CN118414425A

CN118414425A - Joint and application thereof in construction of DNB library

Info

Publication number: CN118414425A
Application number: CN202280085459.9A
Authority: CN
Inventors: 王业钦; 杨林; 欧日晶; 杨贵芳; 吕硕; 聂自豪; 张韶红; 张艳艳; 陈芳
Original assignee: MGI Tech Co Ltd
Current assignee: MGI Tech Co Ltd
Priority date: 2022-01-20
Filing date: 2022-01-20
Publication date: 2024-07-30
Also published as: WO2023137667A1

Abstract

A linker comprising linker 1, linker 2 and anchor primer and use thereof in constructing a DNB library; wherein the nucleic acid sequences at both ends of the anchor primer are complementary to the nucleic acid sequences of the linker 1 and the linker 2, respectively. The construction of DNB library by using the connector can complete one-step library preparation, and has extremely high cost performance compared with other methods; the sample with various loading amounts can be adapted, and the adaptation forms are diversified; it can also be used to capture double-stranded DNA and perform double-stranded sequencing.

Description

Joint and application thereof in construction of DNB library

Technical Field

The invention belongs to the field of bioengineering, and particularly relates to a connector and application thereof in construction of DNB library.

Background

In recent years, the library-building sequencing technology is rapidly developed, life science based on sequencing and explanation shows infinite charm, and the method has irreplaceable advantages in the fields of molecular breeding, pathogen prevention and control or precise health and the like. There are a plurality of sequencing platforms on the market at present, and the Huada DNBSeq platform is unique in terms of high cost performance and high accuracy. There are many new and practical technical inventions in the aspect of library construction, and most of them can be classified into two types. The PCR amplification process has high enrichment, extremely high adaptability to micro sample and hot spot SNP, and can obtain high-quality data at extremely low cost. The PCR technique itself may introduce false bases and subsequently over-amplify such errors, resulting in reduced data accuracy. Secondly, PCR amplification (PCR Free) is not carried out, the technology avoids errors caused by amplification, and real sample information can be obtained. The complete PCR Free technique has stringent sample requirements, cumbersome steps, and high cost costs, compressing the desire for its needs.

Library construction techniques based on DNBseq platforms now classify by amplification or not.

For library construction techniques requiring amplification, such as conventional WGS library construction, it is necessary to perform quality detection, disruption, fragment quality inspection after disruption, end repair, fragment double selection purification, fragment quality inspection, adaptor ligation and purification, amplification purification and quantification on sample nucleic acids, and finally complete on-machine preparation for cyclization, digestion and DNB preparation. If a probe capture procedure is involved, longer time and more expensive costs are required; for example, amplicon library construction techniques, which preferentially perform PCR enrichment and purification of the template once followed by a second PCR enrichment, linker addition and purification, library quality identification, and cyclization, digestion, and pre-machine preparation.

For library construction techniques that do not require amplification, such as PCR Free library construction, it requires quality detection quantification, disruption, fragment quality inspection after disruption, fragment double selection purification, double selection fragment quality inspection, end repair, linker ligation and purification, ligation product quality inspection, and finally, on-machine preparation for circularization, digestion and DNB preparation.

The existing library building technology has a series of defects. For example, the library construction process is very lengthy, and amplicon library construction, WGS library construction, or PCR Free library construction may be completed in 8-12 hours, whereas it takes longer to complete the library construction involving probe capture. Plus the different types of sequencing that follow, the time of one cycle is too long, greatly affecting efficiency. The cost penalty required for WGS and PCR Free is far greater than amplicon pooling. Some researchers are reluctant to select amplicon for library construction due to uncontrolled errors introduced by amplification, but suffer from excessive cost, and a compromise is to select low-level amplification and combine with other methods for library construction. But this approach still does not address the accuracy, cost, and time issues.

Disclosure of Invention

The invention aims to solve the technical problem of providing a connector and application thereof, in particular to application in rapid construction of a single-chain annular library. The invention develops a novel joint and a corresponding library-building sequencing method, and the library-building sequencing method is simpler and more convenient, can reflect original information of a sample more truly, and can meet the requirements of the field with higher cost performance.

