CN118308477A - Capture probe set of Marfan syndrome related genes, kit, library construction method and application - Google Patents

Abstract

The invention discloses a capture probe set, a kit, a library construction method and application of a Marfan syndrome related gene, and belongs to the technical field of gene detection. The sequence of the capture probe set is shown as SEQ ID No. 1-SEQ ID No.149, and the target gene FBN1 can be captured in a targeted manner and sequenced, so that the sequencing target gene is accurate, and the sequencing cost is reduced. The kit containing the capture probe set can effectively capture the target gene, reduce the detection cost and improve the detection sensitivity. The library construction method using the capture probe group can effectively enrich target genes by enriching the target genes based on a sequence capture technology of liquid phase hybridization, reduce the requirement of sample size and better control sequencing cost. The products and methods of the present invention can be effectively applied to screening of related genes and they are studied more intensively.

Description

Capture probe set of Marfan syndrome related genes, kit, library construction method and application

Technical Field

The invention relates to a capture probe set of a Marfan syndrome related gene, a kit, a library construction method and application, and belongs to the technical field of gene detection.

Background

Ma Fanzeng Syndrome (MFS) is an autosomal dominant connective tissue genetic disease. Is mainly characterized by defects of the skeletal, ocular and cardiovascular 3 systems. Is a congenital defect in the interstitial tissue first proposed by the forensic pediatrician, marfan, 1896. The finger is slender due to the involvement of bones, and is also called spider-finger (toe) syndrome, and then the eye and heart changes and family history are supplemented by other doctors, so that a complete syndrome is formed. Etiology and epidemiology: most MFS patients have a family history, but at the same time 15% -30% of the patients are due to self-mutations, which are about 1/2 ten thousand. MFS belongs to autosomal dominant inheritance, mostly (> 90%) due to mutations in the gene encoding connective tissue protein fibrillin-1 (FBN 1), and a few due to mutations in the gene encoding transforming growth factor-beta receptor (transfoming growth factor-beta receptor, TGFBR). In Marfan syndrome patients, more than 600 mutation sites have been found, widely distributed over the whole region of the FBN1 gene, mostly missense mutations and splice site mutations, most of which result in loss of protein function. Fibrillin-1 is the basis for the formation of connective tissue elastic fibers that are distributed throughout the various tissue systems of the body, and the loss of structural support provided by this fibrillin can lead to multiple system lesions resulting from aortic dilation, aortic dissection and even rupture, and extensive dysplasia of the whole body mesodermal tissue.

MFS morbidity is reported to be 1/5000 to 1/3000. Marfan syndrome has no tendency to develop sexually, and mutation rate has no tendency to regional. However, sex can lead to some differences in the clinical manifestations of MFS, such as retrospectively observed increases in the incidence of MFS aortic dilation in men and 40% higher risk of vascular events than women.

High-throughput sequencing is also called next generation sequencing, and in recent years, along with the progress of high-throughput sequencing technology, the sequencing cost is continuously reduced, the sequencing service object and application subdivision fields are continuously expanded, and the market scale of high-throughput sequencing is continuously increased. Along with the policy and favorable conditions, the clinical application of the high-throughput sequencing technology in the health care and the tumor personalized medicine enters an express way, and the application prospect is wide.

The sensitivity of the NGS (second generation gene sequencing) detection technology is far higher than that of the traditional detection technology, 0.03% of point mutation and less than 0.1% of gene fusion can be detected, and DNA and RNA multi-layer detection can be carried out to ensure the detection accuracy.

To sequence the genomic sequence, it is often necessary to design a gene panel with diagnostic value for cost reduction, and the common methods for enriching the target genes in the panel are multiplex PCR and probe hybridization capture. Multiplex PCR is a technique in which a plurality of DNA fragments are used as templates, and a plurality of pairs of primers are mixed in one reaction system to amplify a plurality of target regions simultaneously. This technique requires the design of primers which need to have high specificity while taking care to avoid the generation of dimers between the primers and the amplification reaction temperature needs to be strictly controlled. The DNA fragment that can be amplified finally is mostly between 50bp and 2.5kb in length.

