CN1196391A - New type glucokinase and its producing method - Google Patents
New type glucokinase and its producing method Download PDFInfo
- Publication number
- CN1196391A CN1196391A CN 97103921 CN97103921A CN1196391A CN 1196391 A CN1196391 A CN 1196391A CN 97103921 CN97103921 CN 97103921 CN 97103921 A CN97103921 A CN 97103921A CN 1196391 A CN1196391 A CN 1196391A
- Authority
- CN
- China
- Prior art keywords
- dna
- staphylokinase
- sequence
- dna sequence
- glucokinase
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Enzymes And Modification Thereof (AREA)
Abstract
A new glucokinase whose gene is separated in the chromosome of lysogenic staphylococcus aureus is disclosed. Compared with the gene of DNA glucokinase separated in staphylococcus aureus Sfi-C phage, the adenosine monophosphate at position No.109 in DNA encode sequence becomes uridine monophosphate, resulting in that the amino acid at position No.37 in amino acids sequence changes from arginine to glycine. By means of gene engineering, the new glucokinase is efficiently expressed in host. After purifying, the bioactivity of resultant is 3000000 U/mg, providing basis to further study the mechanism of using glucokinase to dissolve thrombus.
Description
The present invention relates to a kind of bionic thrombolytic drug and production method thereof, particularly a kind of new type glucokinase and production method thereof.
Staphylokinase can combine with proplasmin and form mixture, makes its activation be Taka-proteinase, and fibrin degradation specifically, makes thrombolysis, thereby makes it become the new promising thrombolytic drug of a class.At present, the gene of existing staphylokinase is separation obtains from S φ-c phage of streptococcus aureus (T.Sako et al. Cloning and Expression of theStaphylokinase Gene of Staphylococcus aureus in Escherichia coli:Mol Gen Gene (1983) 190:271.) such as scholar Sako of Japan.Isolated genes from phage, lysogenic strain need be cultured to the cracking state, carry out the separation of phage, from phage, separate needed gene fragment again, step is more, operation is complicated, and is only limited to the gene source of this a kind of staphylokinase, can't satisfy the needs that the thrombolysis mechanism and the clinical application of staphylokinase are carried out comprehensively, furtherd investigate.
The objective of the invention is to seek the new source of containing glucokinase gene, the step that simplifies the operation is raised the efficiency, and obtains the staphylokinase of novel texture.
The objective of the invention is to be achieved through the following technical solutions.
Utilize the pcr amplification technology, chromosomal DNA with the streptococcus aureus lysogenic strain that contains glucokinase gene is a template, design suitable primer sequence, carry out amplified reaction, thereby obtain the dna sequence dna of encoding novel staphylokinase, this dna encoding sequence and the resulting staphylokinase dna encoding of prior art sequence compare, and variation has taken place the 109th Nucleotide, and the 109th nucleotide diversity of the dna encoding sequence that the embodiment of the invention is related is a guanylic acid; By engineered method, carry out the structure of recombined new staphylokinase dna sequence dna expression vector; The recombinant expression vector transformed host cell obtains engineering strain; Engineering strain carries out culture expression; Expression product carries out the analysis and the bioactive mensuration of separation and purification, aminoacid sequence, the aminoacid sequence of the aminoacid sequence of resulting new type glucokinase and the resulting staphylokinase of prior art relatively, variation has taken place in the 37th amino acid, and the 37th amino acids variation of the aminoacid sequence of the new type glucokinase that the embodiment of the invention is related is glycine.
Because the present invention is by the gene fragment of the new type glucokinase in the round pcr amplification streptococcus aureus lysogenic strain chromosomal DNA, simpler than prior art operation steps, improved the production efficiency of recombination product, product expression level and biological activity all are higher than reported in literature, and this further investigation for staphylokinase thrombolysis mechanism and clinical application provides new material source.
Description of drawings:
Fig. 1 is the dna encoding sequence of new type glucokinase of the present invention.
Fig. 2 is the aminoacid sequence of new type glucokinase of the present invention.
Below be embodiments of the invention.
One, contains the extraction of the streptococcus aureus lysogenic strain chromosomal DNA of new type glucokinase gene
Streptococcus aureus FRI610A lysogenic bacteria (being provided by professor Lei Zuorong of the court) is inoculated in the substratum, through 37 ℃ of cultivations, 4 ℃ of centrifugal collection thalline, with behind the TE washing thalline again with TE suspension thalline, after adding the ProteinaseK mixing, the SDS of adding 10% cultivated 1 hour, and added isopyknic phenol then for 37 ℃, put upside down mixing one minute, centrifugal, get phase, use each extracting of phenol and phenol/chloroform more once, the 3M NaAc that adds 1/10 volume, the dehydrated alcohol of 2 times of volumes, put-20 ℃ 2 hours, 4 ℃ are centrifugal, deposit D NA, sedimentary DNA with 75% washing with alcohol, is dissolved in precipitation in the aseptic double-distilled water at last, and-20 ℃ of preservations are standby.