The invention mainly solves the technical problems through the following technical scheme.

The invention provides a linker comprising a linker 1, a linker 2 and an anchor primer; wherein the nucleic acid sequences at both ends of the anchor primer are complementary to the nucleic acid sequences of the linker 1 and the linker 2, respectively.

Wherein, said linker 1 and said linker 2 preferably each comprise one or more tag sequences, reverse complement sequences, and sequencing primer binding sequences; the 5' end of the connector is provided with phosphorylation modification, and the 3' end is locked and exposes at least one T base after annealing and combining with the reverse complementary sequence of the 5' end;

the two ends of the anchor primer respectively contain a capturing sequence complementary to the connector 1 and the connector 2 and a section of single-stranded nucleic acid structural sequence.

In a preferred embodiment of the invention, the linker 1 further comprises 1 or 2 tag primer binding sequences.

In a preferred embodiment of the invention, the linker 2 further comprises 1 or 2 tag primer binding sequences.

In another preferred embodiment of the invention, both said linker 1 and said linker 2 further comprise 1 or 2 tag primer binding sequences.

The label primer binding sequence and the sequencing primer binding sequence are limiting factors of a sequencing platform, and can be correspondingly adjusted according to the sequencing platform or a belief analysis.

In a preferred embodiment of the invention, the reverse complement within the linker 1 and the linker 2 is a 5-10bp lock.

In the invention, the connector 1 and the connector 2 can respectively form a hairpin structure through the reverse complementary sequence annealing under the condition of proper conditions.

In the invention, the length of the connector and the length range of the anchor primer can be adjusted to adapt to the actual reservoir construction situation. Wherein the length of the anchor primer is determined based on the length of the insertion library.

In a preferred embodiment of the invention, the anchor primer is a single stranded nucleic acid sequence of greater than 35bp in length, e.g., 35-200bp, e.g., 75bp in length; the length of the capturing sequence of the anchor primer is 15-25bp, and the length of the single-chain structure sequence of the anchor primer is designed according to the length of the fragment of the library to be detected.

In a preferred embodiment of the invention, the single stranded structural sequence of the anchor primer is 35-55bp.

The invention also provides a kit for constructing a sequencing library comprising adaptor 1, adaptor 2 and an anchor primer as defined above.

Preferably, the kit further comprises a polymerase.

In a preferred embodiment of the invention, the molar ratio of the adaptor 1, the adaptor 2 and the anchor primer is 1:1:1.

In a more preferred embodiment of the invention, the kit further comprises other solutions conventionally used in the art, such as 5 XSET Buffer and NF Water, etc.

The kit is typically prepared in the form of a serial connector complex dilution during use.

In a preferred embodiment of the present invention, the method for preparing the adaptor complex diluent comprises the steps of:

(1) Mixing 12.5. Mu.L of the adaptor 1 at a concentration of 100. Mu.M, 12.5. Mu.L of the adaptor 2 at a concentration of 100. Mu.M, and 3. Mu.L of 5 XSET Buffer, and performing a reaction in a PCR apparatus;

(2) The reaction was performed in a PCR instrument by adding 12.5. Mu.L of the anchor primer at a concentration of 100. Mu.M, and 2. Mu.L of 5 XSET Buffer and 7.5. Mu.L of NF Water.

Wherein the reaction conditions in step (1) are preferably: 95℃for 5min,70℃for 5min,45℃for 5min,25℃for 5min.

The reaction conditions in step (2) are preferably: 15min at 25 ℃.

The invention also provides a method of constructing a sequencing library, the method comprising:

(1) Preparation of the linker complex: mixing and incubating the adaptors 1 and 2 as defined above with an anchor primer to obtain a adaptor complex;

(2) Performing a ligation reaction on the nucleic acid fragment to be detected and the adaptor complex in the step (1), wherein the ligation reaction further comprises ligase;

(3) Obtaining a single-stranded circular library.

Preferably, the nucleic acid fragment is selected from: the nucleic acid fragments obtained by genome disruption, PCR products, free nucleic acid fragments and reverse transcription products.

