CN118360321B

CN118360321B - Application of pineapple AcAPX gene in delaying germination of rice seeds, resisting low temperature and promoting growth

Info

Publication number: CN118360321B
Application number: CN202410796311.7A
Authority: CN
Inventors: 侯晓婉; 鹿志伟; 张媛媛; 谷会; 姚全胜
Original assignee: South Subtropical Crops Research Institute CATAS
Current assignee: South Subtropical Crops Research Institute CATAS
Priority date: 2024-06-20
Filing date: 2024-06-20
Publication date: 2024-08-30
Anticipated expiration: 2044-06-20
Also published as: CN118360321A

Abstract

The invention discloses application of AcAPX gene in delaying germination of rice seeds and promoting growth. The pineapple AcAPX gene subcellular is positioned in cytoplasm, and over-expression of the pineapple AcAPX gene subcellular can effectively delay germination of rice seeds, reduce H ₂O₂ content, ROS content and MDA content in the germination process of the rice seeds, improve APX enzyme activity, reduce AsA content and GSH content in the later period of germination, effectively improve low-temperature weather resistance of rice, improve plant height of rice seedlings and promote rice growth. The invention provides a researched thought and a technical basis for delaying seed germination, improving plant weather resistance, regulating plant growth and the like.

Description

Application of pineapple AcAPX gene in delaying germination of rice seeds, resisting low temperature and promoting growth

Technical Field

The invention belongs to the technical field of biology, and particularly relates to application of pineapple AcAPX gene in delaying germination of rice seeds, resisting low temperature and promoting growth.

Background

Rice (Oryza sativa l.) is known as rice, an annual aquatic herb of the family poaceae, and has been a variety of annual rice. Rice is one of the important food crops for human beings, and the cultivation and eating histories are quite long. Half of the world's population is eating rice, mainly in asia, south europe and tropical america and africa.

The premature germination of rice seeds brings a series of harm, and the phenomenon of premature germination of rice seeds is serious, which directly affects the yield and quality of rice. Premature germination can result in the seeds beginning to grow before sowing, which not only consumes a great deal of nutrients, but also can result in the seeds not growing normally in the field, thereby affecting the overall yield. Prematurely germinated seeds are more susceptible to attack by pests. For example, seed soaking may kill some eggs and viruses, but if the seed germinates prematurely, these pests will have more opportunity to enter the soil and infect the seed. Early germinated seeds may encounter adverse growth conditions, such as low temperatures or flooding, after emergence, which can adversely affect seedling growth. In addition, premature germination of seeds may lead to yellowing, bending, etc. of the tips of the buds when they enter the salt-sensitive phase, and even death. Premature germination may also cause the seeds to go to a dormant state, affecting their normal germination and growth process. Premature germination of seeds may lead to early harvest time, which can affect seed maturity and commodity properties. If the seeds mature prematurely, the seeds may not be full and the germination vigor is not strong, which may further affect the quality and germination rate of the seeds. In northern areas, rice is not cold-resistant due to lower air temperature, so that rice growth is blocked, and yield is reduced. Therefore, developing rice varieties with functions of delaying rice seed germination, resisting low temperature and promoting growth has important significance.

Pineapple [ Ananas comosus (Linn.) Merr. ] is a perennial monocot She Changlu herb fruit tree of the genus pineapple of the family pineapple, and is one of three tropical fruits in the world. The inventor identifies 38 AsA-GSH antioxidant defense system key genes (12 AcAPX, 20 AcDHAR, 2 AcGR and 4 AcMDHAR) when researching pineapple black heart disease in the early stage, analyzes the occurrence process of black heart disease and the change of transcription level after ascorbic acid treatment, finds that the ascorbic acid treatment obviously enhances AcAPX1 gene expression, and finds that pineapple black heart disease index after AsA treatment is obviously positively correlated with AcAPX1 gene expression level, and AcAPX gene plays an important role in AsA delaying black heart disease deterioration. The AcAPX gene has various functions, and is transferred into other plants, and has no relevant report.

Disclosure of Invention

The invention aims to overcome the defects in the prior art and provides application of a pineapple AcAPX gene in delaying germination of rice seeds, resisting low temperature and promoting growth.

Application of pineapple AcAPX gene in delaying rice seed germination, wherein the ORF sequence of pineapple AcAPX gene is shown in SEQ ID NO: 1. as shown.

Further, acAPX gene reduces H ₂O₂ content and/or malondialdehyde content during rice seed germination.

Further, the AcAPX gene reduces the ascorbic acid content and/or the glutathione content in the late germination stage of rice seeds.

Furthermore, acAPX gene improves APX enzyme activity in rice seed germination process.

Application of pineapple AcAPX1 gene in improving rice low temperature tolerance, wherein the ORF sequence of pineapple AcAPX gene is shown in SEQ ID NO: 1. as shown.