The hybridization capture needs to design a specific probe aiming at the genomic region of interest, the specific probe is hybridized with the genomic DNA by utilizing the nucleic acid molecule base complementary hybridization principle, the DNA fragments of the target genomic region are enriched, then the genomic DNA is broken, the sequencing joint is added, the hybridization is carried out with the probe, the target genomic DNA region is captured, the target DNA fragments are recovered, and a high-throughput sequencing library is directly constructed. The main parameters that measure the capture and sequencing effect are sequencing depth, coverage of the target region, 0.2X homogeneity, and GC bias (GC preference).

The sequencing technology can help to more comprehensively understand the Marfan syndrome related genes, but in the existing sequencing technology, the target region of the Marfan syndrome related genes is not sequenced, so that if the Marfan syndrome related genes need to be detected, whole genome sequencing or exon sequencing needs to be performed on a sample to be detected, but the sequencing cost is higher, and the sequencing analysis of the Marfan syndrome related genes is not facilitated in a high throughput manner.

Disclosure of Invention

The purpose of the invention is that: provides a capture probe set, a capture kit and a library construction method of a Marfan syndrome related gene FBN 1. The sequence of the capture probe set is shown as SEQ ID No. 1-SEQ ID No.149, and the target gene FBN1 can be captured in a targeted manner, and high-throughput sequencing is performed, so that the sequencing target gene is accurate, and the sequencing cost is reduced. The kit containing the capture probe set can effectively capture the target gene, reduce the detection cost and improve the detection sensitivity.

In order to achieve the above object, the present invention provides the following technical solutions:

The invention provides a capture probe set of Marfan syndrome related genes, wherein the specifically captured genes of the capture probe set are FBN1, and the sequences of the capture probe set are shown as SEQ ID No. 1-SEQ ID No. 149. Specifically, the genes and their chromosomal coordinate information are shown in the following table:

Gene name	Capture length	Chromosome of the human body	Gene start site	Gene termination site
					FBN1	11609	chr15	48700510	48937906

Further, a group which facilitates recognition may be labeled on the probe, and these groups may be a radioisotope such as 3H, 35S, 125I or 32P, or the like, or a non-radioactive substance such as fluorescein, biotin, digoxygenin, or the like.

Further, the probes comprised by the capture probe set are labeled with biotin (biotin).

In some embodiments of the invention, biotin is labeled at the 5' end of the probe.

The invention also provides a kit for library construction, which at least comprises the capture probe set.

Further, the kit also comprises at least one of the following reagents:

a linker with a sequence shown as SEQ ID No. 150-SEQ ID No. 151;

A pre-amplification primer with a sequence shown as SEQ ID No. 152-SEQ ID No. 153;

sequencing tags with sequences shown as SEQ ID No. 154-SEQ ID No. 155.

The invention also provides a construction method of the Marfan syndrome related gene sequencing library, which comprises the step of capturing the gene FBN1 by using the capture probe set or the kit.

Further, the construction method comprises the steps of adding a connector to a DNA fragment, then capturing and enriching a target gene FBN1 by using a capture probe set, and finally adding a sequencing tag; the sequence of the capture probe group is shown as SEQ ID No. 1-SEQ ID No. 149; the sequence of the joint is shown in SEQ ID No. 150-SEQ ID No. 151; the sequence of the sequencing tag is shown in SEQ ID No. 154-SEQ ID No. 155.

Further, the construction method specifically comprises the following steps:

Step 1: fragmenting genome DNA and repairing tail ends;

step 2: linker ligation and purification;

step 3: pre-library PCR amplification and purification and library quantification;

step 4: adding a capture probe set to hybridize with the pre-library, capturing and enriching target gene fragments, and performing PCR amplification, library purification and library quantification after capturing.

The invention also provides a sequencing method of the Marfan syndrome related gene sequencing library constructed by the construction method, which comprises the following steps: and carrying out double-end sequencing on the constructed library on a sequencing platform to obtain sequencing data.

Further, the sequencing method further comprises performing a bioinformatic analysis on the sequencing data.

The invention also provides an application of the capture probe set, the kit, the library construction method or the sequencing method, wherein the application is selected from any one of the following applications:

1) The application in preparing products for detecting FBN1 gene mutation;

2) Use in the preparation of a product for diagnosis or for aiding in the diagnosis of Ma Fanzeng syndrome;

3) The application of the gene FBN1 in preparing a product for screening the equine fan syndrome related gene;

4) Use in studying the effect between the FBN1 gene and equine syndrome.

