CN118291523A

CN118291523A - Method for producing cloned gamete in plant and application thereof

Info

Publication number: CN118291523A
Application number: CN202410483734.3A
Authority: CN
Inventors: 杨超; 耿苗维; 初壘
Original assignee: Huazhong Agricultural University
Current assignee: Huazhong Agricultural University
Priority date: 2024-04-22
Filing date: 2024-04-22
Publication date: 2024-07-05

Abstract

The invention relates to a method for producing cloned gametes in plants and application thereof, which converts meiosis of germ cells into similar mitosis by utilizing the technology such as gene mutation or genetic engineering technology editing to make proteins participating in meiosis DNA double strand break and mucin participating in meiosis specific lose function in plants, and produces non-meiotic cloned gametes with the same genotype as the parent. The subsequent development of cloned gametes into seeds or plants can be realized, so that the heterosis of the crop hybrid seeds can be fixed in a time-saving and convenient manner, the production efficiency of the hybrid seeds is greatly improved, the production cost is reduced, the influence on the plant nutrition growth is avoided, and the method has a wide application value.

Description

Method for producing cloned gamete in plant and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a method for generating cloned gametes in plants and application thereof.

Background

Heterosis refers to the phenomenon that the hybrid progeny F1 of two parents with different genetic characteristics is superior to parents in terms of growth vigor, yield, quality, stress resistance, etc. (Gu Zhoulin et al, 2023). For a long time, heterosis is widely utilized in agriculture, and by utilizing heterosis, the yield of wheat, rice and rape is greatly improved, so that great contribution is made to global grain safety (Jiang Nan and the like, 2023). However, hybrid vigor cannot be maintained because the hybrid seed segregates in the next generation. Thus, there is a continuous need for hybrid production.

The production of hybrids can be divided into three strategic stages of development, the "three-line method", "two-line method" and "one-line method" (Yuan Longping, 1987). The first generation hybrid production is a three-line breeding technology using a cytoplasmic male sterile line as a genetic tool, and is realized by matching the cytoplasmic male sterile line, a maintainer line and a restorer line (three lines for short). The three-line method for producing hybrid needs to find a proper sterile line and an excellent restorer line, and the selection of an excellent combination is affected due to the restriction of the restorer gene (Deng Xingwang and the like, 2013). Later, a two-line method cross breeding technology with relatively simple seed production procedures is provided, namely a photo-thermo-sensitive genic male sterile line method, pollen of the two-line method cross breeding technology is fertile under a certain photo-thermo condition, and seeds are propagated through the fertility of the two-line method cross breeding technology; while under another light temperature condition, the pollen is sterile, and the sterility is utilized to hybridize with the male parent to produce hybrid (advanced etc. 2018). The photo-thermo-sensitive genic male sterile system is affected by abnormal weather to cause unstable hybrid production system and greatly influence the production process of excellent hybrid, thereby improving the production cost and being unfavorable for commercial popularization (Zheng Xingfei and the like, 2021). Therefore, the first line method is considered as the highest target of cross breeding. The F1 hybrid which is not separated can be cultivated by a one-line method, the heterosis of the plant is fixed, and seed production is avoided.

Apomixis is receiving great attention because of its great potential in heterosis fixation, and artificial creation of apomixis is an important direction in current apomixis research, and mitosis instead of meiosis (Mitosis instead of Meiosis, MIME) can produce diploid gametes that are completely identical to maternal genetic composition, and is a key step in artificial creation of apomixis. It was found that the first meiosis of the Arabidopsis spo11-1/rec8 double mutant was replaced by a mitotic-like process followed by a second division of the chromosomal imbalanced distribution, resulting in severe sterility of gametes. However, combining the OSD1 mutation that prevents the second meiosis with the spo11-1/rec8 that disrupts the first meiosis, the OSD1 gene mutation inhibits the chromosomal imbalance of the spo11-1/rec8 double mutant, resulting in a fertile, fusion-free gamete in which meiosis is replaced by mitosis and the genetic information is identical to that of the female parent in the spo11-1/rec8/OSD1 triple mutant. Similar findings are found in rice. Namely, three genes are required to be mutated simultaneously in the arabidopsis thaliana and the rice to generate the fertile non-fusion gamete with the genetic information completely consistent with that of the female parent, so that the workload is high and the efficiency is low; in addition, the third gene OSD1, which requires mutation in arabidopsis and rice, is involved in mitosis and cell fate, and can bring about a negative effect on plant growth.