The invention also provides a method for simultaneously detecting the sense strand and the antisense strand of a nucleic acid comprising:

(1) Constructing a single-stranded circular library using the method described above;

(2) The single-stranded circular library is amplified and subjected to nucleic acid sequence determination, and complementary sense and antisense strands are identified based on information of the tag sequence in the sequencing data.

The technical scheme of the invention is as follows:

1. A novel adaptor complex structure (figure 1) is formed by combining a tag adaptor 1, a tag adaptor 2 and an anchor primer, and can capture and store DNA fragments with 5-end phosphorylation and 3-end A-base cohesive ends;

2. Tag connector 1 (adapter 1, fig. 2): the adaptor is formed by combining one or more labels, a label primer binding sequence, a section of complementary structure and a sequencing primer binding sequence, wherein the 5 'end of the adaptor is provided with phosphorylation modification, and the 3' end is locked after renaturation binding and exposes a T base for pairing connection;

3. tag connector 2 (adapter 2, fig. 3): the adaptor is formed by combining one or more labels, a label primer binding sequence, a section of complementary structure and a sequencing primer binding sequence, wherein the 5 'end of the adaptor is provided with phosphorylation modification, and the 3' end is locked after renaturation binding and exposes a T base for pairing connection;

4. an anchor primer (Link, fig. 4): the primer contains two sections of nucleic acid sequences which are respectively complementary with the connector 1 and the connector 2, and one section of single-stranded nucleic acid sequence can simultaneously capture and anchor two connectors which are correspondingly designed to form an arch structure and can be used as a primer for preparing the DNA nanospheres subsequently;

5. A method for preparing a joint compound by two-step annealing reaction and a preparation method of a buffer solution for preparing DNA nanospheres;

6. An amplification method capable of adding an A base at the 3-end of an amplicon product;

7. A multiplex PCR primer capture method using multiple 5-terminal phosphorylated primers;

8. A method for preparing 5-terminal-free phosphorylated double-stranded DNA into 5-terminal-phosphorylated double-stranded DNA;

9. A method for rapidly obtaining a directly sequencable DNB library based on a linker complex by mixing and reacting DNA or PCR products fragmented and end-repaired with A with the linker complex and a reaction buffer (FIG. 5).

The invention has the positive progress effects that:

1. The lengthy process is shortened, a plurality of operations in the middle link are omitted, and the one-step library preparation is completed; the method greatly compresses the flow and the cost, is simple and efficient to operate, has extremely short time consumption, and has extremely high cost performance compared with other methods;

2. Samples with various loads can be adapted, and the adaptation forms are diversified. The kit can be used in combination with amplicon library establishment when a very small amount of samples is available, and can be used for library establishment in a PCR Free form when the sample amount is sufficient, so that the kit has good compatibility and autonomous selectivity; the PCR link can be omitted for samples with better quality, and the PCR amplification steps can be reduced for samples with poorer quality and trace quantity; the sample size is low in demand, good in compatibility and high in accuracy;

3. Double-stranded DNA can be captured and double-stranded sequencing can be performed, the original double-stranded information of a sample can be completely reserved in a double-stranded combined library-building sequencing mode, the authenticity of the sample information is kept to the maximum extent, and new application can be expanded according to special requirements.

Drawings

FIG. 1 is a schematic representation of novel linker complex ligation.

Fig. 2 shows a connector adapter 1.

Fig. 3 is a connector adapter2.

Fig. 4 is a joint Link.

Fig. 5 is a library building flow.

FIG. 6 is a distribution diagram of the size of a broken DNA product.

FIG. 7 is an electrophoretogram of the amplified product of DNB verification.

FIG. 8 is a 6X GAPDH PRIMER mix gel electrophoresis.