Compared with the prior art, the invention has the following beneficial effects:

(1) The capture probe set of the Marfan syndrome related gene (FBN 1) provided by the invention can capture specific coding regions and perform high-throughput sequencing, so that the sequencing target gene is accurate, and the sequencing cost is reduced.

(2) The capture kit for the Marfan syndrome related gene (FBN 1) provided by the invention comprises the capture probe set, so that the related gene can be effectively captured, the detection cost of the related gene can be reduced, and the detection sensitivity can be improved.

(3) The sequencing library construction method of the Marfan syndrome related gene (FBN 1) provided by the invention uses the capture probe set of the gene, and the target gene is enriched by using the sequence capture technology of liquid phase hybridization, so that the target gene can be effectively enriched, the requirement on sample size is reduced, and the sequencing cost can be better controlled.

(4) The use of the Marfan syndrome related gene (FBN 1) capture probe set, the capture kit and the sequencing library construction method in related gene screening can further study the characteristics of related genes, not only can the screening of whether a sample contains certain characteristics, but also SNP (single nucleotide polymorphism) and Indel (insertion deletion of bases) of the genes can be further analyzed.

Drawings

Fig. 1 is variation 1: the sanger verification result of FBN1 chr 15:487176803 c.7339C > A;

fig. 2 is variation 2: the sanger verification result of FBN1 chr15:48757777c.4930G > A;

Fig. 3 is variation 3: samger validation results of FBN1 chr15:48722933c.6806A > G;

Fig. 4 is variation 4: results of sanger validation of FBN1 chr 15:488057888 c.1546G > A;

fig. 5 is variation 5: the sanger verification result of FBN1 chr 15:487199922 c.7711A > G;

Fig. 6 is variation 6: FBN1 chr 15:4812913 c.1090c > sanger validation results of t;

Fig. 7 is variation 7: FBN1 chr 15:4875017 c.4786c > sanger validation results of t.

Detailed Description

In order to make the invention more comprehensible, preferred embodiments accompanied with figures are described in detail below.

The test methods used in the following examples are conventional methods unless otherwise specified; the materials, reagents and the like used, unless otherwise specified, are those commercially available.

Example 1 design of Marfan syndrome associated Gene (FBN 1) Capture Probe set

The gene captured in this example and its chromosomal coordinate information are shown in Table 1, and the sequence information of the designed capture probe set is shown in Table 2.

TABLE 1 details of the Gene captured in the present invention and its chromosomal coordinate information

Gene name	Capture length	Chromosome of the human body	Gene start site	Gene termination site
					FBN1	11609	chr15	48700510	48937906

TABLE 2 sequence details of Capture Probe set in the invention

Wherein SEQ ID No. 1-SEQ ID No.149 represent the probe sequences of the FBN1 gene, the 5' -end of which is modified with biotin.

The design of the capture probe set follows the following rules:

The length of the probe is 120bp;

The probes are in a tiled design;

the probe reference is the sense strand of the gene;

ensuring the probe specificity by comparing whole genome information in the probe design;

the low GC content area encryption designs the probe.

Example 2 preparation of a kit for library construction

The present example provides a kit for constructing a library of equine syndrome-associated genes (FBN 1), comprising the following reagents:

Breaking the pre-mix liquor after finishing;

a ligase;

a ligation buffer;

amplifying the premix;

pre-amplifying the primer;

A blocking agent;

hybridization solution A;

Hybridization solution B;

A magnetic bead cleaning solution;

a impurity washing liquid 1;

A impurity washing liquid 2;

a impurity washing liquid 3;

a impurity washing liquid 4;

capture probe-F1 (i.e., the capture probe set described in example 1);

A tag primer;

Capturing the magnetic beads.

In this example, reagents other than the capture probe are commercially available; the capture magnetic beads are streptavidin magnetic beads and can be combined with a biotin-labeled probe.