Disclosure of Invention

The invention aims to provide a method for producing cloned gametes in plants, in particular to polyploid plants, which only needs to mutate two proteins of protein involved in meiosis DNA double-strand break and mucin involved in meiosis specificity in the plants to lose functions, so that the meiosis of germ cells of the plants can be converted into similar mitosis, the second meiosis is skipped, further the non-meiosis fertile cloned gametes with the same parental genotype are obtained, the cloned gametes are induced to develop into seeds or plants subsequently, and the heterosis of the plants are utilized, so that the hybrid vigor of crop hybrids is fixed more time-effectively and conveniently, the production efficiency is greatly improved, and the plant nutrition growth is not influenced.

The present invention provides a method for producing cloned gametes in plants, which causes the loss of function of proteins involved in meiosis DNA double strand breaks and of mucins involved in meiosis specificity in plants, converts meiosis of germ cells into similar mitosis and produces non-meiotic cloned gametes of the same genotype as the parent.

Further, the protein involved in meiosis DNA double strand breaks comprises: SPO11-1, MTOPVIB, PRD1, PRD2, PRD3 and/or DFO, the involvement in meiosis specific adhesion comprising: REC8.

Further, the loss of function can be achieved by genetic mutation or artificial intervention means, wherein the genetic mutation comprises spontaneous mutation and induced mutation, the spontaneous mutation is naturally generated in the body, and the induced mutation is induced by external environment; the manual intervention means comprises a gene editing technique comprising: cre-lox system, zinc finger endonuclease system, transcription activator-like effector nuclease system, CRISPR-Cas9 system, RNAi and/or base editor system.

Further, the amino acid sequence of the SPO11-1 protein is shown as SEQ ID NO. 1-2; the amino acid sequence of MTOPVIB protein is shown as SEQ ID NO 3-4; the amino acid sequence of the REC8 protein is shown as SEQ ID NO. 5-6; the amino acid sequence of the PRD1 protein is shown in SEQ ID NO 7-8; the amino acid sequence of the PRD2 protein is shown as SEQ ID NO 9-12; the amino acid sequence of the PRD3 protein is shown as SEQ ID NO. 13-16; the amino acid sequence of the DFO protein is shown as SEQ ID NO. 17-18.

Further, the plant comprises: rape, cabbage, wheat, oat, cotton, tobacco, pasture, elephant grass, sudan grass, fescue, timothy grass, sugarcane, banana, strawberry, cherry, apple, grape, pear, watermelon, melon, potato, sweet potato, cassava, beet, peanut, coffee, sesame, alfalfa, mustard, cabbage, lavender, red cabbage, broccoli, cauliflower, cabbage, radish, potherb mustard, tomato, eggplant, asparagus, chilli, cucumber, white gourd, towel gourd, pumpkin, leek, yam, orchid, lily, narcissus, chrysanthemum, violet and/or tulip.

The invention also provides application of the method in plant breeding.

The invention also provides a method for fixing plant heterosis, comprising the following steps:

(1) Obtaining non-subtractive cloned gametes with the same genotype as the parent by the method;

(2) Non-subtractive clonal gametes are induced to develop into seeds or plants.

Further, the method of inducing the non-subtractive clonal gametes to develop into seeds or plants is any one or a combination of the following:

A. through the combination of mutation of parthenogenesis or haploid induction genes, proteins required for parthenogenesis comprise BBM1, BBM2 and PAR; proteins required for haploid induction of mutation of genes include CENH3, MTL, PLA1 and DMP.