Detailed Description

Example 1

Step 1: three primers of adapter 1, adapter2 and Link were synthesized in advance and diluted to 100. Mu.L with TE (Productivity, cat. No. B548106-0500). Annealing the primer dilution of the Adapter 1 and the primer dilution of the Adapter2 by taking the mixture of the Adapter 1 (100 mu M)/12.5 mu L+the Adapter2 (100 mu M)/12.5 mu L and 5 XSET Buffer (BGI)/3 mu L, placing the mixture on a PCR instrument for reaction, and taking out and centrifuging after the reaction is finished, wherein the program is' 95 ℃ for 5min,70 ℃ for 5min,45 ℃ for 5min,25 ℃ for 5min and 4 ℃; link (100. Mu.M)/12.5. Mu.L, 5 XSET Buffer/2. Mu.L, NF Water/7.5. Mu.L were then added and reacted on a PCR apparatus with a procedure of '25℃for 15min and 4℃for storage' "to give the linker diluent (25. Mu.M) required for the method. Mix joint dilution (25. Mu.M)/8. Mu.L, 10 XPhi 29Buffer (Thermo, cat. B62)/40. Mu.L, NF Water (Invitrogen, cat. AM 9932)/152. Mu.L, and prepare a Make DNB Buffer for use.

Step 2: the DNA sample was fragmented using Hieff NGS OnePot DNA Fragmentation Reagent (assist Saint, cat. No. 13474ES 96) by "sample DNA/150ng, onePot mix/7.5. Mu.L, NF water UP to 30. Mu.L; 30℃for 10min,65℃for 20min, and 4℃for storage (thermal cover set at 70 ℃) ". Taking out the treated sample DNA, centrifuging and performing one-time simple purification, wherein the operation is that 27 mu L (0.9X) magnetic beads (VAZYME, product number N411-03) are added to the reaction product of the previous step, fully and uniformly mixed and placed at room temperature for 5min; then placing the mixture on a magnetic rack for adsorption for 2min, and removing the supernatant; adding 80% ethanol, rinsing for one time, and air drying until the surface of the magnetic bead is rough; adding 22 μl TE (product number B548106-0500), mixing, eluting, and retaining supernatant; 1 μl was used for quantitative concentration using Qubit DSDNA HS ASSAY KIT (Invitrogen, cat No. Q32854), total yield required to be greater than 30ng for use.

Step 3: pre-sequencing DNB preparation, which was performed by "taking 20 μl of the Make DNB buffer prepared in step one, mixing with 30ng of the product obtained in step 2, adding DNB polymerase I (MGI, 1000004803)/40 μl, T4 DNA LIGASE (repaid) (enzymatic, cat No. L6030-HC-L) 1 μl, supplementing to 80 μl with NF Water, 10min at 25 ℃, and preserving at 4 ℃ (hot lid set 35 °); after the completion of the reaction, the reaction mixture was centrifuged, DNB polymerase II (MGI, 1000017261)/4. Mu.L was added, and the mixture was stored at 30℃for 25 minutes and at 4℃until the total volume was 84. Mu.L and the temperature was set at 35 ℃. After the reaction is finished, 2 mu L of the sample is quantified by using Qubit SSDNA ASSAY KIT (Invitrogen, product number Q10212), and the sample with the concentration of more than 8ng is a qualified library, and can be used for sequencing by an MGI sequencing platform.

Example 2

Step 1: and (3) preparing a Make DNB buffer for standby according to the method of the step 1 in the first experimental method.

Step 2: PCR amplicon library preparation was performed, where two preparation modes were recommended based on different laboratory conditions. The first combination was 5-terminal phosphorylated F and R primers, template and Taq enzyme (TaKaRa, cat. R001A), and the second combination was conventional F and R primers, template and Taq enzyme, T4 polynucleotide kinase (Thermo, cat. EK 0031). The preparation method comprises the steps of diluting each F primer and each R primer to 25 mu M respectively, and mixing the F primer and the R primer in an equimolar amount according to the proportion of 1:1 for standby; mix primer/4. Mu.L, 2 XM. Mu. Ltiplex PCR Readymix (BGI, cat. No. 1000014386)/25. Mu.L, sample/1 ng, NF Water/UP to 50. Mu.L; the amplification procedure was 95 ℃/3min,1 cycle; 95 ℃/20s,60 ℃/20s,72 ℃/30s,30 cycles; 72 ℃/10min, one cycle; preserving at 12 ℃. The process can be optimized according to the self condition without specific requirements, but the product needs to be ensured to be fully extended so that the terminal of the product is added with A, and the connection is convenient. The treated sample DNA was removed, centrifuged and purified once, and it was operated as: taking the reaction product of the previous step, adding 40 mu L (0.8X) magnetic beads, fully mixing uniformly and standing at room temperature for 5min; then placing the mixture on a magnetic rack for adsorption for 2min, and removing the supernatant; adding 80% ethanol for rinsing once and discarding the supernatant; adding 80% ethanol, rinsing for one time, and air drying until the surface of the magnetic bead is rough; adding 22 mu L TE, uniformly mixing and eluting, and reserving supernatant; 1 μl was used for quantitative concentration using Qubit DSDNA HS ASSAY KIT, and the total yield was greater than 30ng for use.