Two, pcr amplification glucokinase gene
1. primer design
Upstream primer: GGAATTCAAATGTCAAGTTCATTCGACAAAGGA
Downstream primer: CGGGATCCTTATTTCTTTTCTATAACAAC
Introduce the restriction endonuclease recognition site of Eco RI and Bam HI respectively at 5 of two primers ' end.With the resulting chromosomal DNA of step 1 is template, adds an amount of primer, carries out pcr amplification reaction, and the condition of reaction is: 94 ℃ 1 minute → 50 ℃ 1 minute → 71 ℃ 1 minute, 30 circulations, 72 ℃ of last round-robin extended 5 minutes.Reactant carries out electrophoretic analysis, and the result shows, on size and position that glucokinase gene conforms to, very special DNA band is arranged, and behind PCR reactant purifying, is dissolved in the aseptic double-distilled water, and-20 ℃ of preservations are standby.
Three, the dna sequence analysis of PCR reactant
With Eco RI and Bam HI digested vector pUC18, electrophoresis reclaims carrier; With Eco RI and Bam HI digestion step two resulting glucokinase gene fragments, electrophoresis reclaims the gene fragment of digestion again.The carrier and the gene fragment that reclaim are mixed in proportion, use T
4Dna ligase connects, and will connect product then and be converted in the EcoliJM101 recipient bacterium, obtains recombinant clone through screening, and the plasmid DNA of a large amount of extracting recombinant clones is carried out the analysis of dna encoding sequence, the results are shown in Figure 1.
Four, the clonal expression of goal gene
Resulting glucokinase gene is digested with restriction endonuclease Eco RI and Bam HI, mix, add T with the carrier pBV220 that digests with same restriction endonuclease
4Dna ligase, 14 ℃ of connections are spent the night, to connect product is converted among the intestinal bacteria EcoliHB101, picking transformant inoculation culture is extracted plasmid DNA, with Eco RI and Bam HI double digestion plasmid, through screening, obtain positive recombinant, recon is inoculated in the M9CA substratum, behind the cultivation certain hour, carry out 42 ℃ of abduction deliverings, after cultivating end, collect thalline, carry out SDS-PAGE and analyze, the result shows, on molecular weight size and position that staphylokinase conforms to, a darker band is arranged, its expression level be expression amount account for bacterial protein 70%.After expression product is purified, be standard protein with the streptokinase, carry out the bioactive mensuration of solusphere method, specific activity is 3 * 10
6U/mg illustrates that the resulting new type glucokinase of the present invention has the thrombolytic pharmaceutical use of potential.Purified product is through amino acid sequence analysis, and its structure as shown in Figure 2.
Claims (15)
1. the dna sequence dna of an encoding novel staphylokinase is characterized in that this dna sequence dna compares with the staphylokinase dna sequence dna of the S φ-C phage DNA that derives from streptococcus aureus, and variation has taken place the 109th adenylic acid (AMP).
2. the dna sequence dna of encoding novel staphylokinase according to claim 1 is characterized in that the 109th adenylic acid (AMP) variation of this dna sequence dna is guanylic acid.
3. the dna sequence dna of encoding novel staphylokinase according to claim 2 is characterized in that this dna sequence dna derives from the chromosomal DNA of lysogeny streptococcus aureus.
4. the dna sequence dna of encoding novel staphylokinase according to claim 3 is characterized in that this dna sequence dna derives from the chromosomal DNA of lysogeny streptococcus aureus FRI610A.
5. a recombinant expression vector is characterized in that this recombinant expression vector contains the dna sequence dna of claim 1,2,3 or 4 described encoding novel staphylokinases.
6. recombinant expression vector according to claim 5, the carrier that it is characterized in that this recombinant expression vector is a plasmid.
7. recombinant expression vector according to claim 6 is characterized in that plasmid is pBV220.
8. a reconstitution cell is characterized in that the host cell of this reconstitution cell is transformed by claim 5,6 or 7 described recombinant expression vectors.
9. reconstitution cell according to claim 8 is characterized in that host cell is a prokaryotic cell prokaryocyte.
10. reconstitution cell according to claim 9 is characterized in that host cell is intestinal bacteria
11. reconstitution cell according to claim 10 is characterized in that host cell is intestinal bacteria HB101.
12. the aminoacid sequence of an encoding novel staphylokinase is characterized in that this aminoacid sequence is coded by claim 1,2,3 or 4 described dna sequence dnas.