B. haploid plants of non-subtractive cloned gametes are obtained by microspore culture techniques;

C. treatment of pollen with ROS inducers produces haploids.

Further, the plants include rape, cabbage, wheat, oat, cotton, tobacco, pasture, elephant grass, sudan grass, duck grass, timothy grass, sugarcane, banana, strawberry, cherry, apple, grape, pear, watermelon, melon, potato, sweet potato, cassava, beet, peanut, coffee, sesame, alfalfa, mustard, cabbage, laver, red cabbage, broccoli, cauliflower, cabbage, radish, potherb mustard, tomato, eggplant, asparagus, chilli, cucumber, white gourd, luffa, pumpkin, leek, yam, orchid, lily, narcissus, chrysanthemum, violet, and tulip.

The beneficial effects are that: the invention only needs to mutate the protein involved in meiosis DNA double strand break and the adhesion protein involved in meiosis specificity in the plant body to lose the function, so that the germ cell meiosis of the plant can be converted into similar mitosis, and the second meiosis is skipped, thereby obtaining the non-meiosis fertile cloned gamete with the same parental genotype, and the subsequent mutation induction of parthenogenesis or haploid induction genes, microspore culture technology and the like can be combined to enable the cloned gamete to develop into seeds or plants, thereby time-saving and convenient fixation of the heterosis of the crop hybrid, greatly improving the production efficiency, accelerating the breeding process of excellent hybrid, reducing the production cost, and having wide application value. The method is conserved in other polyploid plants such as cotton, wheat and the like, and has great significance for polyploid crops.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings that are needed in the embodiments will be briefly described below, it being understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and other related drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.

FIG. 1 is a pollen staining plot of WT, spo11-1 rec8-1 (Westar), spo11-1 rec8-1 (8 x) (Westar), spo11-1 rec8 (Westar x J9707F 1) and mtopVIB rec (Westar x J9707F 1) mutant plants, wherein 8x represents octaploidy and F1 represents hybrid generation.

FIG. 2 shows the status of lichen red staining at the tetrad stage of Westar、spo11-1 rec8-1(Westar)、spo11-1 rec8-1(8x)(Westar)、Westar x J9707 F1、spo11-1 rec8(Westar x J9707 F1) and mtopVIB rec8 (Westar x J9707F 1) mutant plants.

FIG. 3 is a graph of chromosome behavior of mutant plant pollen mother cells of WT, spo11-1 rec8-1 (Westar), spo11-1 rec8-1 (8 x) (Westar), spo11-1 rec8 (Westar x J9707F 1) and mtopVIB rec (Westar x J9707F 1).

FIG. 4 is a comparison of WT and spo11-1 rec8-1 mutant plant seeds.

Detailed Description

The following examples are only for more clearly illustrating the technical aspects of the present application, and thus are merely examples, which should not be construed as limiting the scope of the present application. It is noted that unless otherwise indicated, technical or scientific terms used herein should be given the ordinary meaning as understood by one of ordinary skill in the art to which this application belongs. Unless specifically stated otherwise, the reagents, methods and apparatus employed in the present application are those conventional in the art. Reagents and materials used in the following examples are commercially available unless otherwise specified.

EXAMPLE 1 creation of brassica napus Gene SPO11-1 mutant

1. Construction of CRISPR expression vectors

1. Two targets were designed for BnaA01.SPO11-1 and BnaC01.SPO11-1 as shown in SEQ ID NO:1-2 using the CRISPR-P v 2.0.0 website.

2. Four primers were designed as follows:

BnaSPO11-1DT1-BsF：

ATATATGGTCTCGATTGATCTGCTTCGAAAGATCAAGTT

BnaSPO11-1-DT1-F0：

TGATCTGCTTCGAAAGATCAAGTTTTAGAGCTAGAAATAGC

BnaSPO11-1-DT2-R0：

AACTCGACTTCCTCTACAAGAACAATCTCTTAGTCGACTCTAC

BnaSPO11-1-DT2-BsR：

ATTATTGGTCTCGAAACTCGACTTCCTCTACAAGAACAA

3. Four-primer PCR amplification was performed using 1 ng/. Mu. l pCBC-DT1T2 as template. BnaSPO11-1DT1BsF/BnaSPO11-1-DT2-BsR were the normal primer concentrations; bnaSPO11-1-DT1- -F0/BnaSPO11-1-DT2- -R0 was diluted 20-fold.