Step 3: pre-sequencing DNB preparation, according to the situation described in step two, we need to be split into two modes of preparation. For the first combinatorial amplicon library, we were directly prepared according to step four of method one. In the second combination, we need to change the procedure to "take 20. Mu.L of Make DNB buffer prepared in step one, mix with 30ng of the product obtained in step three, add DNB polymerase I/40. Mu.L, T4 DNA LIGASE (repaid) 1. Mu.L, T4 polynucleotide kinase 1. Mu.L, make up to 80. Mu.L with NF Water, 15min at 30℃and preserve (hot cap set 35 ℃); after the completion of the reaction, the reaction mixture was centrifuged, DNB polymerase II/4. Mu.L was added thereto, and the mixture was stored at 30℃for 25 minutes at 4℃until the total volume was 84. Mu.L and the temperature of the heat cover was set at 35 ℃. And after the reaction is finished, 2 mu L of the sample is quantified by using Qubit SSDNA ASSAY KIT, and the sample with the concentration of more than 8ng is a qualified library and can be used for sequencing by an MGI sequencing platform.

Primer sequences for three structural parts, one example of which is used to describe the assay:

Adapter 1：

5phos·TCCCCCTAAGTCAGCTCAGTACGTCAGCAGTTCGTGATACACGCTCACAGAACGACATGGCTACGATCCGACGTAAGGGGGAT(SEQ ID NO:1)

Adapter 2：

5phos·GAAAAAGTTAACTCTGATAAGGTCGCCATGCATCAAGTGCCTAAGTCGGAGGCCAAGCGGTCTTAGGAAGACAATCTTTTTCT(SEQ ID NO:2)

Link：

designing a pair of capture product verification primers, and detecting the connected products:

F1:CAGAACGACATGGCTACGATCCGACGT(SEQ ID NO:16)

R1:TGCATGGCGACCTTATCAGAGTTA(SEQ ID NO:17)

six pairs of multiplex PCR amplification primers were designed to capture 6 fragments of the GAPDH gene using human DNA (NA 12878, BGI) as template:

GAPDH-1F：CCCCGGTTTCTATAAATTGAGC(SEQ ID NO:4)

GAPDH-1R：CGCTTGGCCTCCGACTTGAACTCACCCGTTGACTCCG(SEQ ID NO:5)

GAPDH-2F：CTCCTCTGCGACACGTGA(SEQ ID NO:6)

GAPDH-2R：CGCTTGGCCTCCGACTTGTTCTCTCCCTCCGCGCA(SEQ ID NO:7)

GAPDH-3F：CAGGAGGTCCCTACTCCCG(SEQ ID NO:8)

GAPDH-3R：CGCTTGGCCTCCGACTTGAGAATAATCTAGGAAAAGCATCACCCG(SEQ ID NO:9)

GAPDH-4F：CCCAATCCTCCCGGTGACAT(SEQ ID NO:10)

GAPDH-4R：CGCTTGGCCTCCGACTTATGGGTGGAGTCGCGTGT(SEQ ID NO:11)

GAPDH-5F：ATCAATGACCCCTTCATTGA(SEQ ID NO:12)

GAPDH-5R：CGCTTGGCCTCCGACTTGATCTCGCTCCTGGAAGAT(SEQ ID NO:13)

GAPDH-6F：TAAGCAGTTGGTGGTGCA(SEQ ID NO:14)

