CN114480347B - Method for purifying Cas12a protein - Google Patents

Abstract

Disclosed is a method of purifying a Cas12a protein, the method comprising: expressing a Cas12a protein with a His tag through bacteria to obtain a supernatant containing the Cas12a protein; the supernatant was then purified using a first nickel column, a second nickel column, and a heparin column to give a purified Cas12a protein.

Description

Method for purifying Cas12a protein

Technical Field

The invention relates to the technical field of biology, and particularly relates to a method for rapidly purifying a Cas12a protein.

Background

The CRSPR-Cas12a system is a novel RNA-guided endonuclease used in the field of genome editing. Compared with the Cas9 system, the Cas12a can recognize and cut the target DNA only by crRNA without the participation of tracerRNA, and the system is simpler. The adjacent motif (PAM) sequence of the protospacer recognized by Cas12a is a thymine (T) rich sequence, and the editing range of CRISPR can be expanded. In addition, cas12a cleaves the target DNA to generate a sticky end, which is more favorable for insertion of the target gene. The study also found that Cas12a has a lower off-target rate than Cas9 with similar editing efficiency. Thus, cas12a is widely used in gene editing.

To prepare a Cas12a protein that meets the required purity, extraction and purification of the recombinantly expressed protein is often required. However, the existing purification method has the problems of long period, complex operation, possibility of causing protein decomposition, further causing the reduction of the effective yield of the protein and the like. Therefore, there is a need for a Cas12a protein purification method that can pass through a shorter period, is simple to operate, and has high purification efficiency.

Disclosure of Invention

In order to solve one of the above technical problems in the prior art, the present invention provides a method for purifying a Cas12a protein. The Cas12a protein purified by the method has higher activity and purity.

According to one aspect of the invention, there is provided a method of purifying a Cas12a protein, the method comprising: expressing a Cas12a protein with a His tag through bacteria to obtain a supernatant containing the Cas12a protein; the supernatant was then purified using a first nickel column, a second nickel column, and a heparin column to give a purified Cas12a protein.

According to some embodiments of the disclosure, the His-tag is linked at the N-terminus of the Cas12a protein. According to some embodiments of the disclosure, the His-tag is linked at the C-terminus of the Cas12a protein.

According to some embodiments of the present disclosure, the Cas12a protein comprises an amino acid sequence as set forth in SEQ ID No. 1. According to some embodiments of the present disclosure, the Cas12a protein comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.8% sequence identity to the amino acid sequence set forth in SEQ ID No. 1.

According to some embodiments of the disclosure, the method further comprises: following the first nickel column purification, enzymatic cleavage is performed using Tobacco Etch Virus (TEV) protease to cleave the His-tag from the His-tagged Cas12a protein.

According to some embodiments of the present disclosure, the mixture cleaved by TEV protease is subjected to a second nickel column purification. When the expression amount of the Cas12a protein is large, the reaction of TEV enzyme digestion to remove the tag protein may not be performed completely. Thus, the TEV cleaved solution, containing His-tag cleaved from Cas12a protein, cas12 protein, TEV enzyme, has not cleaved clean Cas12 protein still with His-tag mixed together. To isolate it, a second nickel column purification was performed. By a second nickel column purification, the His-tagged Cas12a protein was passed directly through the nickel column, while the His-tag and Cas12a protein still with His-tag were adsorbed on the nickel column, thus separating from the His-tagged Cas12a protein.

According to some embodiments of the present disclosure, the product purified by the second nickel column is further purified by a heparin column to break up high polymers.

According to some embodiments of the present disclosure, in the purification step of the first nickel column, linear elution is performed at 1.0 to 2.0mL/min using a first buffer and a second buffer. According to a specific embodiment of the present disclosure, in the purification step of the first nickel column, the first buffer and the second buffer are used to perform linear elution at 1.5 to 2.0mL/min, for example, at 1.5, 1.6, 1.7, 1.8, 1.9, or 2.0 mL/min.