4. The PCR product was purified and recovered, and 15. Mu.l of a cleavage-ligation reaction system was established. The reaction system included 2. Mu.l PCR fragment, 2. Mu. l pKSE401 l 10xT4Buffer, 1.5. Mu.l 10xBSA, 1. Mu.l BsaI, 1. Mu. l T4 Ligase and 6. Mu.l ddH ₂ O.

5. Mu.l of transformed Top10 large intestine competent were aspirated and then screened using Kana plates. After placing in a constant temperature incubator at 37 ℃ for about 12 hours, bacterial plaques are picked for colony PCR identification. And then selecting the correct bacterial plaque for shaking, and extracting the plasmid the next day to obtain the CRISPR expression vector.

2. Mutant acquisition

And (3) transforming the CRISPR expression vector into agrobacterium GV301, carrying out agrobacterium infection on the hypocotyl of the CRISPR expression vector by taking spring brassica napus Westar as a receptor material, subsequently transferring the CRISPR expression vector into a culture medium for inducing callus, and selecting the callus with good growth vigor for 2-3 times of subculture. Cutting the callus of the grown seedling, transferring to rooting culture medium for continuous culture until macroscopic root system is grown. And transferring the rooted seedlings into a field, and then carrying out cultivation management.

And carrying out first-generation sequencing on T0 generation seedlings by using specific primers to finally obtain two strains Bnaspo-1-1 and Bnaspo-11-1-2.

The primers used were as follows:

BnaSPO11-1-A1-T1-F2：

GAGTGAAGTAATAAAACGGCGCG

BnaSPO11-1-A1-T1-R1：

GAACATAGCAGAAACGAACGGTAAAC

BnaSPO11-1-A1-T2-F2：

CTGTTATGAGGCATGTCCTTATTTCAAG

BnaSPO11-1-A1-T2-R2：

GTCCCGATCACAATATTGTCAG

BnaSPO11-1-C1-T1-F3：

GCGAAGGTAGTAATAAAGCGGCACG

BnaSPO11-1-C1-T1-R2：

GCCCTTCCAAAATTTACCTTTGAATGC

BnaSPO11-1-C1-T2-F3：

GGTGGGTACTTCTGACAGCGATTAC

BnaSPO11-1-C1-T2-R3：

CCAAGCTCCTGGAATTAAGTTATG

Example 2: creation of brassica napus gene REC8 mutant

1. Construction of CRISPR expression vectors

1. Two targets were designed for BnaA10.REC8 and BnaC09.REC8 as shown in SEQ ID NO 5-6 using the CRISPR-P v 2.0.0 website.

2, Four primers were designed as follows:

BnaREC8DT1-BsF：

ATATATGGTCTCGATTGTAAAGGACGAACCCACGCCGTT

BnaREC8-DT1-F0：

TGTAAAGGACGAACCCACGCCGTTTTAGAGCTAGAAATAGC

Bn REC8-DT2-R0：

AACTTCAAAGCGATCATACGTCCAATCTCTTAGTCGACTCTAC

BnaREC8-DT2-BsR：

ATTATTGGTCTCGAAACTTCAAAGCGATCATACGTCCAA

3. Mutant acquisition

And carrying out first-generation sequencing on T0 generation seedlings by using specific primers, and finally obtaining Bnarec-1 and Bnarec-8-2 strains.

The primers used were as follows:

BnaREC8-A10-T2-R1:

CTGCTGCAAGATGGAAAAACATAAATAGTG

BnaREC8-C9-T2-R1:

AAGATGGATGAACGAAAATACAGAAAGAGC

BnaREC8-F1:

CGAGAGGAAAGTAAAGCTCCTATTCGG

BnaREC8-A10-T1-seqF1:

CCGTCAAAATTGATATTTCC

BnaREC8-C9-T1-seqF1:

CTTCTGGTAGAAATTAATGG

example 3: bnaspo11 creation of double mutants of 11-1 rec8 and cytological analysis

The Bnaspo11-1 mutant and Bnarec8 mutant were polymerized using hybridization to give Bnaspo11-1rec8 mutant and subjected to subsequent cytological analysis.