Example 3 design of synthetic linker sequences and tag sequences

The linker sequences designed and synthesized in this example were:

linker sequence Adapter-1:

5'-phos-CTACACGACGCTCTTCCGATCTT-3'(SEQ ID No.150)；

Linker sequence Adapter-2:

5'-AGATCGGAAGAGCACACGTCTG-3'(SEQ ID No.151)；

The pre-amplification primer sequences designed in this example were:

F:5'-CTACACGACGCTCTTCCG-3'(SEQ ID No.152)；

R:5'-CAGACGTGTGCTCTTCCG-3'(SEQ ID No.153)；

The tag primer sequence contains a tag moiety:

5'-GCATGGCGACCTTATCAG[Barcode-1]TTGTCTTCCTAAGACCGCTTGG

-3'(SEQ ID No.154)；

The tag primer sequence does not contain a tag moiety:

5'-CAAGCAGAAGACGGCATACGAGATCCGATGTGTGACTGGAGTTCAG ACGTGTGCTCTTCCG-3'(SEQ ID No.155)；

EXAMPLE 4 construction of library and sequencing

The embodiment provides a library construction method, wherein the library is used for 150PE sequencing based on Huada platform, and the library construction and sequencing flow is as follows:

step one: genomic DNA fragmentation and end repair

1. And (3) centrifuging the genomic DNA of the sample to be pooled, placing the sample on an ice box, taking 50 mu L of genomic DNA, adding 10 mu L of breaking and finishing premix, and carrying out vortex mixing and instantaneous centrifugation. Note that: in order to avoid fragmentation non-uniformity due to time differences, this loading step must be performed on ice.

2. The reaction procedure was started on a PCR instrument: 1min at 4 ℃, 15min at 30 ℃,20 min at 72 ℃, hold at 4 ℃, 60 μl of reaction volume, and a hot cap at 75 ℃.

Step two: joint ligation and purification

1. The product of the above step was centrifuged, placed on an ice box, and 30. Mu.L of ligation buffer and 5. Mu.L of ligase were added (when the sample was too much, ligation buffer was previously mixed with ligase in advance and then dispensed in 35. Mu.L).

2. Adding 5 mu L of joint on the wall of the PCR tube, mixing by vortex, and centrifuging instantly to make all the reaction liquid be placed at the bottom of the PCR tube. Note that: the linker should avoid premature contact with the ligation buffer, ligase, or else more linker dimers will be formed.

3. The reaction procedure was started on a PCR instrument: 15min at 20℃and Hold at 4℃and a reaction volume of 100. Mu.L were set without a hot cap.

4. The purified magnetic beads are mixed reversely, balanced for 30min at room temperature, 75 mu L of purified magnetic beads are added into the connection reaction product of the step 3, mixed uniformly and incubated for 5min at room temperature.

5. The PCR tube was centrifuged instantaneously and placed on a magnetic rack for 5min until the liquid was completely clarified, and the supernatant was removed by pipetting with the attention of not pipetting the beads.

Note that: the magnetic rack must be clear completely, and the placement time of different brands must be adjusted.

6. 150. Mu.L of 80% ethanol solution was slowly added along the side wall of the PCR tube, taking care not to disturb the magnetic beads, standing for 30s, pipetting the supernatant off using a pipette, taking care not to aspirate the magnetic beads.

7. The above steps were repeated once.

8. The PCR tube was centrifuged transiently and placed on a magnetic rack, and a small amount of residual 80% ethanol solution was removed using a 10. Mu.L tip, taking care not to attract the magnetic beads.

9. The PCR tube cap was opened and allowed to stand at room temperature for about 2-3min until ethanol was completely volatilized (the surface of the magnetic beads was rough and not smooth).

Note that: it is not excessively dried, which would affect the DNA recovery efficiency.

10. And removing the PCR tube from the magnetic frame, adding 25 mu L of Nuclease FREE WATER into the PCR tube, fully and uniformly mixing, centrifuging briefly to ensure that the tube cover has no liquid drops, and standing for 5-10 min at room temperature.

11. The reaction tube was placed on a magnetic rack, adsorbed for 3min, and 23 μl of supernatant was aspirated and placed in a new PCR tube.