Application of pineapple AcAPX1 gene in improving rice seedling height and/or promoting rice growth, wherein the ORF sequence of pineapple AcAPX gene is shown in SEQ ID NO:1. as shown.

A method for delaying germination of rice seeds is to transfer pineapple AcAPX gene into rice to obtain transgenic rice plants.

A method for improving low-temperature tolerance of rice is to transfer pineapple AcAPX gene into rice to obtain transgenic rice plant.

A method for increasing the plant height of rice seedlings and/or promoting the growth of rice features that pineapple AcAPX gene is transferred to rice to obtain transgenic rice plant.

The invention has the beneficial effects that: the pineapple AcAPX gene subcellular is positioned in cytoplasm, and the over-expression of the pineapple AcAPX gene subcellular can effectively delay the germination of rice seeds, reduce the MDA content of H ₂O₂ in the germination process of rice seeds, improve the activity of APX enzyme, reduce the AsA content and GSH content in the later period of germination, effectively improve the low-temperature tolerance of rice, improve the plant height of rice seedlings and promote the growth of rice. The invention provides a researched thought and a technical basis for improving and delaying seed germination, plant tolerance, regulating plant growth and the like.

Drawings

FIG. 1 shows colony PCR identification results.

FIG. 2 shows subcellular localization results.

FIG. 3 shows the results of the germination rate statistics of transgenic rice seeds.

FIG. 4 shows the results of detection of H ₂O₂ and MDA content in the germination stage of transgenic rice seeds.

FIG. 5 shows the results of detection of the AsA and GSH content in the germination stage of transgenic rice seeds.

FIG. 6 shows the results of APX enzyme activity detection in the germination stage of transgenic rice seeds.

FIG. 7 shows the growth of transgenic rice at various stages of low temperature stress treatment.

FIG. 8 shows the growth of transgenic rice under normal conditions.

Detailed Description

The invention will be further described with reference to specific embodiments in order to provide a better understanding of the invention. The specific techniques or conditions are not identified in the examples and are performed according to techniques or conditions described in the literature in this field or according to the product specifications. The reagents or apparatus used were conventional products commercially available without the manufacturer's attention.

1. Experimental materials and data analysis

(1) Plant material and method of treatment

Pineapple cultivar 'Bali' (Ananas comosus L. cv. Comte de Paris) was selected as the test material, and samples were collected from pineapple planting bases (1 DEG 10'2' 'N; 110 DEG 16'34'' E) of the national institute of tropical and southern crops, national academy of agricultural sciences. 'Nippon' Rice (Oryza Sativa L.) and Nicotiana benthamiana, offered by Wohan Bober biosciences, inc.

(2) Culture medium

① LB medium

Respectively weighing 10 g pancreatic protein, 10 g sodium chloride and 5g yeast extract, adding deionized water for full dissolution, and then fixing the volume to 1L to obtain an LB liquid medium, adding Agar (Agar) 15 g before fixing the volume to obtain an LB solid medium, adjusting the pH to 7.3 by using NaOH (2M), and sterilizing at 121 ℃ by high-pressure steam to obtain 20 min;

② 1/2 MS culture medium

Weighing MS culture medium powder 2.37 g, sucrose 30 g, adding deionized water, dissolving to constant volume to 1L, adjusting pH to 5.8 with KOH of 2M, adding 8g agar powder, and sterilizing with high pressure steam to set temperature: 121 ℃, time: 20 And (5) min.

(3) Statistical analysis of data

The present invention uses GRAPHPAD PRISM 9.0.0 for variance and correlation analysis of data, using Excel tab (deer shiwei et al, 2019).

2. Pineapple AcAPX Gene clone

(1) PCR amplification

Extracting pineapple pulp total RNA, reversely transcribing into cDNA, taking the cDNA as a template, and adopting a primer AcAPX-F: GATGCCATGGCGATGGGGAAGTCGTATCCGAC and AcAPX1-R: GGACTAGTAGCATCAGCAAACCCTAGCTC amplification of the full length CDS sequence of the AcAPX gene was performed using a DNA high fidelity polymerase kit (full gold). The reaction system is as follows: the template, primer F (10. Mu.M) and R (10. Mu.M) were each 50. Mu.L of the total system of 1 μL,5×TransStartd® FastPfu Buffer 10 μL,NTP(2.5 mM) 4 μL,TransStart® FastPfu DNA Polymerase 1 μL,ddH₂O 32 μL,. The reaction procedure is: pre-denaturation at 94℃for 4 min, denaturation at 94℃for 30 s, annealing at 55℃for 30 s, extension at 72℃for 1 min,35 cycles, final extension at 72℃for 7 min.