1. Bnaspo11-1-1rec8-1 mutant pollen was stained with Alexander dye. First, 15. Mu.l Alexander stain was pipetted onto a slide using a pipette, then fresh rape flowers were dipped in the stain, then immediately covered with 18X 18cm coverslips and heated at 90℃for 15min, and finally pollen staining was observed under a 10X microscope. As shown in FIG. 1, bnaspo.sup.11-1-1 rec.sup.8-1 mutants were filled with viable and full pollen grains and were uniformly larger than the wild type.

2. The Bnaspo11-1-1rec8-1 mutant tetrad was stained with lichen red stain. First, an anther of a suitable period was picked up, and heated at 60℃for 1min in 1mol/L HCl. The anthers were then removed and soaked in water for 1min, then triturated in lichen red dye with a curved hook-shaped dissecting needle, immediately covered with an 18 x 18cm coverslip and observed under a 40 x microscope. As a result, as shown in FIG. 2, the wild type was substantially balanced tetrads during the tetrad period, whereas Bnaspo11-1-1rec8-1 mutant was mostly tetrads during this period. Thus, the Bnaspo-1-1 rec8-1 mutant skipped the second meiosis.

3. Chromosome behavior was observed for the Bnaspo11-1-1rec8-1 mutant during meiosis. The operation steps are as follows:

(1) Fresh and proper flower buds are taken, and fixed and decolorized by using a Carnot fixing solution (absolute ethyl alcohol: glacial acetic acid=3:1; volume ratio).

(2) The fixed and decolorized flower buds are selected in meiosis period by using Kabao fuchsin dye liquor, and then soaked in 0.01 mol/LPH=4.5 sodium citrate buffer solution for 30-60min.

(3) The anther is put into a piece-spreading enzymolysis liquid for enzymolysis for 50min at 37 ℃,5 mu l H ₂ O is sucked by a liquid-transferring gun and is dripped in the center of a glass slide, then two anthers are clamped by forceps and put into water, then the anthers are knocked into uniform slurry by a hook-shaped dissecting needle, then 15 mu l of 60% acetic acid is sucked by the liquid-transferring gun and dripped, the transparent cell suspension is continuously knocked, and then 15 mu l of 60% acetic acid is added. Subsequently, the spreading was performed on a heating plate at 45 ℃. When the drop on the slide is about to dry, a rinse is performed with pre-chilled Carnot fixative. Finally, the mixture was air-dried on a heating plate at 45 ℃.

(4) After the pieces were dried, 4',6' -diamidino-2-phenylindole (DAPI) was added dropwise for staining, and then the chromosome behavior was observed with a fluorescence microscope.

As a result, as shown in FIG. 3, in the wild-type pollen mother cell, metaphase I19 pairs were orderly arranged on the equatorial plate. At late stage I, homologous chromosomes separate and migrate to the two poles in opposite directions, resulting in the formation of two segregants each containing 19 chromosomes at end stage I. After a second meiosis four daughter cells containing 19 chromosomes were formed at end stage ii. Whereas Bnaspo.sup.11-1-1 rec.sup.8-1 mutants, in metaphase I we observed an ordered arrangement of 38 monovalent bodies on the equatorial plate. Subsequently, sister chromatids of late I monovalent bodies segregate in advance towards the equilibrium and shift to the dipoles. Eventually at end stage I, two segregants each containing 38 chromosomes are formed. Furthermore, bnaspo11-1-1rec8-1 mutant male meiocytes did not undergo a second meiosis. Indicating that meiosis of the mutant has been converted to mitotic-like division, resulting in a cloned non-meiotic gamete.

Example 4: bnaspo11-1 rec8 mutant inbred offspring cytological analysis

Bnaspo11-1-1rec8-1 mutant was filled with viable and full pollen grains and was uniformly larger compared to the wild type (FIG. 1). This also resulted in the Bnaspo-1-1 rec8-1 mutant selfing to produce larger seeds than the wild type (as shown in FIG. 4). These inbreds are subsequently planted in a greenhouse for conventional cultivation management. After the buds of the plants are found, the buds in a proper period are taken, and fixed and decolorized by using a Carnot fixing solution (absolute ethyl alcohol: glacial acetic acid=3:1; volume ratio).