According to some embodiments of the present disclosure, during the linear elution, the proportion of the second buffer in the elution buffer increases from 0% to 100%. According to some embodiments of the disclosure, the proportion of the second buffer in the elution buffer increases from 0% to 100% over a period of 30-60 min. According to a particular embodiment of the present disclosure, the proportion of the second buffer in the elution buffer increases from 0% to 100% in a time of 30-50 min. According to a specific embodiment of the present disclosure, the proportion of the second buffer in the elution buffer increases from 0% to 100% within a period of 40 min.

According to some embodiments of the disclosure, the pH of the first buffer is 7.5 to 8.2, for example 8.0. According to some embodiments of the disclosure, the pH of the second buffer is between pH 7.5 and pH 8.2, such as pH 8.0.

According to some embodiments of the disclosure, the first buffer may comprise 40-55 mM Tris-HCl, for example may comprise 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54 or 55mM Tris-HCl. According to some embodiments of the disclosure, the first buffer may further comprise 16 to 25mM imidazole, for example may comprise 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25mM imidazole. According to some embodiments of the present disclosure, the first buffer may further comprise 280 to 320mM NaCl, e.g., may comprise 280, 290, 300, 310 or 320mM NaCl. According to some embodiments of the present disclosure, the first buffer may further comprise 0.4 to 0.6mM TCEP, for example may comprise 0.4, 0.5 or 0.6mM TCEP.

According to some embodiments of the present disclosure, the second buffer may comprise 40-55 mM Tris-HCl, for example may comprise 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54 or 55mM Tris-HCl. According to some embodiments of the present disclosure, the second buffer may further comprise 280 to 320mM imidazole, for example may comprise 280, 290, 300, 310 or 320mM imidazole. According to some embodiments of the present disclosure, the second buffer may further comprise 280 to 320mM NaCl, for example may comprise 280, 290, 300, 310 or 320mM NaCl. According to some embodiments of the present disclosure, the second buffer may further comprise 0.4 to 0.6mM TCEP, for example may comprise 0.4, 0.5 or 0.6mM TCEP.

Compared with single nickel column purification, the method for purifying Cas12a protein by using nickel columns twice does not need gel filtration purification which is most time-consuming, labor-consuming and easy to cause protein loss, and reduces purification cost. According to the method, the nickel column and the heparin column are combined twice to purify the recombinant Cas12a protein, so that the protein purity is improved, the purification time is greatly reduced, the whole purification time is about 36 hours, and correspondingly, the protein loss caused by time extension is also greatly reduced.

Drawings

Fig. 1 shows PAGE gel results of protein samples obtained according to the steps of the purification method of the embodiments of the present disclosure. In fig. 1A, lane 1 from left to right is a molecular weight marker, lane 2 is a flow-through solution of a crude nickel column (first nickel column), lane 3 is a washing solution of a crude nickel column (first nickel column), lane 4 is a protein peak (sample 1) of the crude nickel column (first nickel column), and lane 5 is sample 2 after TEV enzyme digestion. In fig. 1B, lane 1 from left to right is a molecular weight marker, lane 2 is sample 2 after TEV digestion, lane 3 is secondary nickel column elution, lane 4 is flow-through of secondary nickel column (sample 3), and lanes 5 to 8 are peak samples (7, 10, 11.5, 9) of Cas12a secondary purification.

Fig. 2 shows a detection pattern of a high polymer of each protein sample obtained by the purification step of example 3.

Figure 3 shows the results of assays for Cas12a protein activity obtained via different purification methods.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail with reference to the following embodiments. The specific embodiments described herein are merely illustrative of the invention and do not constitute any limitation on the invention. Moreover, in the following description, descriptions of well-known structures and techniques are omitted so as to not unnecessarily obscure the concepts of the present disclosure. Such structures and techniques are also described in numerous publications.

Definition of

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly used in the art to which this invention belongs. For the purpose of explaining the present specification, the following definitions will apply and, where appropriate, terms used in the singular will also include the plural and vice versa.

As used herein, the expressions "a" and "an" include plural references unless the context clearly dictates otherwise. For example, reference to "a cell" includes a plurality of such cells and equivalents thereof known to those skilled in the art, and so forth.