2) Glue recovery of fragments of interest

① Using a 2% agarose gel, 120V, electrophoresis 30min, detection of amplification results, excision of the DNA band of interest, placement in a 2 ml centrifuge tube, weighing (approximately 100. Mu.L according to gel weight 0.1 g, and so on);

② Adding 3 times of volume of solution GSB, and adding 1 time of volume of isopropanol solution after the solution is completely dissolved in metal bath glue 10 min at 55 ℃;

③ Transferring the gel solution into a centrifugal column, standing and adsorbing for 1 min, centrifuging for 1 min at 10,000 g, repeating the steps, and discarding the waste liquid. 650 μl of solution WB,10,000 g was added and centrifuged 1, 1 min, and the waste solution was discarded. 10,000 g centrifugation 2 min to thoroughly remove residual WB;

④ The column was placed in a clean centrifuge tube, the lid was opened and left to stand for 1 min, and ddH ₂ O40. Mu.L preheated at 65℃was added, and after 1.1 min, 10,000 g was allowed to centrifuge for 1.1 min, and the DNA was eluted and stored at-20 ℃.

(3) The gel recovery product was ligated into cloning vector pEASY-T1

After the concentration of the recovered gel product was measured, the recovered gel product was connected to the cloning vector pEASY-T1 in accordance with the reaction system of Table 1, reacted at room temperature for 30min, and placed in a refrigerator at-20℃for use.

TABLE 1 AcAPX1 and pEASY-T1 vector ligation System

(4) Transformation of E.coli by heat shock

The recombinant plasmid was transformed into E.coli, and the following operations were performed:

① Taking out the Trans-Tl competent cells stored in a refrigerator at the temperature of minus 80 ℃, adding a connecting product when just melting, flicking and uniformly mixing, and then carrying out ice bath 30 min;

② Heat shock at 42 ℃ is 30 s, ice bath 2 min;

③ Adding 250 μl of LB medium at room temperature, and culturing L h in shaking table 200 rpm at 37deg.C;

④ Mixing 40 μ L X-gal (20 mg. ML ^-1) and 8 μl IPTG (500 Mm), uniformly coating on LB plate, placing in incubator at 37deg.C, and standing for 30 min;

⑤ After the X-gal and IPTG are completely absorbed, centrifuging the cultured bacterial liquid under the condition of 1500 rpm for 1 min, discarding the supernatant, reserving 150 mu L of bacterial liquid, sucking and beating uniformly, coating on an LB plate containing corresponding antibiotics, and culturing overnight at 37 ℃;

⑥ After overnight incubation on the plate, white monoclonal was picked, placed in a PCR tube, colony PCR was performed with 10. Mu.L distilled water, positive clones were detected, and the reaction system and reaction procedure were as follows (Table 2, table 3):

TABLE 2 AcAPX1 Gene clone colony PCR reaction System

TABLE 3 AcAPX1 Gene clone colony PCR reaction procedure

After the PCR reaction is finished, detecting the size of a target band by 1% agarose gel electrophoresis, and if the size is correct, sending to sequencing, wherein the ORF sequence of the AcAPX gene is shown as SEQ ID No: 1. Inoculating the bacterial liquid with correct sequencing result into 5mL LB culture medium, culturing at 37deg.C and 200: 200 rpm overnight, adding 40% glycerol into 1: 1mL bacterial liquid to preserve strain, and preserving at-80deg.C.

Plasmid extraction of T1-AcAPX1 recombinant vector

Plasmid extraction was performed using easy pure @ PLASMID MINIPREP KIT, as follows:

① Taking bacterial liquid 2 mL cultured overnight in the step (4), centrifuging 1 min in a centrifuge tube at 10,000, 000 g, and discarding the supernatant;

② Sequentially adding 250 μl colorless solution RB (containing RNaseA), 250 μl blue solution LB, and 350 μl yellow solution NB into the tube, mixing to form coagulated mass, and standing for 2 min;

③ 12,000 g to 5 min, loading the supernatant into a centrifuge column; 12,000 g to centrifuge 1 min, discard waste liquid;

④ 650 μl of solution WB,12,000 g was added for centrifugation 1 min, and the waste solution was discarded; again 12,000 g centrifuged 2 min;

⑤ The centrifuge column was placed in a centrifuge tube of 1.5 mL, 40 μl EB (preheated at 65 ℃) was added in the center of the column, and left to stand for 1 min;

⑥ 10,000 g to centrifuge 1, 1 min, and the bottom solution is DNA, and the DNA is preserved at-20 ℃ for standby.

3. Subcellular localization of pineapple AcAPX1 gene

(1) Construction of pineapple over-expression pBI121-AcAPX1-GFP vector

① The pBI121-GFP vector was double digested with Xba I and BamH I restriction enzymes, and the specific reaction system (Table 4) and reaction conditions were as follows:

TABLE 4 pBI121+GFP vector double cleavage reaction System

The PCR amplification unit was run at 37℃for 30 min. The cut gel recovered a lower band of interest than the pBI121-GFP plasmid fragment.