Step three: pre-library amplification and purification

1. The product recovered by the previous purification step is placed on an ice box, 25 mu L of amplification premix and 2 mu L of pre-amplification primer are added, the mixture is uniformly mixed, and the whole reaction solution is placed at the bottom of a PCR tube by instantaneous centrifugation.

2. The PCR tube was placed in a PCR instrument to initiate the following procedure: 45s at 98 ℃; (98 ℃ C. 15s,58 ℃ C. 30s,72 ℃ C. 30 s) 11 cycles; 72℃1min,4℃Hold, 50. Mu.L of volume was set and the lid was heated to 105 ℃.

3. The product of the previous step was purified using purification magnetic beads. Before purification, the beads were mixed upside down and equilibrated for 30min at room temperature. 75 mu L of purified magnetic beads are added into the PCR tube of the amplified product, and the mixture is fully and uniformly mixed and incubated for 5min at room temperature.

4. And (3) placing the PCR tube on a magnetic rack after instantaneous centrifugation for 5min until the liquid is completely clarified, and sucking and discarding the supernatant by using a pipette, wherein the magnetic beads are not required to be sucked.

Note that: the magnetic rack must be clear completely, and the placement time of different brands must be adjusted.

5. 150. Mu.L of 80% ethanol solution was slowly added along the side wall of the PCR tube, taking care not to disturb the magnetic beads, standing for 30s, pipetting the supernatant off using a pipette, taking care not to aspirate the magnetic beads.

6. The above steps were repeated once.

7. The PCR tube was centrifuged instantaneously and placed on a magnetic rack, and a small amount of residual 80% ethanol solution was removed using a 10. Mu.L tip, taking care not to attract the magnetic beads.

8. The PCR tube cap was opened and allowed to stand at room temperature for about 5min until ethanol was completely volatilized (the surface of the beads was rough and not smooth).

Note that: it is not excessively dried, which would affect the DNA recovery efficiency.

9. Removing the PCR tube from the magnetic frame, adding 35 mu L of Nuclease FREE WATER into the PCR tube, fully and uniformly mixing, centrifuging briefly to ensure that the tube cover has no liquid drops, and standing for 5-10 min at room temperature.

10. The reaction tube is placed on a magnetic rack, adsorbed for 3min, and 33 mu L of supernatant is sucked and placed in a new PCR tube, thus obtaining the pre-library.

Step four: quantification of library

Quantitative quality inspection of the library is performed by using a fluorescence quantitative instrument (such as QubitTM 3.0.0 Fluorometer) or quantitative PCR. UsingFragment analysis instruments such as (Agilent) and Qsep (Bioptic) are used for library fragment distribution quality inspection.

Step five: hybridization of library

1.1 To 8 purified equivalent pre-libraries (500 ng per library) were mixed. After pre-library mixing, 5 μl of blocking agent was added after being filled to 60 μl with nuclease-free deionized water.

2. And (3) reversing and uniformly mixing the magnetic beads balanced for 30min at room temperature, taking 100 mu L of purified magnetic beads, adding the purified magnetic beads into a reaction tube in the previous step, fully and uniformly mixing, centrifuging for a short time to ensure that the tube cover has no liquid drops, and standing for 5-10 min at room temperature.

3. Standing, placing the product on a magnetic rack, adsorbing for 5min, and removing the supernatant with a pipette, wherein the magnetic beads are not required to be attracted.

4. 150. Mu.L of 80% ethanol solution was slowly applied along the wall of the centrifuge tube, and the beads were left undisturbed for 30s, and the supernatant was pipetted off using a pipette.

5. The above steps were repeated once.

6. The tube was centrifuged briefly and placed on a magnetic rack, and a small amount of 80% ethanol solution was removed using a 10. Mu.L tip, taking care not to suck onto the beads.

7. The beads were allowed to stand at room temperature and dry for 5min until ethanol was completely evaporated (the beads were rough and smooth).

Note that: it is not excessively dried, which would affect the DNA recovery efficiency.

8. The centrifuge tube was removed from the magnet rack and 9.5. Mu.L of hybridization solution A, 3. Mu.L of hybridization solution B, and 6.5. Mu.L of capture probe-F1 were added.

9. And (3) fully and uniformly mixing the magnetic beads and the hybridization reaction liquid by vortex, incubating for 4min at 65 ℃, and standing for 4min at room temperature after uniformly mixing by vortex.