The term "about" as used herein means within ± 20% of the value following. In some embodiments, the term "about" means a range of ± 10% of the value following it. In some embodiments, the term "about" means a range of ± 5% of the value following.

The term "tobacco etch virus protease" or "TEV enzyme" as used herein is a recombinantly expressed His-tagged cysteine protease that specifically recognizes the heptad sequence Glu-Asn-Leu-Tyr-Phe-Gln-Gly/Ser and cleaves between Gln and Gly/Ser amino acid residues. The TEV enzyme can be used to remove GST, his, or other tags from the fusion protein.

The term "heparin" as used herein is an acidic polysaccharide containing sulfate ester, which can bind with biological macromolecules such as anti-coagulation factors III, thrombin-like enzyme, human coagulation factors IX, XI, VIII, etc., escherichia coli-expressed human interleukins, human prostate growth factor, recombinant human vascular endothelial growth factor, cartilage growth factor, basic fibroblast growth factor, recombinant human acidic fibroblast growth factor, recombinant hepatocyte growth factor, recombinant murine heparin cofactor II, recombinant human platelet fourth factor, recombinant human endostatin, recombinant human keratinocyte growth factor, etc. Heparin may therefore be used for the purification of such substances. The heparin column or heparin affinity chromatography medium uses high flow rate agarose microspheres as matrix, adopts epoxy activation process to couple heparin onto agarose gel, and thus is applied to the purification of some proteins.

The term "sequence identity" as used herein refers to the degree of relatedness between two amino acid sequences or between two nucleotide sequences. The sequence identity between two amino acid sequences can be determined using the Needleman-Wunsch algorithm (Needleman-Wunsch algorithm) as in the Needleman program of the EMBOSS software package. The parameters used are gap opening penalty of 10, gap extension penalty of 0.5 and EBLOSUM62 (EMBOSS version of BLOSUM 62) substitution matrix. The output of the "longest identity" of the nidel label is used as the percent identity and is calculated as follows:

(same residue x 100)/(alignment length-total number of gaps in alignment).

The following examples and figures are provided to aid in the understanding of the present invention. It is to be understood that these examples and drawings are illustrative of the invention and are not to be construed as limiting in any way. The actual scope of the invention is set forth in the following claims. It is to be understood that any modifications and variations may be made without departing from the spirit of the invention.

Example 1: construction of Cas12a protein expression vector and expression of Cas12a protein

Competent cells were taken from Rosseta (DE 3) and thawed on ice. mu.L of plasmid 6His-MBP-TEV-huLbCpf1 (Addge) into which the Cas12a coding sequence has been inserted is taken and added to 50. Mu.L of competent cells, ice-cooled for 30min, then heat-shocked at 42 ℃ for 45s, rapidly and smoothly put back into ice for 2min, 700. Mu.L of sterile medium without antibiotics is added, the mixture is mixed uniformly, shaking culture is carried out at 37 ℃ for 1 h, about 50. Mu.L of bacterial liquid is sucked and evenly spread on LB agar medium plates containing 100mg/L ampicillin and 30mg/L chloramphenicol, and culture is carried out overnight at 37 ℃. Colonies were picked, transferred to medium containing 100mg/L ampicillin and 30mg/L chloramphenicol, and cultured overnight.

25mL of the saturated bacterial solution was added to 1L of a medium containing 100mg/L ampicillin and 30mg/L chloramphenicol and 0.2% glucose, and cultured at 37 ℃ until the OD value became about 0.5 to 0.6, followed by addition of IPTG (final concentration of 0.1 mM) and expression at 18 ℃ overnight. Centrifuge at 5000g for 10 min at 4 deg.C, discard the supernatant and store at-80 deg.C. Approximately 25 to 30g of cells can be harvested per 4L of the bacterial suspension.

Example 2: extraction of Cas12a protein

The cells were thawed on ice, and lysis buffer (50 mM Tris-HCl, pH =8.0, 20mM imidazole, 300mM nacl,0.5mM tcep,0.25mg/ml lysozyme, 1. After the ultrasonic treatment is finished, centrifuging at 40000g for 1.5h at a high speed, sucking supernatant, and reserving a small amount of samples for subsequent protein electrophoresis. The supernatant was used in the following purification experiment.