② Redesigning an Xba I and BamH I homologous recombination primer F by taking a T1-AcAPX1 recombinant vector plasmid as a template: CACGGGGGACTCTAGATGGGGAAGTCGTATCCG and R: GTACCCCCGGGGATCCTAGCATCAGCAAACCCTAGC high fidelity enzyme amplification (same 2 PCR amplification system), the amplified products were linked to the restriction enzymes Xba I and BamH I cut linearized pBI121-GFP vector, based on the desired fragment concentration and vector ratio, according to the following system (Table 5, table 6):

TABLE 5 construction of reaction System by pBI121-AcAPX1-GFP vector

TABLE 6 construction of pBI121-AcAPX1-GFP vector reaction procedure

③ Transforming the product obtained in ② mu L into escherichia coli competence (the method is the same as above), culturing at 37 ℃ for 12h, and performing colony PCR identification;

④ Colony PCR was performed by synthesizing pBI 121-AcAPX-GFP identifying primers (F: ATGGGGAAGTCGTATCCG, R: AGCATCAGCAAACCCTAGC), with a target band of about 753 bp, and the results are shown in FIG. 1. Taking 100 mu L of bacterial liquid corresponding to positive strips, carrying out sample feeding and sequencing, inoculating the rest 400 mu L of bacterial liquid into LB containing 5-10 mL kana resistance, shaking bacteria, extracting plasmids from bacterial liquid with correct sequencing results, and storing the bacterial strains and plasmids into a low-temperature refrigerator at-80 ℃.

(2) Freeze thawing process of transforming agrobacterium

Agrobacterium EHA105 was transformed by freeze thawing, as follows:

① Placing EHA105 agrobacterium competent cells stored at-80 ℃ on ice for thawing;

② Adding 1 mug of recombinant plasmid when competent cells are just frozen, uniformly mixing, placing the mixture on ice for incubation of 10min, freezing with liquid nitrogen for 5 min, water-bath at 37 ℃ for 5 min, and finally incubating on ice for 5 min;

③ Adding 800 mu L of LB liquid medium, and culturing in a shaking incubator at 28 ℃ for 3 h;

④ 5,000 g to centrifuge 1, 1 min, and taking about 100 mu L of supernatant to re-suspend, and uniformly coating on LB solid medium plates of corresponding antibiotics;

⑤ After the liquid in the flat plate is completely absorbed, culturing for 2-3 d at 28 ℃.

(3) Subcellular localization

The obtained positive bacterial liquid (agrobacterium liquid containing pBI121-AcAPX1-GFP vector) is used for infecting the Nicotiana benthamiana, and the specific operation is as follows:

① Before infection, 5-week-old Nicotiana benthamiana seedlings were thoroughly watered. Sucking 100 μl of positive bacterial liquid to LB liquid culture medium containing rifampicin (Rif) and kana, shaking at 28deg.C and 200 rpm, centrifuging at 4deg.C when OD ₆₀₀ =1.015, 5,000 g, centrifuging at 10min, and discarding supernatant;

② Adding 10 mM MES,10 mM MgCl ₂ heavy suspension to resuspend, 4 ℃,5,000 g,10 min, discarding supernatant;

③ Add resuspension with 10mM MES,10 mM MgCl ₂ and 200 μm As to make OD ₆₀₀ =0.8, dark rest 3 h;

④ After the resuspension is sucked by a sterile syringe, the lower epidermis of the leaf back is injected, then the dark culture is carried out for 3d, the epidermis of the infected area is taken out for tabletting, and a laser confocal microscope is used for observation. The results are shown in FIG. 2, where subcellular localization showed AcAPX that was localized to the cytoplasm.

Genetic transformation of 4 pineapple AcAPX gene

(1) Construction of rice over-expression pBWA (V) KU-AcAPX1 vector

① Synthesis of target Gene

Recombinant amplification primer of pBWA (V) KU vector by taking T1-AcAPX1 recombinant vector plasmid as template

F：CAGTCGTCTCACAACATGGGGAAGTCGTATCCGAC；

R：CAGTGGTCTCATACATCAAGCATCAGCAAACCCTA。

Amplification of the target bands was performed according to the following reaction system and procedure (table 7, table 8):

TABLE 7 AcAPX1 target band amplification reaction System

TABLE 8 AcAPX1 mesh Strand amplification reaction procedure

1% Agarose gel electrophoresis, 5 v/cm voltage, 20min, detection of amplification results, and recovery and purification of cut gel. mu.L of ddH ₂ O was added to dissolve DNA (rAPX-G1), and after the detection was correct, ligation was performed with pBWA (V) KU-ccdB vector.