10. The tube was centrifuged transiently and placed on a magnetic rack until the liquid was completely clear, and 17 μl of supernatant was transferred to a new PCR tube using a pipette.

11. The following hybridization procedure was initiated on a PCR instrument: 95 ℃ for 2min;65℃12h,65℃Hold, thermal cover 105℃17. Mu.L of reaction system.

Note that: the hybridization time is not less than 12 hours and not more than 24 hours.

Step six: cleaning liquid working solution configuration table 3

TABLE 3 cleaning fluid working fluid configuration

Component (A)	Stock solution volume (mu L)	Add Water volume (mu L)	Working fluid volume (μL)
				Magnetic bead cleaning solution (2 x)	150	150	300
Washing liquid 1 (10 x)	30	270	300
				Washing liquid 2 (10 x)	25	225	250
Washing liquid 3 (10 x)	15	135	150
				Washing liquid 4 (10 x)	15	135	150

Note that: the working solutions of the wash solution 1 (10 x) and the wash solution 2 (10 x) were incubated at 65℃for at least 15min.

Step seven: preparation of magnetic bead suspension

Hybridization solution A8.5. Mu.L;

Hybridization solution B2.7. Mu.L;

Nuclease-Free Water 5.8μL。

step eight: captured magnetic bead washing

1. The captured magnetic beads are mixed for 15s by vortex, so that complete mixing is ensured, and the room temperature is balanced for 30min. mu.L of magnetic beads were pipetted into the PCR tube and placed on a magnetic rack for 1 min until the solution was clear and the supernatant removed.

2. Adding 100 mu L of prepared magnetic bead cleaning liquid working solution, fully and uniformly mixing, placing on a magnetic rack for 1min until the solution is clear, and removing the supernatant.

3. The above procedure was repeated two additional times.

4. After the last removal of the supernatant, the tube cap was centrifuged briefly to remove any liquid droplets, the PCR tube was placed on a magnetic rack and the residual liquid was removed as much as possible using a 10. Mu.L pipette.

5. Add 17. Mu.L of the prepared magnetic bead suspension (the captured magnetic bead suspension should be thoroughly mixed before addition), vortex mix, centrifuge briefly, then snap the tube cap, and place at 65deg.C for 5min.

Step nine: magnetic bead capture

1. After hybridization, the PCR instrument was adjusted to enter the elution procedure: 65 ℃ infinity, hot cap 70 ℃, reaction system: 34 mul.

2. The resuspended capture magnetic beads are added to the hybridization system and gently mixed by pipetting or vortexing.

3. Incubation was carried out at 65℃for 45min, gently vortexing once every 15min, ensuring complete resuspension of the beads, and the whole procedure should be kept at a reaction temperature as high as possible above and below 65 ℃.

Step ten: high-temperature impurity washing

1. After the incubation is finished, the PCR tube is taken off from the PCR instrument, and 100 mu L of working solution of washing liquid 1 at 65 ℃ is added into the PCR tube, and a hybridization system containing magnetic beads is blown and sucked uniformly. ( The operation of the thermal elution process is rapid; air bubbles are avoided to the greatest extent in the blowing, sucking and mixing process. )

2. Adding 100 mu L of working solution of the impurity washing liquid 1 at 65 ℃ in advance, gently blowing and sucking for 10 times, uniformly mixing, and centrifuging briefly to ensure that the pipe cover has no liquid drops. The PCR tube is placed on a magnetic rack, and after the liquid is completely clarified, a pipettor is used for sucking and discarding the supernatant.

3. The above steps were repeated 2 times.

4. And removing the PCR tube from the magnetic frame, adding 150 mu L of working solution of the impurity washing liquid 2 preheated to 65 ℃, gently blowing and sucking for 10 times, uniformly mixing, placing the mixture into a PCR instrument, incubating for 5min at 65 ℃, placing the mixture on the magnetic frame for 1min until the solution is clarified, and removing the supernatant.

Step eleven: washing impurities at normal temperature

1. And taking the sample off the magnetic rack, adding 150 mu L of working solution of the room-temperature standing impurity-washing liquid 2, mixing by vortex for 30s, standing for 30s at room temperature, and mixing by vortex for 30s. The PCR tube is placed on a magnetic rack for 1min after instantaneous centrifugation, and the supernatant is sucked and removed after the liquid is completely clarified.