Example 3: purification of Cas12a protein using two nickel and heparin columns

The following buffers were used in the purification process:

buffer a (50 mM Tris-HCl, pH =8.0, 20mM imidazole, 300mM nacl,0.5mM TCEP);

buffer B (50 mM Tris-HCl, pH =8.0, 300mM imidazole, 300mM nacl,0.5mM TCEP);

buffer C (20mM HEPES,0.5mM TCEP,100mM NaCl);

buffer D (2M NaCl,20mM HEPES,0.5mM TCEP, pH = 8);

buffer E (20 mM Tris-HCl, pH 7.5,200mM NaCl,10% (v/v) glycerol).

The specific purification steps are as follows:

(1) Coarse purity of nickel column

Firstly, washing 5 column volumes by using a peristaltic pump, then balancing 5 column volumes of Histrap HP by using a buffer solution A, then loading the supernatant obtained in the embodiment 2 by using the peristaltic pump, wherein the sample loading amount is about 100-150 mL, reserving the buffer solution A for electrophoresis, washing 5-10 column volumes by using the buffer solution A after the sample loading is finished, then placing a nickel column on AKTA Pure25M (Cytiva) to continuously wash until the UV 280 is stable, then starting linear elution, setting the elution parameter to be 100% by using a buffer solution B pump after the elution parameter is set to 40min, setting the flow rate to be 1.8mL/min, and merging and collecting protein peak samples after the elution is stable as a sample 1.

(2) Dialysis and digestion

And (3) testing the protein concentration, adding Tobacco Etch Virus (TEV) protease (self-made) according to the mass ratio of (8-10) to 100, carrying out enzyme digestion for 16-24 h at 4 ℃, and replacing the buffer solution with buffer solution C by dialysis to obtain a sample 2.

Flow-through liquid, washing liquid, protein peak sample (sample 1) in the crude extraction process of the nickel column in the step (1) and the sample after TEV enzyme digestion are detected by PAGE gel electrophoresis and Coomassie brilliant blue staining, and the result is shown in FIG. 1A. As can be seen from the results in fig. 1A, there is still a Cas12a protein with a tag after TEV cleavage that is not completely cleaved (as shown by the arrow in fig. 1A). For further purification, cas12a protein that was not cleaved completely was removed and a second nickel column purification was performed.

(3) Secondary nickel column purification

Imidazole was added to the protein-containing buffer solution C to a final concentration of 20mM, and then the flow-through was collected on the nickel column as sample 3.

To verify the results of the secondary nickel column purification, sample 2 was run through the sample with the elution and flow of the secondary nickel column, as detected by PAGE gel and coomassie blue staining, and the results are shown in figure 1B. As can be seen from the results in FIG. 1B, after the secondary nickel column purification, the protein which is not completely digested is substantially removed, and the protein purity is greatly improved.

However, it was found that although the purity was improved, the UV peak of the sample appeared to be multimodal, indicating the presence of protein polymers.

(4) Heparin column breaking high polymer

To eliminate protein polymers, the flow-through was loaded onto a heparin column, followed by linear elution with buffer D, and the eluate was collected and concentrated by replacing buffer E with buffer c, sample 4.

(5) Protein electrophoresis

The samples at each stage were subjected to protein electrophoresis.

In this process, two nickel column purifications were used, and a heparin column was performed to break down the polymer, which took about 36 hours, yielding about 55mg of Cas12a protein.

(6) Protein hyperaggregation assay

The Increate 200 column was equilibrated with buffer E (20 mM Tris-HCl, pH 7.5,200mM NaCl,20% (v/v) glycerol and 1mM TCEP), and then samples 3 and 4 were injected into the channel through 500. Mu.L sample loops, respectively, and the presence or absence of protein polymers in the samples was detected by analyzing the UV absorption peak waveform at a wavelength of 280nm, and the results are shown in FIG. 2.