② The pBWA (V) KU vector and rAPX1-G1 were digested respectively by the following reaction system (Table 9), placed in a PCR apparatus at 37℃for reaction 1 h:

TABLE 9 cleavage reaction System

③ The pBWA (V) KU vectors obtained by digestion in ②, rDNAG, were combined, purified using a purification kit (product labeled rAPX 1-G2), and subjected to ligation, with the following specific reaction system (Table 10):

table 10 pBWA (V) KU Carrier + rDNAG1 ligation reaction System

Placed in a PCR amplification apparatus at 20℃and reacted at 1 h.

④ And (3) converting 5-10 mu L of the connection product into escherichia coli competent, culturing at 37 ℃ for 12h, and performing colony PCR identification.

⑤ PBWA (V) KU-ccdB universal primer 35seq: TTCATTTGGAGAGAACACGGGGGAC A

And NOSseq-R: CAAGACCGGCAACAGGATTCAATC, performing colony PCR identification. And extracting plasmids from the bacterial liquid with correct identification results to obtain the pBWA (V) KU-AcAPX1 vector.

(2) Freeze thawing process of transforming agrobacterium

Agrobacterium EHA105 was transformed by freeze thawing, as follows:

② Adding 1 mu g pBWA (V) KU-AcAPX1 carrier when competent cells are just frozen, uniformly mixing, placing on ice for incubation for 10 min, freezing with liquid nitrogen for 5min, water-bath for 5min at 37 ℃, and finally incubating on ice for 5 min;

③ Adding 800 mu L of LB liquid medium, and culturing for 3 hours at 28 ℃ in a shaking incubator;

⑤ After the liquid in the plate was completely absorbed, the plate was incubated at 28℃for 3d.

(3) Genetic transformation of rice

The genetic transformation procedure for rice is described in Zhang Yi (2011) and Zhao et al (2011).

① Selecting seeds of Nippon rice with consistent growth vigor and plump seeds, sequentially soaking and oscillating for 30 s with 75% alcohol, soaking and oscillating for 20min with 50% sodium hypochlorite, repeating for one time, finally washing with sterile water for 3 times, absorbing water, transferring to MS culture medium, and subculturing for 7 d after callus grows;

② Placing the positive bacterial liquid obtained in the part (2) on a shaking table of 200 rpm at 28 ℃, shaking the positive bacterial liquid greatly after shaking the positive bacterial liquid slightly at 36: 36 h, shaking the positive bacterial liquid at 28 ℃ and 200: 200 rpm until OD ₆₀₀ =0.6 is used for dip-dyeing the callus, transferring the positive bacterial liquid onto a co-culture medium, and culturing the positive bacterial liquid in a dark way at 22 ℃ for 4: 4 d;

③ Selecting callus with better growth vigor, cleaning 3 times with sterile water, adding NBL liquid culture medium containing cephalosporin (500 mg/L), cleaning 3 times, performing selective culture, culturing under dark light for 15 d, and culturing under dark for 15 d at 28deg.C;

④ Pre-differentiating culture dark culture 7d, differentiating dark culture 2d and light culture 14 d of the selected resistant callus; selecting a green spot resistant callus for subculture, and carrying out illumination culture on the selected green spot resistant callus at a temperature of 14 d ℃ and 28 ℃;

⑤ Transplanting the tissue of the grown seedling to rooting and seedling strengthening culture medium, and culturing under light of 14 d at 28 ℃. And (5) transplanting the seedlings to a field for planting after the seedlings grow well, receiving T0 generation seeds, and placing the seeds in a 28 ℃ incubator for one week for subsequent generation.

Screening and verification of 5 AcAPX1 transgenic positive seedlings

(1) Transgenic seed resistance selection and transgenic seedling DNA extraction

① Seed soaking and screening: selecting full T0 generation seeds, soaking the seeds in Kan solution containing 40 mg/l for 2-3 d, selecting white germination seedlings, transplanting the seedlings to a culture medium for 3 weeks, taking rice leaves, adding liquid nitrogen, rapidly placing the rice leaves in a grinder for full grinding, and preserving the rice leaves at-80 ℃ for later use;

② Sample lysis: 100 mg rice leaf powder was taken, 1 XCTAB lysate 1ml was added respectively, and after vortexing and mixing, 45 min was incubated in a 65℃metal bath.

③ DNA extraction: 500 μl of chloroform was added, mixed well by vortexing, centrifuged at room temperature 12000 rpm, and 10: 10 min.

④ Precipitation of DNA: mu.l of the upper DNA aqueous phase was pipetted into a new 2 ml centrifuge tube, equal amounts of isopropanol were added and mixed upside down. Centrifuge 5 min at room temperature 12,000 g and discard the supernatant.

⑤ Cleaning DNA impurities: after adding 500. Mu.l of 70% absolute ethanol, mixing the mixture upside down and re-suspending the milky DNA, centrifuging the mixture at room temperature by 12,000 g for 5 min, discarding the supernatant, and repeating the procedure twice.