1. Bnaspo11-1 rec8-1 (8 x) mutant pollen was stained with Alexander dye and the staining procedure was as described in example 3. As shown in FIG. 1, bnaspo.sup.11-1 rec8-1 (8X) mutants were filled with viable and full pollen grains and increased uniformly compared to Bnaspo.sup.11-1-1 rec8-1 mutants.

2. The Bnaspo11-1rec8-1 (8 x) mutant tetrad was stained with lichen red stain and experimental procedure was as described in example 3. As a result, as shown in FIG. 2, the wild type was substantially balanced tetrads during the tetrad period, whereas Bnaspo11-1rec8-1 (8X) mutant was mostly tetrads during this period. Thus, the Bnaspo-1 rec8-1 (8 x) mutant also skipped the second meiosis.

3. Chromosome behavior was observed for the Bnaspo11-1 rec8-1 (8 x) mutant during meiosis. The procedure is as in example 3.

As a result, FIG. 3 shows that Bnaspo.sup.11-1 rec8-1 (8X) mutants, in metaphase I, we observed 76 monovalent bodies. Subsequently, sister chromatids of late I monovalent bodies segregate in advance towards the equilibrium and shift to the dipoles. Finally, at end stage I, two segregants each containing 76 chromosomes were formed. Furthermore, bnaspo11-1 rec8-1 (8 x) mutant male meiocytes did not undergo a second meiosis. This also indicated that the Bnaspo-1-1 rec8-1 mutant had increased ploidy in the selfing progeny, indirectly demonstrating that Bnaspo11-1-1rec8-1 mutant female parent cells could also produce cloned non-subtractive gametes.

Example 5: use of Bnaspo11-1 rec8 double mutant in Westar and J9707 hybrid generation

And (3) constructing a CRISPR expression vector simultaneously containing knocked-out genes SPO11-1 and REC8 targets by using CRISPR gene editing technology involved in examples 1 and 2, and carrying out tissue culture by taking the first generation of the hybrid of Westar and J9707 as a receptor to obtain the SPO11-1 rec8 mutant in the background of the hybrid of Westar and J9707.

The required primers are as follows:

MiMe-BnaSPO11-1-DT1-BsF

ATATATGGTCTCGATTGTTCTTGTAGAGGAAGTCGAGTT

MiMe-BnaSPO11-1-DT1-F0

TGTTCTTGTAGAGGAAGTCGAGTTTTAGAGCTAGAAATAGC

MiMe-BnaREC8-DT2-R0

AACGGCGTGGGTTCGTCCTTTACAATCTCTTAGTCGACTCTAC

MiMe-BnaREC8-DT2-BsR

ATTATTGGTCTCGAAACGGCGTGGGTTCGTCCTTTACAA

1. the spo11-1 rec8 mutant pollen in the background of Westar and J9707 hybrids was stained with Alexander dye. As shown in FIG. 1, the spo11-1 rec8 mutant in Westar and J9707 hybrid background was filled with a large number of fertile and full pollen grains and was uniformly larger than the wild type.

2. The spo11-1 rec8 mutant tetrad period in the background of Westar and J9707 hybrids was stained with lichen red stain. As shown in FIG. 2, the hybrid Westar and J9707 was essentially balanced tetrads during tetrad, while the spo11-1 rec8 mutant in the context of the hybrid Westar and J9707 was mostly tetrads during this period. Thus, the spo11-1 rec8 mutant in the context of the Westar and J9707 hybrid skipped the second meiosis.

3. Chromosome behavior of spo11-1 rec8 mutant during meiosis in the context of Westar and J9707 hybrids was observed. As shown in FIG. 3, the spo11-1 rec8 mutant in the context of Westar and J9707 hybrids, in metaphase I, we observed an ordered arrangement of 38 monovalent bodies on the equatorial plate. Subsequently, sister chromatids of late I monovalent bodies segregate in advance towards the equilibrium and shift to the dipoles. Eventually at end stage I, two segregants each containing 38 chromosomes are formed. Furthermore, the spo11-1 rec8 mutant male meiocytes in the context of the Westar and J9707 hybrid did not undergo secondary meiosis. It was shown that meiosis of the spo11-1 rec8 mutant in the context of the Westar and J9707 hybrid had been converted to mitotic-like division, yielding cloned non-meiotic gametes.