Fig. 2A shows the chromatographic peak of sample 4 and fig. 2B the chromatographic peak of sample 3. As can be seen from FIG. 2, the sample 4 obtained by passing through the heparin column has no precipitation and high polymerization, and has high ultraviolet absorption peak and obvious main peak, which indicates that high-purity monomeric protein with higher yield can be obtained; while the sample 3 without heparin column purification shows a phenomenon of aggregation of a large amount of proteins, the ultraviolet absorption peak is low and the same protein shows multiple peaks, which indicates that the sample 3 without heparin column purification has a large amount of protein polymers.

Example 4: purification of Cas12a protein using primary nickel column plus molecular sieve

Purification was performed using the buffer of example 3, according to the following procedure:

(1) Coarse purity of nickel column

Firstly, washing 5 column volumes by using a peristaltic pump, then balancing 5 column volumes of Histrap HP by using a buffer solution A, then loading a sample by using the peristaltic pump, wherein the loading amount is about 100-150 mL, temporarily keeping flow-through for electrophoresis, washing 5-10 column volumes by using the buffer solution A after loading the sample, then placing a nickel column on AKTA Pure25M (Cytiva) to continuously wash until UV 280 is stable, then starting linear elution, setting the elution parameters to 40min, enabling a buffer solution B pump to reach 100%, enabling the flow rate to be 1.8mL/min, and collecting a protein peak after the elution is stable at a base line.

(2) Dialysis and digestion

Adding Tobacco Etch Virus (TEV) protease (self-made) according to the proportion of (8-10) to 100, carrying out enzyme digestion for 16-24 h at 4 ℃, and simultaneously replacing the buffer solution with buffer solution C by dialysis.

(3) Molecular sieve purification

The Increate 200 column was equilibrated with buffer E (20 mM Tris-HCl, pH 7.5,200mM NaCl,20% (v/v) glycerol and 1mM TCEP) and the sample was then injected into the flow path through a 500. Mu.L sample loop.

(4) Heparin column breaking high polymer

Loading the flow-through to a heparin column, then performing linear elution by using a buffer solution D, collecting eluent, and replacing the buffer solution by a concentrated mode to obtain a buffer solution E which is a sample 5.

The above purification process takes about 60 hours, yielding about 36mg of Cas12a protein. Moreover, it can also be seen from the results of example 3 that the molecular sieve purification step also fails to remove high polymers of the Cas12a protein.

Example 5 detection of activity of purified Cas12a protein

A final concentration of 100nM Cas12a,125nM gRNA (UAAUUUCUACUACUAAGUGUAGAUUCCUUGAGUUCAGA, SEQ ID NO. 2), 500nM FAM-TTATT-BHQ1 probe was prepared in 1 XNEB buffer 2.1 (B7202S), incubated at 37 ℃ for 60min and fluorescence data recorded using ABI 7500.

By the above procedure, cas12a protein of sample 3 (secondary nickel column) and sample 4 (secondary nickel column plus heparin column) in example 3, sample 5 (primary nickel column plus heparin column plus molecular sieve) in example 4, and the activity of the purchased Cas12a protein were tested, and the results are shown in fig. 3.

As can be seen from fig. 3, the Cas12a protein activity of sample 4 obtained by secondary nickel column plus heparin column purification is significantly higher than that of sample 3 obtained by secondary nickel column purification. This indicates that protein hyper-aggregation has a great influence on activity, and the activity of Cas12a protein without passing through heparin column is far lower than that of Cas12a protein without high polymer due to the appearance of high polymer. In addition, the activity of sample 4, which was purified by the secondary nickel column plus heparin column, was also higher than that of sample 5, which was purified by the single nickel column plus heparin column and molecular sieve.

The technical solution of the present invention is not limited to the limitations of the above specific embodiments, and all technical modifications made according to the technical solution of the present invention fall within the protection scope of the present invention.