⑥ Drying and preserving DNA: the lid was opened and placed in a fume hood for air drying 1h, 40. Mu.l of sterile ddH ₂ O was added, dissolved at room temperature and stored at-20℃for further use.

⑧ 10,000 Rpm to centrifuge 1, 1 min, repeating the above steps once, and obtaining the genomic DNA as the bottom solution.

(2) PCR screening of transgenic seedlings

PCR amplification was performed using Kan reporter gene amplification primers (Kan-F: GAATCGGGAGCGGCGATACC and Kan-R: CCACCAAGCGAAACATCGCAT) and target gene amplification primers (AcAPX-F: CAGTGGTCTCACAACATGGGGAAGTCCGAC and AcAPX1-R: CAGTGGTCTCATACATCAAGCATCAGCAAACCCT), respectively, to finally obtain 16 transgenic positive seedlings.

(3) Positive transgenic seedling RNA extraction

Positive transgenic seedling RNA was extracted using the rapid extraction kit for EASYspin plant RNA extraction of original Ping Hao. The specific method comprises the following steps:

① Fragmentation and lysis of samples: after each sample was ground with liquid nitrogen, 0.1 g was weighed into a 2 ml centrifuge tube, 500 μl of plant lysate was added, 50 μl of β -mercaptoethanol was added, and the mixture was vortexed and mixed well.

② RNA adsorption: the mixture after cleavage was applied to an RNA adsorption column, and after 2 min on ice, centrifuged at 12000rpm at 4℃for 30s, the filtrate was discarded.

③ And (3) RNA cleaning: adding 700 μl deproteinized solution, standing for 1 min, centrifuging at 12000 rpm at 4deg.C for 30 s, removing filtrate, adding 500 μl of rinsing solution, centrifuging at 12000 rpm at 4deg.C for 30 s, removing filtrate, and rinsing twice.

④ Removing the rinse solution: the column was placed in a new enzyme free 1.5 mL centrifuge tube by centrifugation at 13,000 g of empty tube at 4℃2 min.

⑤ RNA collection and preservation: after uncapping and leaving at room temperature 2 min, 50. Mu.l of RNase-free ddH ₂ O was added to the center of the column, and after leaving on ice 2 min, 2 min was centrifuged at 12,000 g at 4℃and the column was discarded.

⑥ The concentration of RNA in the centrifuge tube is measured by a nucleic acid measuring instrument, and the RNA can be appropriately packaged and stored in a refrigerator at-80 ℃ for later use.

(4) Rice cDNA reverse transcription

The cDNA was obtained according to the reaction system of Table 11, and the whole process was carried out on ice to obtain cDNA after completion of the reaction.

TABLE 11 reaction System for reverse transcription

(5) QPCR verification AcAPX gene

At QAPX, 1-F: TTGTTGCCGTGGAAGTTA and QAPX1-R: CGAAGAAAAGAGGATTGG is a primer, the RNA reverse transcription cDNA of the transgenic positive seedling is used as a template, qPCR verification is carried out on AcAPX gene in the transgenic seedling, and AcAPX-OE#4 and AcAPX1-OE#5 strains with obviously up-regulated expression are finally selected for subsequent experiments.

6 Transgenic Rice traits

(1) Germination and treatment of transgenic rice seeds

① Selecting 200 rice seeds of wild type (NIP) strains and AcAPX1-OE #4 strains and AcAPX1-OE #5 strains with neat and consistent grain types;

② The rice seeds were first soaked with 70% ethanol for 10 min, rinsed 2 times with ddH ₂ O (Li et al 2020), germinated in 20 cm X20 cm plates, and fully submerged;

③ Sucking redundant distilled water, adding 5 mL distilled water and 0.1% AsA (a layer of filter paper is filled in a glass dish, and 1/2 of seeds are immersed in the water), and placing in a 28 ℃ illumination incubator for germination acceleration under dark conditions;

④ Observing germination numbers at 0H, 24H, 48H, 72H and 96H, sampling, respectively taking 30 seeds, quick-freezing with liquid nitrogen, and storing in a refrigerator at-80deg.C for measuring hydrogen peroxide (H ₂O₂) content, malondialdehyde (MDA) content, ascorbic acid (AsA) content, glutathione (GSH) content and APX enzyme activity;

⑤ Germination index: embryo length of 0.5 mm was used as a standard for germination.

As shown in FIG. 3, the rice seeds of AcAPX-OE #4 and AcAPX-OE #5 lines germinate 24 and h later than NIP, and the germination rate of the over-expressed lines is obviously lower than that of NIP at all time points of germination, which indicates that the over-expression of AcAPX1 gene obviously delays the germination of the seeds.