2. Taking the sample off the magnetic rack, adding 150 mu L of working solution of the room-temperature standing impurity-washing liquid 3, mixing by vortex for 30s, standing for 30s at room temperature, and mixing by vortex for 30s. The PCR tube is placed on a magnetic rack for 1min after instantaneous centrifugation, and the supernatant is sucked and removed after the liquid is completely clarified.

3. And taking the sample off the magnetic rack, adding 150 mu L of working solution of room temperature impurity washing solution 4, mixing by vortex for 30s, standing for 30s at room temperature, and mixing by vortex for 30s. The PCR tube is placed on a magnetic rack for 1min after instantaneous centrifugation, and the supernatant is sucked and removed after the liquid is completely clarified.

4. A small amount of residual wash 4 working fluid was removed with a 10. Mu.L tip.

5. The PCR tube was removed from the magnetic rack, 20. Mu. LNuclease-FREE WATER was added, and gently blown and sucked 10 times with a pipette to ensure uniform mixing. ( Note that: the magnetic beads are not required to be removed by a magnetic frame, and the magnetic beads are carried out for the next reaction. )

Step twelve: post-capture PCR amplification

1. The magnetic beads with the captured DNA of the previous step are placed on an ice box by centrifugation at 20 mu L, 25 mu L of amplification premix and 5 mu L of label primer are added, and the mixture is uniformly mixed and separated.

2. PCR instrument setup procedure: 45s at 98 ℃; (98 ℃ C. 15s,58 ℃ C. 30s,72 ℃ C. 30 s) 11 cycles, 72 ℃ C. 1min,4 ℃ C. Infinity, 50. Mu.L of the volume was set, and the heat was capped at 105 ℃. Put on the reaction tube and start PCR amplification. (amplified product may be stored overnight at 4 ℃ C.)

Step thirteen: library purification

1. The product of the previous step was purified using purification magnetic beads. Before purification, the beads were mixed upside down and equilibrated for 30min at room temperature. 75 mu L of purified magnetic beads are added into the PCR tube of the amplified product, and the mixture is fully and uniformly mixed and placed at room temperature for 8min.

2. Standing, placing the product on a magnetic rack, adsorbing for 5min, and removing the supernatant with a pipette, wherein the magnetic beads are not required to be attracted.

3. 150. Mu.L of 80% ethanol solution was slowly added along the side wall of the PCR tube, taking care not to disturb the magnetic beads, standing for 30s, pipetting the supernatant off using a pipette, taking care not to aspirate the magnetic beads.

4. The above steps were repeated once.

5. The PCR tube was centrifuged instantaneously and placed on a magnetic rack, and a small amount of residual 80% ethanol solution was removed using a 10. Mu.L tip, taking care not to attract the magnetic beads.

6. The PCR tube cap was opened and allowed to stand at room temperature for about 5min until ethanol was completely volatilized (the surface of the beads was rough and not smooth).

Note that: it is not excessively dried, which would affect the DNA recovery efficiency.

7. The PCR tube was removed from the magnetic rack, 35. Mu.L of Tris solution (10 mM Tris, pH=8.5) was added to the PCR tube, and after thoroughly mixing, the tube was centrifuged briefly to leave the cap free of droplets and allowed to stand at room temperature for 5 to 10 minutes.

10. The reaction tube was placed on a magnetic rack, adsorbed for 1min, and 33. Mu.L of supernatant was aspirated and placed in a new EP tube.

Step fourteen: quantification of library

Quantitative quality inspection of the library is performed by using a fluorescence quantitative instrument (such as QubitTM 3.0.0 Fluorometer) or quantitative PCR. UsingFragment analysis instruments such as (Agilent) and Qsep (Bioptic) are used for library fragment distribution quality inspection.

Fifteen steps: sequencing on machine

And (3) using the final product of the step thirteen, and carrying out double-end sequencing on the captured region by using MGISEQ-2000 second generation sequencers produced by Wuhua Dazhisha technology Co., ltd, wherein the reading length is 150bp.