Sequence listing

<110> institute of geochemistry of Chinese academy of sciences

<120> a method for purifying Cas12a protein

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1228

<212> PRT

<213> Homo sapiens

<400> 1

Met Ser Lys Leu Glu Lys Phe Thr Asn Cys Tyr Ser Leu Ser Lys Thr

1 5 10 15

Leu Arg Phe Lys Ala Ile Pro Val Gly Lys Thr Gln Glu Asn Ile Asp

20 25 30

Asn Lys Arg Leu Leu Val Glu Asp Glu Lys Arg Ala Glu Asp Tyr Lys

35 40 45

Gly Val Lys Lys Leu Leu Asp Arg Tyr Tyr Leu Ser Phe Ile Asn Asp

50 55 60

Val Leu His Ser Ile Lys Leu Lys Asn Leu Asn Asn Tyr Ile Ser Leu

65 70 75 80

Phe Arg Lys Lys Thr Arg Thr Glu Lys Glu Asn Lys Glu Leu Glu Asn

85 90 95

Leu Glu Ile Asn Leu Arg Lys Glu Ile Ala Lys Ala Phe Lys Gly Asn

100 105 110

Glu Gly Tyr Lys Ser Leu Phe Lys Lys Asp Ile Ile Glu Thr Ile Leu

115 120 125

Pro Glu Phe Leu Asp Asp Lys Asp Glu Ile Ala Leu Val Asn Ser Phe

130 135 140

Asn Gly Phe Thr Thr Ala Phe Thr Gly Phe Phe Asp Asn Arg Glu Asn

145 150 155 160

Met Phe Ser Glu Glu Ala Lys Ser Thr Ser Ile Ala Phe Arg Cys Ile

165 170 175

Asn Glu Asn Leu Thr Arg Tyr Ile Ser Asn Met Asp Ile Phe Glu Lys

180 185 190

Val Asp Ala Ile Phe Asp Lys His Glu Val Gln Glu Ile Lys Glu Lys

195 200 205

Ile Leu Asn Ser Asp Tyr Asp Val Glu Asp Phe Phe Glu Gly Glu Phe

210 215 220

Phe Asn Phe Val Leu Thr Gln Glu Gly Ile Asp Val Tyr Asn Ala Ile

225 230 235 240

Ile Gly Gly Phe Val Thr Glu Ser Gly Glu Lys Ile Lys Gly Leu Asn

245 250 255

Glu Tyr Ile Asn Leu Tyr Asn Gln Lys Thr Lys Gln Lys Leu Pro Lys

260 265 270

Phe Lys Pro Leu Tyr Lys Gln Val Leu Ser Asp Arg Glu Ser Leu Ser

275 280 285

Phe Tyr Gly Glu Gly Tyr Thr Ser Asp Glu Glu Val Leu Glu Val Phe

290 295 300

Arg Asn Thr Leu Asn Lys Asn Ser Glu Ile Phe Ser Ser Ile Lys Lys

305 310 315 320

Leu Glu Lys Leu Phe Lys Asn Phe Asp Glu Tyr Ser Ser Ala Gly Ile

325 330 335

Phe Val Lys Asn Gly Pro Ala Ile Ser Thr Ile Ser Lys Asp Ile Phe

340 345 350

Gly Glu Trp Asn Val Ile Arg Asp Lys Trp Asn Ala Glu Tyr Asp Asp

355 360 365

Ile His Leu Lys Lys Lys Ala Val Val Thr Glu Lys Tyr Glu Asp Asp

370 375 380

Arg Arg Lys Ser Phe Lys Lys Ile Gly Ser Phe Ser Leu Glu Gln Leu

385 390 395 400

Gln Glu Tyr Ala Asp Ala Asp Leu Ser Val Val Glu Lys Leu Lys Glu

405 410 415

Ile Ile Ile Gln Lys Val Asp Glu Ile Tyr Lys Val Tyr Gly Ser Ser

420 425 430

Glu Lys Leu Phe Asp Ala Asp Phe Val Leu Glu Lys Ser Leu Lys Lys

435 440 445

Asn Asp Ala Val Val Ala Ile Met Lys Asp Leu Leu Asp Ser Val Lys

450 455 460

Ser Phe Glu Asn Tyr Ile Lys Ala Phe Phe Gly Glu Gly Lys Glu Thr

465 470 475 480