(2) Determination of hydrogen peroxide (H ₂O₂) content and Malondialdehyde (MDA) content

The determination of the H ₂O₂ content refers to a Suzhou Ming kit, and comprises the following specific steps: ① Adding 1.1 mL (V2) acetone into 0.1 g tissue, grinding on ice, centrifuging at 4deg.C for 8,000, 000 g, and centrifuging for 10 min to obtain supernatant; ② Sequentially adding 250 mu L of a sample (V1), 25 mu L of a second reagent and 50 mu L of a third reagent into a centrifugal tube, centrifuging at room temperature at 4,000 g for 10 min, and reserving a precipitate; ③ After the precipitation by adding the reagent IV, the solution was allowed to stand at room temperature for 5min hours, 200. Mu.L (V2) was transferred to a 96-well plate, and the absorbance OD at 415 and nm was measured. H ₂O₂ content is calculated according to fresh weight, namely: h ₂O₂ content (μmol/g fresh weight) = [ (OD ₄₁₅-0.0006）÷0.7488×V1]÷(W ×V1÷V2)=1.34×（OD₄₁₅ -0.0006)/(W);

The MDA content is determined by referring to a Suzhou Ming kit, and the method comprises the following specific steps: ① Adding 1. 1 mL extractive solution into 0.1 g tissue, grinding on ice, centrifuging at 4deg.C for 10min at 8,000 and g, and collecting supernatant; ② Adding 0.3 mL reagent I and 0.1 mL sample 0.4 ml, uniformly mixing, and reacting in a 95 ℃ water bath for 30 min; ③ After cooling to room temperature in an ice bath, 10,000 g was centrifuged at 25℃for 10 min; ④ 200 μl of the supernatant was taken in 96-well plates and absorbance at 532 nm and 600 nm was measured. MDA content is calculated as fresh weight, i.e. MDA content (nmol/g fresh weight) = [ (OD ₅₃₂－OD₆₀₀) x V inverse total +.epsilon.dX109 ]/(W x V sample +.V extraction) = 25.8XDeltaA +.W (epsilon: malondialdehyde molar extinction coefficient, 155 x 103 l/mol/cm; d:96 well plate optical path, 0.5 cm);

The results are shown in fig. 4, the H ₂O₂ and MDA contents of the transgenic rice seeds are significantly lower than the wild type, indicating that the overexpression of the AcAPX1 gene significantly reduces the H ₂O₂ and MDA contents during germination.

(3) Determination of the content of ascorbic acid (AsA) and Glutathione (GSH)

Determination of AsA content reference solebao kit (Ji et al 2019): ① Adding 1 mL reagent I to 0.1 g tissue, grinding on ice, centrifuging at 4deg.C, and centrifuging at 8,000, 000 g for 20, 20min to obtain supernatant; ② Preheating the second reagent in a water bath kettle at 25 ℃ for more than 30 min; ③ 20 μl of standard solution (or sample supernatant), 160 μl of reagent II and 20 μl of reagent III are sequentially added to the 96-well plate, rapidly mixed, and measured at 265 nm, and standard solution absorbance positions A1 and A2 of 30 s and 150 s are recorded, and sample absorbance values are A3 and A4). The AsA content is expressed as fresh weight, i.e., asA (nmol/g fresh weight) = [ C standard solution X (A3-A4)/(A1-A2) XV sample ]/(W X V sample/(V sample total) = 400 XDeltaA measurement tube/(DeltaA standard tube/(W) (C standard solution: 400 nmol/mL);

The method for determining GSH content is referred to the Soxhaust company kit (Alpert et al, 1985; owens et al, 1965): ① Adding 1 ml reagent I to 0.1 g plant tissue, grinding on ice, centrifuging at 4deg.C, 8,000, 000 g, and centrifuging at 10 min; taking a supernatant; ② The following reagents were added to the EP tube in order, the tube was assayed: 20. mu.l sample, 140. Mu.l reagent II, 40. Mu.l reagent III; standard tube: 20. mu.l of standard solution, 140. Mu.l of reagent II, 40. Mu.l of reagent III; blank tube: 20. mu.l distilled water, 140. Mu.l reagent 40. Mu.l reagent III; ③ After mixing, the mixture was allowed to stand at room temperature for 2 min hours, and the absorbance of each of the measurement tube, standard tube and blank tube was measured at 412: 412 nm. GSH content is expressed in fresh weight, i.e., GSH content (μg/g mass) = [ (OD ₄₁₂ + 0.0008)/0.0023 ] ×v sample ≡v (V sample ≡v sample total×w) = [ (OD ₄₁₂ + 0.0008)/0.0023 ] ≡w;

As a result, as shown in FIG. 5, after 72 hours of germination, the transgenic rice seeds had significantly lower AsA and GSH levels than the wild type, indicating that the post-germination AcAPX gene overexpression reduced the AsA and GSH levels.

