta 6180

tttagaaaaa taaacaaata ggggttccgc gcacatttcc ccgaaaagtg ccacctgacg 6240

tctaagaaac cattattatc atgacattaa cctataaaaa taggcgtatc acgaggccct 6300

ttcgtc 6306

<210> 7

<211> 123

<212> DNA

<213> Artificial sequence

<400> 7

gtaagcgtta acaaaattct ccagtcttca catcggtttg aaaggaggaa gcggaagaat 60

gaagtaagag ggatttttga ctccgaagta agtcttcaaa aaatcaaata aggagtgtca 120

aga 123

<210> 8

<211> 27

<212> PRT

<213> Artificial sequence

<400> 8

Met Lys Lys Pro Leu Gly Lys Ile Val Ala Ser Thr Ala Leu Leu Ile

1 5 10 15

Ser Val Ala Phe Ser Ser Ser Ile Ala Ser Ala

20 25

<210> 9

<211> 165

<212> PRT

<213> Artificial sequence

<400> 9

Ala Thr Gly Ala Leu Pro Gln Ser Pro Thr Pro Glu Ala Asp Ala Val

1 5 10 15

Ser Met Gln Glu Ala Leu Gln Arg Asp Leu Asp Leu Thr Ser Ala Glu

20 25 30

Ala Glu Glu Leu Leu Ala Ala Gln Asp Thr Ala Phe Glu Val Asp Glu

35 40 45

Ala Ala Ala Glu Ala Ala Gly Asp Ala Tyr Gly Gly Ser Val Phe Asp

50 55 60

Thr Glu Ser Leu Glu Leu Thr Val Leu Val Thr Asp Ala Ala Ala Val

65 70 75 80

Glu Ala Val Glu Ala Thr Gly Ala Gly Thr Glu Leu Val Ser Tyr Gly

85 90 95

Ile Asp Gly Leu Asp Glu Ile Val Gln Glu Leu Asn Ala Ala Asp Ala

100 105 110

Val Pro Gly Val Val Gly Trp Tyr Pro Asp Val Ala Gly Asp Thr Val

115 120 125

Val Leu Glu Val Leu Glu Gly Ser Gly Ala Asp Val Ser Gly Leu Leu

130 135 140

Ala Asp Ala Gly Val Asp Ala Ser Ala Val Glu Val Thr Thr Ser Asp

145 150 155 160

Gln Pro Glu Leu Tyr

165

<210> 10

<211> 53

<212> DNA

<213> Artificial sequence

<400> 10

taatcaataa aaaaacgctg tgcggttaaa gggcacagcg tttttttgtg tat 53

<210> 11

<211> 65

<212> DNA

<213> Artificial sequence

<400> 11

tcggtacctc gcgaatgcat ctagatatcg gatccgcggc attatgtttg aatttccgtt 60

taaag 65

<210> 12

<211> 65

<212> DNA

<213> Artificial sequence

<400> 12

cttgagacct ttgagcttcc gagactggtc tcatcttgac actccttatt tgattttttg 60

aagac 65

<210> 13

<211> 60

<212> DNA

<213> Artificial sequence

<400> 13

aagatgagac cagtctcgga agctcaaagg tctcaagcgc ccaagtgccc ggtcagaatc 60

<210> 14

<211> 65

<212> DNA

<213> Artificial sequence

<400> 14

acaggaaaca gctatgacca tgattacgcc aagcttcttc actaacgatg cctttgaaaa 60

tcttc 65

<210> 15

<211> 63

<212> DNA

<213> Artificial sequence

<400> 15

taagtcttca aaaaatcaaa taaggagtgt caagaatgaa aaaacctctt ggcaaaatcg 60

ttg 63

<210> 16

<211> 60

<212> DNA

<213> Artificial sequence

<400> 16

agttgggtaa cgccagggtt ttcccagtca cgacgttata cacaaaaaaa cgctgtgccc 60

<210> 17

<211> 21

<212> DNA

<213> Artificial sequence

<400> 17

aacgtcgtga ctgggaaaac c 21

<210> 18

<211> 60

<212> DNA

<213> Artificial sequence

<400> 18

agccaggctg attctgaccg ggcacttggg cgctttattg gtatgactgg ttttaagcgc 60

Claims (10)

1. A protease mutant characterized in that the mutant has a sequence corresponding to SEQ ID NO:1 with an amino acid substitution at position 11; and the mutant has protease activity.

2. The mutant according to claim 1, wherein the amino acid at position 11 of the mutant is substituted with I.

3. The mutant of claim 1, wherein the amino acid sequence of the mutant is:

(1) As shown in SEQ ID NO: 2;

(2) As shown in SEQ ID NO:2, the amino acid sequence of a mature polypeptide of the polypeptide shown in the specification;

(3) And SEQ ID NO:2, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more sequence identity; or

(4) As shown in SEQ ID NO:2, and (b) the amino acid sequence is obtained by adding, substituting, deleting or inserting one or a plurality of amino acids in the amino acid sequence shown in the formula 2.

4. The mutant according to any one of claims 1 to 3, wherein the parent protease of the protease mutant is from Nocardiopsis species NRRL18262 and has an amino acid sequence as set forth in SEQ ID NO:1 is shown.

5. A polynucleotide encoding the protease mutant according to any one of claims 1 to 4.

6. The polynucleotide of claim 5, wherein the polynucleotide sequence of the protease mutant is:

(1) As shown in SEQ ID NO: 3;

(2) And SEQ ID NO:3, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more sequence identity;

(3) As shown in SEQ ID NO:3 with one or more nucleotides added, substituted, deleted or inserted;

(4) A polynucleotide sequence that hybridizes under stringent conditions to the polynucleotide sequence of (1), (2) or (3) or the full-length complement thereof; or

(5) The polynucleotide sequence differs from the polynucleotide sequences of (1), (2), (3) and (4) due to the degeneracy of the genetic code.

7. A nucleic acid construct, expression vector or expression plasmid comprising the polynucleotide of claim 5 or 6.

8. A host cell comprising the nucleic acid construct, expression vector or expression plasmid of claim 7.

9. The host cell of claim 8, wherein the host cell is a gram-positive strain or a gram-negative strain.

10. The host cell of claim 9, wherein the gram-positive strain is bacillus subtilis, bacillus licheniformis, bacillus amyloliquefaciens, or bacillus lentus; the gram-negative strain is escherichia coli.

Images