Example 6: use of BnamtopVIB rec double mutant in Westar and J9707 hybrid generation

And (3) constructing a CRISPR expression vector simultaneously containing knocked-out genes MTOPVIB and REC8 targets by using CRISPR gene editing technology involved in examples 1 and 2, and carrying out tissue culture by taking the first generation of the hybrid of Westar and J9707 as a receptor to obtain a mtopVIB REC mutant in the background of the hybrid of Westar and J9707.

The required primers were as follows:

MiMe-BnaMTOPVIB-DT1-BsF

ATATATGGTCTCGATTGGGTGCCCTAGAGAGTTCAAGTT

MiMe-BnaMTOPVIB-DT1-F0

TGGGTGCCCTAGAGAGTTCAAGTTTTAGAGCTAGAAATAGC

MiMe-BnaREC8-DT2-R0

AACGGCGTGGGTTCGTCCTTTACAATCTCTTAGTCGACTCTAC

MiMe-BnaREC8-DT2-BsR

ATTATTGGTCTCGAAACGGCGTGGGTTCGTCCTTTACAA

1. mtopVIB rec8 mutant pollen in Westar and J9707 hybrid background was stained with Alexander dye. As shown in FIG. 1, the mtopVIB rec mutant in Westar and J9707 hybrid background was also filled with a large number of viable and full pollen grains and was uniformly larger than the wild type.

2. The spo11-1 rec8 mutant tetrad period in the background of Westar and J9707 hybrids was stained with lichen red stain. As shown in FIG. 2, the Westar and J9707 hybrids were essentially balanced tetrads during tetrad, whereas the mtopVIB rec mutant in the context of Westar and J9707 hybrids was mostly tetrads during this period. Thus, the mtopVIB rec mutant in the context of the Westar and J9707 hybrid skipped the second meiosis.

3. Chromosome behavior was observed for the mtopVIB rec mutant during meiosis in the background of Westar and J9707 hybrids. Results As shown in FIG. 3, the mtopVIB rec mutant in the context of Westar and J9707 hybrids, in metaphase I, we observed an ordered arrangement of 38 monovalent bodies on the equatorial plate. Subsequently, sister chromatids of late I monovalent bodies segregate in advance towards the equilibrium and shift to the dipoles. Eventually at end stage I, two segregants each containing 38 chromosomes are formed. Furthermore, the mtopVIB rec mutant male meiocytes in the Westar and J9707 hybrid background did not undergo a second meiosis. It was shown that meiosis of the mtopVIB rec mutant in the context of the Westar and J9707 hybrid had been converted to mitotic-like division, yielding cloned non-meiotic gametes.

The invention is verified by using SPO11-1 and MTOPVIB proteins as representatives of DNA double strand break proteins involved in meiosis, and proteins such as PRD1, PRD2, PRD3 and DFO which are known in the art to perform the same function can be used to achieve the meiosis of plant germ cells into similar mitosis to produce non-meiotic, fertile cloned gametes of the same parental genotype.

That is, the present invention generates non-meiotic, fertile cloned gametes identical to the parental genotype by editing proteins involved in meiosis DNA double strand breaks (e.g., SPO11-1, MTOPVIB, PRD1, PRD2, PRD3, and DFO) and meiosis specific mucins (e.g., REC 8) to transform meiosis of their plant germ cells into similar mitosis. The subsequent parthenogenesis or haploid induction gene mutation can induce non-reduced cloned gametes to develop into seeds or plants, so that the method is used for fixing plant heterosis, can not influence plant nutrition growth while improving production efficiency, and has wide application value.

The above detailed description describes in detail the practice of the invention, but the invention is not limited to the specific details of the above embodiments. Many simple modifications and variations of the technical solution of the present invention are possible within the scope of the claims and technical idea of the present invention, which simple modifications are all within the scope of the present invention.

Claims

1. A method for producing cloned gametes in plants, characterized in that proteins involved in meiosis DNA double strand breaks and mucins involved in meiosis specific in plants are rendered nonfunctional, the meiosis of germ cells is converted to similar mitosis, and non-meiotic cloned gametes of the same genotype as the parent are produced.