(4) Determination of APX enzyme Activity

APX enzyme activity assay reference kohl kit (PELLEGRINI ET al, 2006): ① Adding 1.1 ml extractive solution into 0.1 g tissue, grinding on ice, centrifuging at 4deg.C under 13,000, 000 g, and centrifuging at 10min to obtain supernatant; ② 20. Mu.l of the supernatant, 140. Mu.l of the first reagent, 20. Mu.l of the second reagent and 20. Mu.l of the third reagent were added in sequence to a 6-well plate, and after rapid mixing, the light absorption A1 and A2 of 10 s and 130 s were measured at 290 nm; the reagent needs to be preheated at 25 ℃ before use. APX activity is measured in fresh weight, i.e. APX (nmol/min/g fresh weight) = (A1-A2) = (epsilon×d) x V inverse total x 109/(w×v sample/(V sample total)/(t=3571× Δa/(W) (epsilon: asA molar absorption at 290nm is 2.8×103L/mol/cm; d:96 well plate optical path 0.5 cm);

as shown in FIG. 6, the APX enzyme activity of the transgenic rice seeds is obviously higher than that of the wild type, which indicates that AcAPX gene overexpression improves the APX enzyme activity of plants.

(5) Low temperature stress treatment of transgenic rice seedlings

Selecting NIP, acAPX1-OE #4 and AcAPX-OE #5 rice seeds with neat and consistent grain sizes, sterilizing with 2% sodium hypochlorite solution for 30min, washing with distilled water for 3 times, and soaking in distilled water for 24 h; seeds were transferred to 40 mg.L ^-1 kan screening solution and germinated in the dark at 28 ℃. After germination 24h, seeds were planted in soil (Pinshi soil: nutrient soil: vermiculite=2:2:1). The temperature (25+ -0.5) deg.C and the humidity (75+ -5) percent of the culture environment. Culturing until the three leaf stage (15 d) is reached, the temperature is 6deg.C/6deg.C (day/night), the illumination intensity in daytime is 4000 lux, the illumination time is 16 h, and the relative humidity is 80%; and restoring to room temperature after the low temperature treatment.

The growth of rice seedlings was observed at low temperature treatments of 0 d, 5 d and room temperature recovery of 7d, and the results are shown in FIG. 7, in which the wild type rice seedlings were substantially withered and the transgenic rice seedlings were significantly better in growth than the wild type rice seedlings when the room temperature was recovered for 7d after the low temperature treatment. In addition, after recovery at room temperature of 7d, the H ₂O₂ and MDA contents in the AcAPX-OE#4 and AcAPX-OE#5 lines were significantly lower than in wild-type rice. The result shows that the over-expression of AcAPX gene obviously enhances the low-temperature tolerance of rice plants.

(6) Plant height of transgenic rice seedlings

To eliminate the germination rate difference between the over-expressed strain and NIP, we used AcAPX-OE#4, acAPX1-OE#5 rice seeds to accelerate germination of NIP rice seeds by 12: 12h until the embryo length is consistent after all seeds germinate. The rest operation steps are the same:

① Seed selection: selecting NIP, acAPX1-OE#4 and AcAPX1-OE#5 rice seeds with neat and consistent grain sizes;

② Seed soaking: soaking in 2% sodium hypochlorite solution for 30 min%, sterilizing, washing with distilled water for 3 times, and cleaning;

③ Accelerating germination: a layer of filter paper is filled in a glass dish, and sterilized rice seeds are soaked in 40 mg/l kanamycin screening solution, and germination acceleration is carried out at 28 ℃ under dark conditions.

④ Transplanting: after germination 48 h, seeds were planted in soil (Pinshi soil: nutrient soil: vermiculite=2:2:1). The culture environment temperature (25+/-0.5) DEG C, humidity (75+/-5)%, and the illumination intensity in the daytime is 4000 lux, and the illumination is 16 hours.

⑤ Plant height measurement: after 22d growth, seedlings were observed for growth and photographed, and the height from the base of the stem to the tip of the third full leaf was measured using a ruler, at least 15 lines were measured per line.

Results As shown in FIG. 8, the transgenic rice seedlings were higher than NIP at 22d, indicating that over-expression AcAPX1 promoted rice growth.

The above description of the specific embodiments of the present invention has been given by way of example only, and the present invention is not limited to the above described specific embodiments. Any equivalent modifications and substitutions for this practical use will also occur to those skilled in the art, and are within the scope of the present invention. Accordingly, equivalent changes and modifications are intended to be included within the scope of the present invention without departing from the spirit and scope thereof.

Claims

1. The application of pineapple AcAPX gene in delaying rice seed germination is characterized in that pineapple AcAPX gene is transferred into rice to obtain transgenic rice plants; the ORF sequence of the pineapple AcAPX gene is shown in SEQ ID NO: 1. as shown.