GAPDH-6R：CGCTTGGCCTCCGACTTCTTCACCACCATGGAGAAG (SEQ ID NO:15)

one additional set of six pairs of primers, each modified by phosphorylation, were synthesized:

GAPDH-1F：5phos-CCCCGGTTTCTATAAATTGAGC(SEQ ID NO:4)

GAPDH-1R：5phos-CGCTTGGCCTCCGACTTGAACTCACCCGTTGACTCCG(SEQ ID NO:5)

GAPDH-2F：5phos-CTCCTCTGCGACACGTGA(SEQ ID NO:6)

GAPDH-2R：5phos-CGCTTGGCCTCCGACTTGTTCTCTCCCTCCGCGCA(SEQ ID NO:7)

GAPDH-3F：5phos-CAGGAGGTCCCTACTCCCG(SEQ ID NO:8)

GAPDH-3R：5phos-CGCTTGGCCTCCGACTTGAGAATAATCTAGGAAAAGCATCACCCG(SEQ ID NO:9)

GAPDH-4F：5phos-CCCAATCCTCCCGGTGACAT(SEQ ID NO:10)

GAPDH-4R：5phos-CGCTTGGCCTCCGACTTATGGGTGGAGTCGCGTGT(SEQ ID NO:11)

GAPDH-5F：5phos-ATCAATGACCCCTTCATTGA(SEQ ID NO:12)

GAPDH-5R：5phos-CGCTTGGCCTCCGACTTGATCTCGCTCCTGGAAGAT(SEQ ID NO:13)

GAPDH-6F：5phos-TAAGCAGTTGGTGGTGCA(SEQ ID NO:14)

GAPDH-6R：5phos-CGCTTGGCCTCCGACTTCTTCACCACCATGGAGAAG(SEQ ID NO:15)

primers used in this protocol were all synthesized by Jin Weizhi (su).

The experiment was performed according to experiment one. Three 150ng DNA samples were treated according to step 2 to give the desired concentrations and total amounts of the products shown in Table 1. To facilitate subsequent validation, we performed a one-time fragment size detection of the cleavage products using agilent 2100 (high sensitivity) (fig. 6).

TABLE 1

150Ng sample

1

2

3

Breaking recovery concentration ng/. Mu.L	4.42	4.38	4.51
Recovery of the total amount ng	88.4	87.6	90.2

DNB preparation is carried out on the broken product obtained in the last step according to the step 3, the concentration is shown in the table 2, and the broken product meets the requirement of on-machine. To verify that DNB was correct, DNB was amplified using a pair of quality control primers (F1/R1) and checked by electrophoresis on a 1% agarose gel for expected amplified product size (FIG. 7).

TABLE 2

Sample of	1	2	3
DNB concentration ng/. Mu.L	22.4	19.7	23.3

Sequencing the library using the MGI-2000 platform and supplementing the data of a conventional flow library (MGIEasy Universal DNA library preparation kit) as a comparison, analyzing the data GC_Content and mapping_Rate using BWA; the results of analysis of Raw_Q30, raw_Reads, clean_ Reads and Clean_Rate using Soapnuke are shown in Table 3.

TABLE 3 Table 3

Sample of	Raw_Q30	GC_Content	Raw_Reads	Clean_Reads	Clean_Rate	Mapping_Rate
1	95.04％	43.34％	34309037	34248909	99.72％	99.35％
2	95.09％	43.36％	34326210	34266052	99.77％	99.40％
3	95.16％	43.39％	34350207	34290007	99.84％	99.47％
MGIEasy	95.14％	43.38％	34343337	34283149	99.82％	99.45％

The data of the machine is displayed that the result obtained by sequencing by the method has good consistency with the result obtained by the conventional method.

According to the experiment method II, six pairs of amplification primers are mixed and amplified, three parallel repeats are performed on samples with different concentrations, 1% agarose gel electrophoresis is performed on PCR products, maker 100 is compared (TIANGEN, product number MD 109), an electrophoresis chart (figure 8) shows that the PCR products are bright in strips and have the sizes in accordance with expectations, negative control is free of strips, the experiment results are normal, and the concentration and total amount of the products are shown in table 4:

TABLE 4 Table 4

Sample input amounts of 1ng, 2.5ng, 5ng, 7.5ng and 10ng of the conventional primer PCR product and the phosphorylating primer PCR product are respectively taken for DNB preparation, and the concentrations are shown in the table 5, and all meet the requirements.

TABLE 5

Sample group	1Ng conventional group	2.5Ng conventional group	5Ng conventional group	7.5Ng conventional group	10Ng conventional group
DNB concentration ng/. Mu.L	18.9	21.7	20.6	21.3	23.6
Sample group	1ng-phos	2.5ng-phos	5ng-phos	7.5ng-phos	10ng-phos
DNB concentration ng/. Mu.L	19.8	23.2	25.7	20.4	22.8

Sequencing the library using the MGI-2000 platform and supplementing the data of a conventional flow library (MGIEasy Universal DNA library preparation kit) as a comparison, analyzing the data GC_Content and mapping_Rate using BWA; the results of analysis of Raw_Q30, raw_Reads, clean_ Reads and Clean_Rate using Soapnuke are shown in Table 6.

TABLE 6

While particular embodiments of the present invention have been described above, it will be appreciated by those skilled in the art that these are merely illustrative, and that many changes and modifications may be made to these embodiments without departing from the principles and spirit of the invention. Accordingly, the scope of the invention is defined by the appended claims.

Claims

A linker comprising linker 1, linker 2 and an anchor primer; wherein the nucleic acid sequences at both ends of the anchor primer are complementary to the nucleic acid sequences of the linker 1 and the linker 2, respectively.
The adapter of claim 1, wherein each of the adapter 1 and adapter 2 comprises one or more of a tag sequence, a reverse complement sequence, and a sequencing primer binding sequence; wherein, the 5' end has phosphorylation modification, and the 3' end is locked and exposes at least one T base after annealing and combining with the reverse complementary sequence of the 5' end;

the two ends of the anchor primer respectively contain a capturing sequence complementary to the connector 1 and the connector 2 and a section of single-stranded nucleic acid structural sequence.
The linker of claim 2, wherein said linker 1 further comprises 1 or 2 tag primer binding sequences;

and/or, the adaptor 2 further comprises 1 or 2 tag primer binding sequences.
The linker of claim 2 wherein the reverse complement within said linker 1 and said linker 2 is a 5-10bp lock.
The linker of any one of claims 1 to 4, wherein said linker 1 and said linker 2 are annealed by said reverse complement sequences, respectively, under suitable conditions to form a hairpin structure.
The adapter of any one of claims 1-4, wherein the anchor primer is a single-stranded nucleic acid sequence with a length of greater than 35bp, the capture sequence of the anchor primer is 15-25bp, and the single-stranded structural sequence of the anchor primer is designed according to the length of the fragment of the library to be tested;

the length of the single-stranded structural sequence of the anchor primer is preferably 35-55bp.
Kit for constructing a sequencing library, characterized in that it comprises a linker 1, a linker 2 and an anchor primer as defined in any one of claims 1 to 6;

Preferably, the kit further comprises a polymerase.
The kit of claim 7, wherein the molar ratio of the adaptor 1, the adaptor 2 and the anchor primer is 1:1:1.
A method of constructing a sequencing library, the method comprising:

(1) Preparation of the linker complex: mixing and incubating the adaptors 1 and 2 as defined in any one of claims 1 to 6 with an anchor primer to obtain a adaptor complex;

(2) Performing a ligation reaction on the nucleic acid fragment to be detected and the adaptor complex in the step (1), wherein the ligation reaction further comprises ligase; preferably, the nucleic acid fragment to be detected is selected from the group consisting of: a nucleic acid fragment obtained by genome disruption, a PCR product, a reverse transcription product and a free nucleic acid fragment;

(3) Obtaining a single-stranded circular library.
A method of simultaneously detecting the sense strand and the antisense strand of a nucleic acid, comprising:

(1) Constructing a single-stranded circular library using the method of claim 9;

(2) The single-stranded circular library is amplified and subjected to nucleic acid sequence determination, and complementary sense and antisense strands are identified based on information of the tag sequence in the sequencing data.