Step sixteen: credit analysis

The raw letter analysis flow is as follows:

1. Raw off-the-shelf data FASTQ was quality controlled using fastp (version 0.23.2), splice excised and low quality data filtered.

2. The filtered FASTQ was aligned to the human reference genome (build hg 19) using bwa-mem (version 2.2.1) to generate an alignment file.

3. The alignment files were processed and quality controlled using samblaster (version 0.1.26), samtools (version 1.16.1), mosdepth (version 0.3.3).

4. The processed alignment file was subjected to mutation detection using gatk (version 4.3.0.0).

5. The mutation detection results were filtered and quality controlled using bcftools (version 1.16).

6. The mutation detection results were annotated with snpeff (version 5.0) and annovar (version 2020-06-08).

Seventeenth step: report interpretation

Eighteenth step: sanger sequencing verification.

Application example 1

In this example, the detection of the FBN1 gene was performed in 42 patients clinically diagnosed with Marfan syndrome according to the method described in example 4, wherein the 20 forerunner's gene detection results were that the FBN1 gene mutation was carried, and the detection positive rate was 47.6%. Of these 17 (40.5%) of the precursor results were P (pathogenic) or LP (potentially pathogenic), and 3 (7.1%) of the precursor carried an indeterminate gene mutation (VUS). The statistical results are shown in Table 4.

Table 4: statistical results of the forensic gene detection

The results of gene testing for all forensics are shown in Table 5.

Table 5: results of FBN1 Gene detection in all forensics

Among them, 7 FBN1 gene pathogenic variants (P) were validated by sanger, and the results are shown in FIGS. 1 to 7.

While the invention has been described with respect to preferred embodiments thereof, it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims.

Claims (8)

1. The capture probe set of the Marfan syndrome related genes is characterized in that the specifically captured genes of the capture probe set are FBN1, and the sequences of the capture probe set are shown as SEQ ID No. 1-SEQ ID No. 149.

2. A kit for library construction, comprising at least the capture probe set of claim 1.

3. The kit of claim 2, further comprising at least one of the following reagents:

a linker with a sequence shown as SEQ ID No. 150-SEQ ID No. 151;

A pre-amplification primer with a sequence shown as SEQ ID No. 152-SEQ ID No. 153;

sequencing tags with sequences shown as SEQ ID No. 154-SEQ ID No. 155.

4. A method for constructing a sequencing library of equine syndrome-associated genes, comprising capturing the genes FBN1 using the capture probe set of claim 1 or the kit of any one of claims 2 to 3.

5. The construction method according to claim 4, wherein the construction method comprises the steps of adding a linker to the DNA fragment, then performing capture enrichment on the target gene FBN1 by using a capture probe set, and finally adding a sequencing tag; the sequence of the capture probe group is shown as SEQ ID No. 1-SEQ ID No. 149; the sequence of the joint is shown in SEQ ID No. 150-SEQ ID No. 151; the sequence of the sequencing tag is shown in SEQ ID No. 154-SEQ ID No. 155.

6. The construction method according to claim 4, characterized in that it comprises in particular the following steps:

Step 1: fragmenting genome DNA and repairing tail ends;

step 2: linker ligation and purification;

step 3: pre-library PCR amplification and purification and library quantification;

step 4: adding a capture probe set to hybridize with the pre-library, capturing and enriching target gene fragments, and performing PCR amplification, library purification and library quantification after capturing.

7. A sequencing method of a marfan syndrome related gene sequencing library constructed using the construction method according to any one of claims 4 to 6, characterized in that the sequencing method comprises: and carrying out double-end sequencing on the constructed library on a sequencing platform to obtain sequencing data.

8. Use of the capture probe set of claim 1, the kit of any one of claims 2 to 3, the library construction method of any one of claims 4 to 6 or the sequencing method of claim 7, wherein the use is selected from any one of the following:

1) The application in preparing products for detecting FBN1 gene mutation;

2) Use in the preparation of a product for diagnosis or for aiding in the diagnosis of Ma Fanzeng syndrome;

3) The application of the gene FBN1 in preparing a product for screening the equine fan syndrome related gene;

4) Use in studying the effect between the FBN1 gene and equine syndrome.