2. The method of claim 1, wherein the protein involved in a meiosis DNA double strand break comprises: SPO11-1, MTOPVIB, PRD1, PRD2, PRD3 and/or DFO, the involvement in meiosis specific adhesion comprising: REC8.

3. The method of claim 2, wherein the loss of function is achieved by genetic mutation or by means of human intervention, the genetic mutation comprising spontaneous mutation and induced mutation, wherein spontaneous mutation is naturally occurring in the body, and induced mutation is induced by external environment; the manual intervention means comprises a gene editing technique comprising: cre-lox system, zinc finger endonuclease system, transcription activator-like effector nuclease system, CRISPR-Cas9 system, RNAi and/or base editor system.

4. The method according to any one of claims 1-2, wherein the amino acid sequence of the SPO11-1 protein is as shown in SEQ ID No. 1-2; the amino acid sequence of MTOPVIB protein is shown as SEQ ID NO 3-4; the amino acid sequence of the REC8 protein is shown as SEQ ID NO. 5-6; the amino acid sequence of the PRD1 protein is shown in SEQ ID NO 7-8; the amino acid sequence of the PRD2 protein is shown as SEQ ID NO 9-12; the amino acid sequence of the PRD3 protein is shown as SEQ ID NO. 13-16; the amino acid sequence of the DFO protein is shown as SEQ ID NO. 17-18.

5. The method of any one of claims 1-4, wherein the plant comprises: rape, cabbage, wheat, oat, cotton, tobacco, pasture, elephant grass, sudan grass, fescue, timothy grass, sugarcane, banana, strawberry, cherry, apple, grape, pear, watermelon, melon, potato, sweet potato, cassava, beet, peanut, coffee, sesame, alfalfa, mustard, cabbage, lavender, red cabbage, broccoli, cauliflower, cabbage, radish, potherb mustard, tomato, eggplant, asparagus, chilli, cucumber, white gourd, towel gourd, pumpkin, leek, yam, orchid, lily, narcissus, chrysanthemum, violet and/or tulip.

6. Use of the method according to any one of claims 1-5 in plant breeding.

7. The use according to claim 6, wherein the plant comprises: rape, cabbage, wheat, oat, cotton, tobacco, pasture, elephant grass, sudan grass, fescue, timothy grass, sugarcane, banana, strawberry, cherry, apple, grape, pear, watermelon, melon, potato, sweet potato, cassava, beet, peanut, coffee, sesame, alfalfa, mustard, cabbage, lavender, red cabbage, broccoli, cauliflower, cabbage, radish, potherb mustard, tomato, eggplant, asparagus, chilli, cucumber, white gourd, towel gourd, pumpkin, leek, yam, orchid, lily, narcissus, chrysanthemum, violet and/or tulip.

8. A method for fixing plant hybrid vigour comprising the steps of:

(1) Obtaining non-subtractive cloned gametes of the same genotype as the parent using the method of any one of claims 1-5;

(2) Non-subtractive clonal gametes are induced to develop into seeds or plants.

9. The method of claim 8, wherein the method of inducing non-subtractive clonal gametes to develop into a seed or plant is any one or a combination of the following:

A. Through the combination of mutation of parthenogenesis or haploid induction genes, proteins required for parthenogenesis comprise BBM1, BBM2 and PAR; proteins required for haploid induction of mutation of genes include CENH3, MTL, PLA1 and DMP;

C. treatment of pollen with ROS inducers produces haploids.

10. The method of claim 8, wherein the plant comprises canola, cabbage, wheat, oat, cotton, tobacco, pasture, grasses, sudan grass, cogongrass, timothy, sugarcane, banana, strawberry, cherry, apple, grape, pear, watermelon, melon, potato, sweet potato, cassava, beet, peanut, coffee, sesame, alfalfa, mustard, cabbage, laver, red tongue, broccoli, cauliflower, cabbage, radish, potherb mustard, tomato, eggplant, asparagus, capsicum, cucumber, white gourd, towel gourd, pumpkin, leek, yam, orchid, lily, narcissus, chrysanthemum, violet, and tulip.