13. the aminoacid sequence of new type glucokinase according to claim 12, it is characterized in that the coded aminoacid sequence of this aminoacid sequence and the staphylokinase dna sequence dna of the S φ-C phage DNA that derives from streptococcus aureus compares, variation has taken place in the 36th arginine.
14. the aminoacid sequence of new type glucokinase according to claim 13 is characterized in that the 36th amino acids of this aminoacid sequence is a glycine.
15. a production is as the method for new type glucokinase as described in the claim 12,13 or 14, it is characterized in that this method may further comprise the steps: (1) extracts the chromosomal DNA that contains just like claim 1,2,3 or 4 described new type glucokinase dna sequence dnas; (2) pcr amplification that is template with the resulting new type glucokinase dna sequence dna of step (1); (3) as the structure of expression vector as described in the claim 5,6 or 7; (4) as the structure of claim 8,9,10 or 11 described reconstitution cells; (5) culture expression of the reconstitution cell that obtained of step (4); (6) separation and purification of the expression product that obtained of step (5); (7) analysis and the bioactive mensuration of the aminoacid sequence of the purified product that obtained of step (6).
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 97103921 CN1196391A (en) | 1997-04-16 | 1997-04-16 | New type glucokinase and its producing method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 97103921 CN1196391A (en) | 1997-04-16 | 1997-04-16 | New type glucokinase and its producing method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN1196391A true CN1196391A (en) | 1998-10-21 |
Family
ID=5166985
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 97103921 Pending CN1196391A (en) | 1997-04-16 | 1997-04-16 | New type glucokinase and its producing method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1196391A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001055359A1 (en) * | 2000-01-28 | 2001-08-02 | Fudan University | A novel recombinant staphylokinase derivant and its preparation method and application thereof |
-
1997
- 1997-04-16 CN CN 97103921 patent/CN1196391A/en active Pending
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001055359A1 (en) * | 2000-01-28 | 2001-08-02 | Fudan University | A novel recombinant staphylokinase derivant and its preparation method and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Quigley et al. | Non-Watson-Crick G⋅ C and A⋅ T Base Pairs in a DNA-Antibiotic Complex | |
| FI64813B (en) | FOERFARANDE FOER PRODUCERING AV ETT UTVALT AEGGVITEAEMNE OCH VID FOERFARANDET ANVAENDA REKOMBINANTPLASMIDVEKTORER | |
| CN102558309A (en) | Transcription activator-like effector nucleases, and encoding genes and application thereof | |
| CN110331146A (en) | It is a kind of regulation sgRNA transcription promoter, expression vector and its genome editing system and application | |
| CA2307842A1 (en) | Hyaluronan synthase gene and uses thereof | |
| CN107759675A (en) | A kind of signal peptide and its application that secernment efficiency can be improved from bacillus subtilis | |
| CN112251458B (en) | Method for integrating yarrowia lipolytica genome based on non-homologous end connection mechanism | |
| CN116333097A (en) | High-activity recombinant human fibronectin and preparation method and application thereof | |
| EP0587541B1 (en) | Process to purify the big-endothelin protein | |
| CN1196391A (en) | New type glucokinase and its producing method | |
| CN108103025B (en) | Hematopoietic stem cell and preparation method and application thereof | |
| US4935351A (en) | Process for preparing oligopeptide | |
| CN110468143A (en) | The preparation method and application of antibacterial peptide NZX | |
| CN113025599B (en) | Recombinant clostridium histolyticum type I collagenase as well as preparation method and application thereof | |
| CN115896082A (en) | Alginate lyase mutant and application thereof | |
| KR102152142B1 (en) | The preparation method of cyclic oligoadenylate using Cas10/Csm4 | |
| CN1042182A (en) | The coat protein gene of cucumber mosaic virus | |
| CN102174553A (en) | Preparation method of exfoliative toxin C (ExhC) proteins of staphylococcus sciuri | |
| JP2022513628A (en) | Alkaline purification method for spider silk protein | |
| CN100460502C (en) | Genetically engineered bacteria for efficiently expressing recombinant human sweet gland antibacterial peptide, and its constructing method and use | |
| CN114480347B (en) | Method for purifying Cas12a protein | |
| CN114196656B (en) | Proteinase K mutant and construction and application of its expression vector | |
| CN107266540A (en) | A kind of preparation method of mycobacterium tuberculosis elongation factors EF Tu albumen | |
| CN107698668A (en) | A kind of bacillus subtilis can improve signal peptide and its application of secernment efficiency | |
| CN106754599A (en) | Express engineering bacteria and its construction method and the application of GDH |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |