CN118389580A - Application of ABH gene in regulation of plant salt stress resistance - Google Patents

Abstract

The invention discloses application of an ABH gene in regulating and controlling plant salt stress resistance, and belongs to the technical field of plant genetic engineering. The gene VITIS VINIFERA uncharacterized LOC100251931 with unknown functions on the chromosome 6 of the grape is subjected to intensive research, and the gene is found to be capable of negatively regulating and controlling the tolerance of the grape to salt stress, can be used as a novel grape salt tolerance related gene, provides a theoretical basis for breeding a grape salt tolerance variety, and provides a novel thought for a cultivation technology for relieving grape salt damage.

Description

Application of ABH gene in regulating plant salt stress resistance

Technical Field

The present invention relates to the technical field of plant genetic engineering, and in particular to the use of ABH gene in regulating plant salt stress resistance.

Background technique

Grape (Vitis vinifera L.) is a deciduous vine plant belonging to the genus Vitis in the family Vitaceae. It is one of the fruits with the largest cultivated area and the longest cultivation history. Its wide cultivation range and rich processed products have created huge economic and ecological benefits for society. With the change of global climate, soil salinization has become an important limiting factor for the sustainable development of the grape industry. When grapes face salt stress, the osmotic potential will increase, which will inhibit the water absorption of the plants. In addition, the ion toxicity caused by excessive accumulation of Na ⁺ , Mg ²⁺ , Cl ^- , etc. will eventually affect the yield and quality of grapes. Therefore, improving the tolerance of grapes to salt stress has become an urgent problem to be solved in grape cultivation.

When grapes face salt stress, molecular regulation is a relatively basic and critical step. Exploring the molecular regulatory mechanism of grapes under salt stress can provide a solid theoretical basis for revealing the mechanism of grape salt tolerance and provide candidate genes for the breeding of salt-tolerant varieties. In recent years, many researchers have discovered many transcription factors that respond to salt stress in grapes through transcriptome sequencing technology, such as VvMYC2, which improves the germination rate of transgenic Arabidopsis under salt stress. VvWRKY2, VlWRKY3, VvWRKY30, and VvNAC17 improve the tolerance of transgenic tobacco or Arabidopsis to salt stress. In addition to transcription factors, genes that respond to salt stress in grapes through different pathways are also gradually being discovered. For example, overexpression of VvSNAT 1 enhances Arabidopsis melatonin synthesis and ROS scavenging ability, thereby improving tolerance to salt stress. VvKCS11 improves Arabidopsis salt tolerance by regulating ion transporters and channels, the accumulation of osmotic regulatory substances, and membrane stability.

However, the current research on the mechanism of grape salt tolerance is still insufficient, and at the molecular level, new genes related to grape stress tolerance still need to be further discovered.

Summary of the invention

In view of the above prior art, the purpose of the present invention is to provide the use of ABH gene in regulating plant salt stress resistance. The present invention has found that silencing ABH gene in grape can improve the resistance of grape to salt stress, providing a new candidate gene for the breeding of salt-resistant grape varieties.

To achieve the above object, the present invention adopts the following technical solution:

The first aspect of the present invention provides the use of the ABH gene as a negative regulatory gene in the following (1) or (2):

(1) Improve plant resistance to salt stress;

(2) Cultivate salt-tolerant plant varieties;

The ABH gene is a DNA molecule as shown in the following i) or ii) or iii):

i) the nucleotide sequence is the DNA molecule shown in SEQ ID NO.1;

ii) a DNA molecule encoding the amino acid sequence shown in SEQ ID NO.2 other than i);

iii) a DNA molecule that has 90% or more identity with the DNA fragment defined in i) or ii), and encodes a protein that is functionally equivalent to the protein shown in SEQ ID NO.2.

The term "identity" as used herein refers to sequence similarity to a natural nucleic acid sequence. Homology can be evaluated using computer software, such as the BLAST algorithm (Altschul et al. 1990. Journal of Molecular Biology 215: 403-410; Karlin and Altschul. 1993. Proceedings of the National Academy of Sciences 90: 5873-5877).

In the above nucleic acid molecules, the 90% or more homology may be at least 90%, 92%, 93%, 95%, 96%, 98% or 99% homology.

The second aspect of the present invention provides the use of a protein encoded by the ABH gene as a negative regulatory factor in the following (1) or (2):

(1) Improve plant resistance to salt stress;

(2) Prepare products that improve the salt tolerance of plants.

In the above application, the amino acid sequence of the protein encoded by the ABH gene is shown in SEQ ID NO.2.

The third aspect of the present invention provides the use of a recombinant expression vector, a transgenic cell line or a genetically engineered bacterium containing an ABH gene in the following (1) or (2):

(1) Improve plant resistance to salt stress;

(2) Cultivate salt-tolerant plant varieties.

In the above application, the recombinant expression vector can be constructed using existing plant expression vectors or prokaryotic expression vectors, such as pHB, pCXUN, pCAMBIA1300, pTA7001, pTA7002, pBin, PET-30a, PMAL-C2X, pGEX-4T or other derivative vectors.

In the above application, the plant is preferably grape.

In the above application, the ABH gene or the protein encoded by the ABH gene is used as the target. By silencing the ABH gene or inactivating the protein encoded by the ABH gene, the resistance of grapes to salt stress is improved, thereby broadening the application of grapes in soil salinization improvement.

A fourth aspect of the present invention provides a method for improving the tolerance of grapes to salt stress, comprising the following steps:

Knock out or silence the ABH gene in grapes.

In the above methods, gene knockout refers to the phenomenon of inactivating a specific target gene by homologous recombination. Gene knockout is the inactivation of a specific target gene by changing the DNA sequence.

Gene silencing refers to the phenomenon of making a gene non-expressed or low-expressed without damaging the original DNA. Gene silencing is based on the premise of not changing the DNA sequence, making the gene non-expressed or low-expressed. Gene silencing can occur at two levels. One is gene silencing at the transcriptional level caused by DNA methylation, heterochromatinization, and position effects; the other is post-transcriptional gene silencing, that is, inactivating the gene by specifically inhibiting the target RNA at the level after gene transcription, including antisense RNA, co-suppression, RNA interference (RNAi), and microRNA (miRNA)-mediated translation inhibition.

A fifth aspect of the present invention provides a method for cultivating salt-resistant grape varieties, comprising the following steps:

Knocking out or silencing the ABH gene in a wild-type grape plant to obtain a transgenic grape plant, wherein the transgenic grape plant has a higher resistance to salt stress than the wild-type grape plant;

The transgenic grape plants are used as parents for self-pollination, or hybridized with other grape plants to obtain grape varieties with improved salt resistance.

Beneficial effects of the present invention:

The present invention conducts in-depth research on a gene Vitis viniferauncharacterized LOC100251931 with unknown function located on chromosome 6 of grape, and finds that the gene can negatively regulate the tolerance of grape to salt stress, and can be used as a new salt-tolerance-related gene of grape, which provides a theoretical basis for the breeding of salt-tolerant grape varieties and a new idea for the cultivation technology to alleviate salt damage of grapes.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG1 : Expression of the grape ABH gene of the present invention at different time points after salt stress.

Figure 2: Resistance to salt stress after silencing of the grape ABH gene of the present invention; wherein, the left figure shows the growth conditions of ABH-silenced (ABH-RNAi) grape plants and control grape plants under salt stress conditions; the right figure shows the root weight and aboveground weight of ABH-silenced (ABH-RNAi) grape plants and control grape plants under salt stress conditions (the average value of data measured on multiple plants).

Detailed ways

It should be noted that the following detailed descriptions are illustrative and are intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which the present application belongs.

As mentioned above, the physiological disorders of grapes caused by salinized soil are becoming more and more obvious, seriously affecting the normal growth and development of grapes, fruit yield and quality. Therefore, it is urgent to discover new genes related to grape stress tolerance.

In view of this, the present invention has conducted an in-depth study on genes related to salt stress tolerance in the grape genome. Vitis vinifera uncharacterized LOC100251931 (NCBI Reference Sequence: XM_002285585.5) is a gene with unknown function located on chromosome 6 of grape. In order to study its function, the present invention first cloned the gene from grapes and named the cloned gene as ABH gene. The nucleotide sequence of the coding region of the ABH gene is shown in SEQ ID NO.1, which is as follows:

ATGGCTTGTCTGGTTGAGTCCTCCACAGTTGAAACCAGTGATGGCATCAAGCTCCATACAAGGGTCTTCAAACCAAGGGAGGAGATCAAGGACAACTTGGTGGTTGTTCTGGTGCATCCTTACTCAGTCTTGGGTGGTTGTCAGGCCCTTGTGAAGGGGATTGCTCTTGGGTTAGCAGAAAAAGGCTACAGAGCTGTGACCTTTGACATGAGAGGCGCCGGAAGATCCACAGGAAGGCCTTCTCTTACTGGGTTTTCAGAAA TCAAGGATGTGGTTGCTGTCTGCAAATGGGTCTGTGACAATCTTTCTCTGATAGGATTTTGTTGGTGG GTTCTTCTGCAGGAGCACCTATTGCAGGATCCGCGGTAAATCAGATTGAACAAGTGGTGGGCTATGTGAGTCTGGGGTACCCATTCGGCTTGATGGCCTCAATCCTCTTTGGCCGCCACCACAAAGCCATCCTGCAGTTCCCGAAACCTAAACTCTTTGTCATGGGGACTCAGGATGGGTTCACCAGCGTTAAGCAGCTGAGGAACAAGCTGAGCTCTGCAGCAGGCCATGTTGAGACCCACCTTATCGAAGGAGCA GGCCACTTCCAAATGGAAGGGCCAGCTTATGATGCCCAGATGGCAGATAAGATCACAGAATTCATCCCCAAACTG TAG.

The amino acid sequence of the protein encoded by the ABH gene is shown in SEQ ID NO.2, which is as follows:

MACLVESSTVETSDGIKLHTRVFKPREEIKDNLVVVLVHPYSVLGGCQALLKGIALGLAEKGYRAVTFDMRGAGRSTGRPSLTGFSEIKDVVAVCKWVCDNLSSDRILLVGSSAGAPIAGSAVNQIEQVVGYVSLGYPFGLMASILFGRHHKAILQFPKPKLFVMGTQDGFTSVKQLRNKLSSAAGHIETHLIEGAGHFQMEGPAYDAQMA DKITEFIPKL.

The present invention selects the ABH gene as a research object and finds that the expression level of the gene changes under salt stress conditions, thereby inferring that the gene may respond to the salt stress resistance of grapes.

In order to further study the function of the ABH gene, the present invention constructed an ABH gene silencing vector and introduced the ABH gene silencing vector into grapes to obtain transgenic plants with ABH gene silencing. The results showed that the growth of grapes with ABH gene silencing under salt stress was significantly higher than that of the control. The above results show that the grape ABH gene can play a salt resistance function in plants and is a new salt-resistant gene in grapes related to resisting salt stress, thus proposing the present invention.

In order to enable those skilled in the art to more clearly understand the technical solution of the present application, the technical solution of the present application will be described in detail below in conjunction with specific embodiments.

The experimental materials used in the examples of the present invention without specific description are all conventional experimental materials in the field and can be purchased through commercial channels. If the specific experimental conditions and methods are not specified in the examples of the present invention, conventional conditions are usually followed, such as J. Sambrook et al., ed., Science Press, 2002, Molecular Cloning Experiment Guide (3rd Edition); D.L. Spector et al., ed., Science Press, 2001, Cell Experiment Guide; or the conditions recommended by the manufacturer.

Example 1: Cloning of grape ABH gene

1. Plant materials:

The material used in the present invention is 'SA15' grape rootstock seedling.

2. RNA extraction and reverse transcription:

Grape leaves were collected for RNA extraction. Total RNA was extracted using RNAprep Pure Polysaccharide and Polyphenol Plant Total RNA Extraction Kit (DP441) according to the instructions, and 1 μg RNA was reverse transcribed into cDNA using TaKaRa PrimeScript ^TM RT reagent Kit (PerfectReal Time).

3. Cloning and verification of ABH gene:

Primers were designed based on the gene with NCBI accession number XM_002285585.5:

ABH-F: 5′-ATGGCTTGTCTGGTTGAGTCCT-3′ (SEQ ID NO. 3);

ABH-F: 5'-CTACAGTTTGGGGATGAATTCTGTG-3' (SEQ ID NO. 4).

PCR reaction was performed using PrimeSTAR Max Premix high-fidelity enzyme according to the instructions, and the PCR product was ligated to Simple Cloning Vector (Beijing Quanshijin Biotechnology Co., Ltd.) was used to transform Escherichia coli DH5α, and positive single colonies were screened by colony PCR and sent to Sangon Biotechnology Co., Ltd. for sequencing. The nucleotide sequence of the cloned grape ABH gene is shown in SEQ ID NO.1.

Example 2: Expression of grape ABH gene at different salt treatment time points

1. Plant materials:

The ‘SA15’ grape seedlings were irrigated with 1L 100mM NaCl solution, which flowed out from the bottom of the flowerpot. The roots were then sampled at 1, 2, 3, 4, and 5h. The root sample taken before irrigation was marked as 0h. Three replicates were set up and the samples were quickly frozen in liquid nitrogen for storage.

2. RNA extraction and reverse transcription:

RNA was extracted from the root system and reverse transcribed to synthesize cDNA. The steps of RNA extraction and reverse transcription were the same as those in Example 1.

3. Changes in the expression of ABH genes at different salt treatment time points:

Specific primers were designed to perform real-time fluorescence quantitative PCR to analyze the expression changes of ABH at different salt treatment time points. The designed specific primers are as follows:

qABH-F: 5′-AATCAAGGATGTGGTTGCTGTCT-3′ (SEQ ID NO. 5);

qABH-R: 5′-AAGAGGATCGAGGCCATCAA-3′ (SEQ ID NO. 6).

The internal reference gene is ACTIN, and the primers are:

ACTIN-F: 5′-TCCGTTGTCCAGAAGTCCTCTT-3′ (SEQ ID NO. 7);

ACTIN-R: 5'-GTCAGCAATACCAGGGAACATG-3' (SEQ ID NO. 8).

4. Real-time fluorescence quantitative analysis of ABH gene in the sample to be tested:

Using cDNA as a template, specific primers for ABH and ACTIN were used for fluorescence quantitative analysis. The reaction was carried out in a real-time fluorescence quantitative PCR instrument (CFX connect Real Time PCR Detection System, Bio-Rad) using a 20 μL system (10 μL SYBR Premix Ex Taq, 1 μL each of upstream and downstream primers (10 μM), 1 μL cDNA template, filled up to 20 μL with water). The program was as follows: 95°C for 30 s; 95°C for 5 s, 60°C for 10 s, and 40 cycles.

5. Relative quantitative analysis of ABH using the 2- ^△△Ct method:

The results are shown in Figure 1. The results show that as the salt treatment time increases, the expression level of the ABH gene shows a trend of first decreasing and then increasing, indicating that the ABH gene can be differentially expressed in response to salt stress (Figure 1).

Example 3: Detection of salt resistance in grape ABH gene silenced plants

The pHB vector (described in the literature “MicroRNA171c-targeted SCL6-II, SCL6-III, and SCL6-IV genes regulate shoot branching in Arabidopsis, doi.org/10.1093/mp/ssq042”) was used to construct a silencing vector for the ABH gene. The primers are as follows:

ABH-1-F: 5′-ccagtctctctctcaATGGCTTGTCTGGTTGAGTCCT-3′ (SEQ ID NO.9)

ABH-1-R: 5′-ttgtattttactagtCAGCAACCACATCCTTGATTTCT-3′ (SEQ ID NO. 10)

ABH-2-F: 5′-aggatgtggttgctgACTAGTAAAATACAACACATGTTAATTGATACATT-3′ (SEQID NO.11)

ABH-2-R: 5′-aggatgtggttgctgGTTTATAGGTGCTTTAAAGTACTCAAATTG-3′ (SEQ ID NO. 12)

ABH-3-F: 5′-aaagcacctataaacCAGCAACCACATCCTTGATTTCT-3′ (SEQ ID NO. 13)

ABH-3-R: 5′-ctcctgcagctcgagATGGCTTGTCTGGTTGAGTCCT-3′ (SEQ ID NO. 14)

PrimeSTAR Max Premix high-fidelity enzyme was used for PCR reaction (in a 20 μL reaction system, 10 μL PrimeSTAR Master Mix, 1 μL each of upstream and downstream primers (10 μM), 1 μL template, and filled up to 20 μL with water) with the following program: 34 cycles of 98°C for 10 s, 55°C for 5 s, and 72°C for 10 s; extension at 72°C for 5 mins.

The three PCR products were separated by 1.5% agarose gel electrophoresis and purified using the SanPrep column DNA gel recovery kit (B518131, Sangon Biotechnology) according to standard operating procedures.

The pHB vector plasmid was treated with enzyme digestion, and the enzyme digestion reaction system was as follows:

The reaction solution was incubated at 37°C for 30 minutes, and then subjected to agarose gel electrophoresis and then cut and recovered.

The pHB and three ABH fragments after enzyme digestion were connected and the recombinant plasmid was transferred into E. coli DH5α according to the standard operation steps of the ClonExpress II One Step Cloning Kit. The positive clones were screened by colony PCR and sent to Sangon for sequencing. The single colony with correct sequencing was shaken overnight and the plasmid was extracted according to the standard instructions of the SanPrep column plasmid DNA small-scale extraction kit (Sangon Biotechnology). The plasmid containing the ABH silencing vector was obtained.

The ABH silencing vector plasmid was transferred into Cabernet Sauvignon grapes by Agrobacterium rhizogenes infection method. The method is as follows: cut a grape stem segment containing one bud eye, insert the lower incision into Agrobacterium, and infiltrate the stem segment with Agrobacterium rhizogenes (MSU440) infection solution containing the target vector by immersion penetration. The stem segment is cultured in sand and cuttage, and positive verification is performed after rooting. The grape seedlings (VvABH-RNAi) that have passed the positive verification are transplanted into flower pots. After normal growth, 100mM NaCl is irrigated, once every 7 days, 4 times, and 1L each time.

Wild grapes obtained by infection with empty plasmid were used as control (EV).

After 30 days of salt stress, photos were taken to observe the growth status of the grape plants; then the whole grape plant was taken out, the plant was cut off from the rhizome, the root system was cleaned and the surface moisture was absorbed with toilet paper, and the roots and the above-ground parts were weighed separately with an electronic balance.

The results are shown in Figure 2, which show that the growth of ABH-silenced (ABH-RNAi) grape plants was significantly higher than that of the control (EV); the aboveground weight and root weight of ABH-RNAi grape plants were higher than those of EV, that is, the ABH gene can negatively regulate salt resistance, and reducing the expression of the ABH gene can improve the salt resistance of the plant.

The above description is only the preferred embodiment of the present application and is not intended to limit the present application. For those skilled in the art, the present application may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims (6)

1. The use of abh gene as negative regulatory gene in (1) or (2) as follows:

   (1) Improving the resistance of the plant to salt stress;

   (2) Cultivating a salt-tolerant plant variety;

   the ABH gene is a DNA molecule shown in the following i) or ii) or iii):

   i) The nucleotide sequence is a DNA molecule shown in SEQ ID NO. 1;

   ii) a DNA molecule other than i) encoding the amino acid sequence shown in SEQ ID NO. 2;

   iii) A DNA molecule which has 90% or more identity to the DNA fragment defined in i) or ii) and which encodes a protein functionally equivalent to the protein shown in SEQ ID NO. 2.
2. Use of a protein encoded by the abh gene as a negative regulator in (1) or (2) as follows:

   (1) Improving the resistance of the plant to salt stress;

   (2) And preparing a product for improving the salt tolerance of plants.
3. 3. The use according to claim 2, wherein the amino acid sequence of the protein encoded by the ABH gene is shown in SEQ ID No. 2.
4. 4. The application of the recombinant expression vector containing the ABH gene, a transgenic cell line or genetically engineered bacteria in the following (1) or (2):

   (1) Improving the resistance of the plant to salt stress;

   (2) Cultivating salt-tolerant plant varieties.
5. 5. A method of increasing tolerance of a grape to salt stress comprising the steps of:

   ABH gene in grape was knocked out or silenced.
6. 6. A method of breeding a salt-tolerant grape variety, comprising the steps of:

   knocking out or silencing an ABH gene in a wild grape plant to obtain a transgenic grape plant, wherein the transgenic grape plant has higher resistance to salt stress than the wild grape plant;

   And (3) taking the grape transgenic plant as a parent to carry out selfing or hybridization with other grape plants to obtain the grape variety with improved salt resistance.