Asn Arg Asp Glu Ser Phe Tyr Gly Asp Phe Val Leu Ala Tyr Asp Ile

485 490 495

Leu Leu Lys Val Asp His Ile Tyr Asp Ala Ile Arg Asn Tyr Val Thr

500 505 510

Gln Lys Pro Tyr Ser Lys Asp Lys Phe Lys Leu Tyr Phe Gln Asn Pro

515 520 525

Gln Phe Met Gly Gly Trp Asp Lys Asp Lys Glu Thr Asp Tyr Arg Ala

530 535 540

Thr Ile Leu Arg Tyr Gly Ser Lys Tyr Tyr Leu Ala Ile Met Asp Lys

545 550 555 560

Lys Tyr Ala Lys Cys Leu Gln Lys Ile Asp Lys Asp Asp Val Asn Gly

565 570 575

Asn Tyr Glu Lys Ile Asn Tyr Lys Leu Leu Pro Gly Pro Asn Lys Met

580 585 590

Leu Pro Lys Val Phe Phe Ser Lys Lys Trp Met Ala Tyr Tyr Asn Pro

595 600 605

Ser Glu Asp Ile Gln Lys Ile Tyr Lys Asn Gly Thr Phe Lys Lys Gly

610 615 620

Asp Met Phe Asn Leu Asn Asp Cys His Lys Leu Ile Asp Phe Phe Lys

625 630 635 640

Asp Ser Ile Ser Arg Tyr Pro Lys Trp Ser Asn Ala Tyr Asp Phe Asn

645 650 655

Phe Ser Glu Thr Glu Lys Tyr Lys Asp Ile Ala Gly Phe Tyr Arg Glu

660 665 670

Val Glu Glu Gln Gly Tyr Lys Val Ser Phe Glu Ser Ala Ser Lys Lys

675 680 685

Glu Val Asp Lys Leu Val Glu Glu Gly Lys Leu Tyr Met Phe Gln Ile

690 695 700

Tyr Asn Lys Asp Phe Ser Asp Lys Ser His Gly Thr Pro Asn Leu His

705 710 715 720

Thr Met Tyr Phe Lys Leu Leu Phe Asp Glu Asn Asn His Gly Gln Ile

725 730 735

Arg Leu Ser Gly Gly Ala Glu Leu Phe Met Arg Arg Ala Ser Leu Lys

740 745 750

Lys Glu Glu Leu Val Val His Pro Ala Asn Ser Pro Ile Ala Asn Lys

755 760 765

Asn Pro Asp Asn Pro Lys Lys Thr Thr Thr Leu Ser Tyr Asp Val Tyr

770 775 780

Lys Asp Lys Arg Phe Ser Glu Asp Gln Tyr Glu Leu His Ile Pro Ile

785 790 795 800

Ala Ile Asn Lys Cys Pro Lys Asn Ile Phe Lys Ile Asn Thr Glu Val

805 810 815

Arg Val Leu Leu Lys His Asp Asp Asn Pro Tyr Val Ile Gly Ile Asp

820 825 830

Arg Gly Glu Arg Asn Leu Leu Tyr Ile Val Val Val Asp Gly Lys Gly

835 840 845

Asn Ile Val Glu Gln Tyr Ser Leu Asn Glu Ile Ile Asn Asn Phe Asn

850 855 860

Gly Ile Arg Ile Lys Thr Asp Tyr His Ser Leu Leu Asp Lys Lys Glu

865 870 875 880

Lys Glu Arg Phe Glu Ala Arg Gln Asn Trp Thr Ser Ile Glu Asn Ile

885 890 895

Lys Glu Leu Lys Ala Gly Tyr Ile Ser Gln Val Val His Lys Ile Cys

900 905 910

Glu Leu Val Glu Lys Tyr Asp Ala Val Ile Ala Leu Glu Asp Leu Asn

915 920 925

Ser Gly Phe Lys Asn Ser Arg Val Lys Val Glu Lys Gln Val Tyr Gln

930 935 940

Lys Phe Glu Lys Met Leu Ile Asp Lys Leu Asn Tyr Met Val Asp Lys

945 950 955 960

Lys Ser Asn Pro Cys Ala Thr Gly Gly Ala Leu Lys Gly Tyr Gln Ile

965 970 975

Thr Asn Lys Phe Glu Ser Phe Lys Ser Met Ser Thr Gln Asn Gly Phe

980 985 990

Ile Phe Tyr Ile Pro Ala Trp Leu Thr Ser Lys Ile Asp Pro Ser Thr

995 1000 1005

Gly Phe Val Asn Leu Leu Lys Thr Lys Tyr Thr Ser Ile Ala Asp Ser

1010 1015 1020

Lys Lys Phe Ile Ser Ser Phe Asp Arg Ile Met Tyr Val Pro Glu Glu

1025 1030 1035 1040

Asp Leu Phe Glu Phe Ala Leu Asp Tyr Lys Asn Phe Ser Arg Thr Asp

1045 1050 1055

Ala Asp Tyr Ile Lys Lys Trp Lys Leu Tyr Ser Tyr Gly Asn Arg Ile

1060 1065 1070

Arg Ile Phe Arg Asn Pro Lys Lys Asn Asn Val Phe Asp Trp Glu Glu

1075 1080 1085

Val Cys Leu Thr Ser Ala Tyr Lys Glu Leu Phe Asn Lys Tyr Gly Ile

1090 1095 1100

Asn Tyr Gln Gln Gly Asp Ile Arg Ala Leu Leu Cys Glu Gln Ser Asp

1105 1110 1115 1120

Lys Ala Phe Tyr Ser Ser Phe Met Ala Leu Met Ser Leu Met Leu Gln

1125 1130 1135

Met Arg Asn Ser Ile Thr Gly Arg Thr Asp Val Asp Phe Leu Ile Ser

1140 1145 1150

Pro Val Lys Asn Ser Asp Gly Ile Phe Tyr Asp Ser Arg Asn Tyr Glu

1155 1160 1165

Ala Gln Glu Asn Ala Ile Leu Pro Lys Asn Ala Asp Ala Asn Gly Ala

1170 1175 1180

Tyr Asn Ile Ala Arg Lys Val Leu Trp Ala Ile Gly Gln Phe Lys Lys

1185 1190 1195 1200

Ala Glu Asp Glu Lys Leu Asp Lys Val Lys Ile Ala Ile Ser Asn Lys

1205 1210 1215

Glu Trp Leu Glu Tyr Ala Gln Thr Ser Val Lys His

1220 1225

<210> 2

<211> 41

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

uaauuucuac uaaguguaga uuccugcuua gugauuucag a 41

Claims (2)

1. A method of purifying a Cas12a protein, the method comprising: expressing a Cas12a protein with a His tag through bacteria to obtain a supernatant containing the Cas12a protein; then purifying the supernatant using a first nickel column, after the first nickel column purification, performing enzymatic cleavage using tobacco etch virus protease to cleave the His-tag from the His-tagged Cas12a protein to obtain an enzymatically cleaved protein solution, and then purifying the enzymatically cleaved protein solution using a second nickel column and a heparin column to obtain a purified Cas12a protein;

wherein the method does not include gel filtration purification, and the Cas12a protein includes the amino acid sequence shown in SEQ ID No. 1;

in the purification step of the first nickel column, linear elution was performed at 1.8mL/min using a first buffer and a second buffer;

the proportion of the second buffer in the elution buffer increases from 0% to 100% over a period of 40 min;

the pH value of the first buffer solution and/or the second buffer solution is 8.0;

the first buffer comprises 50mM Tris-HCl, 20mM imidazole, 300mM NaCl,0.5mM TCEP;

the second buffer comprises 50mM Tris-HCl, 300mM imidazole, 300mM NaCl,0.5mM TCEP.

2. The method of claim 1, wherein the His-tag is attached at the N-terminus or C-terminus of the Cas12a protein.

Images