CN118291523A - A method for producing cloned gametes in plants and its application - Google Patents

Abstract

The invention relates to a method for producing cloned gametes in plants and application thereof, which converts meiosis of germ cells into similar mitosis by utilizing the technology such as gene mutation or genetic engineering technology editing to make proteins participating in meiosis DNA double strand break and mucin participating in meiosis specific lose function in plants, and produces non-meiotic cloned gametes with the same genotype as the parent. The subsequent development of cloned gametes into seeds or plants can be realized, so that the heterosis of the crop hybrid seeds can be fixed in a time-saving and convenient manner, the production efficiency of the hybrid seeds is greatly improved, the production cost is reduced, the influence on the plant nutrition growth is avoided, and the method has a wide application value.

Description

A method for producing cloned gametes in plants and its application

Technical Field

The invention belongs to the technical field of biotechnology, and specifically relates to a method for producing cloned gametes in plants and an application thereof.

Background technique

Hybrid vigor refers to the phenomenon that the hybrid offspring F1 of two parents with different genetic characteristics is superior to both parents in terms of growth potential, yield, quality, stress resistance, etc. (Gu Zhoulin et al., 2023). Hybrid vigor has been widely used in agriculture for a long time. By utilizing hybrid vigor, people have greatly increased the yield of wheat, rice, and rapeseed, making a huge contribution to global food security (Jiang Nan et al., 2023). However, hybrid vigor cannot be maintained because hybrids will separate in the next generation. Therefore, people need to continuously prepare hybrids.

The production of hybrids can be divided into three strategic development stages: the "three-line method", the "two-line method" and the "one-line method" (Yuan Longping, 1987). The first generation of hybrid production is a three-line breeding technology that uses cytoplasmic male sterile lines as genetic tools, which is achieved through the matching of cytoplasmic male sterile lines, maintenance lines and restorer lines (referred to as three lines). The three-line method of hybrid production requires finding suitable sterile lines and excellent restorer lines, which are restricted by the restorer gene and thus affect the selection of excellent combinations (Deng Xingwang et al., 2013). Later, a two-line hybrid breeding technology with a relatively simple seed production procedure was proposed, namely the photothermosensitive nuclear sterile line method. Under certain light and temperature conditions, its pollen is fertile, and seeds are propagated through its fertility; under another light and temperature condition, its pollen is sterile. Using its sterility, hybrids can be produced by hybridization with the male parent (Fu Zhiyuan et al., 2018). The photothermosensitive nuclear sterile system will be affected by abnormal weather, resulting in an unstable hybrid production system, which greatly affects the production process of excellent hybrids, thereby increasing production costs and being unfavorable for commercial promotion (Zheng Xingfei et al., 2021). Therefore, the one-line method is considered to be the highest goal of hybrid breeding. The one-line method can cultivate non-segregating F1 hybrids, fix the hybrid vigor of plants, and eliminate the need for seed production.

Apomixis has attracted extensive attention due to its great potential in fixing heterosis. Artificial creation of apomixis is an important direction of current apomixis research. Mitosis instead of meiosis (MIME) can produce diploid gametes with completely identical genetic composition to the maternal parent, which is a key step in artificial creation of apomixis. Studies have found that the first meiosis of the Arabidopsis spo11-1/rec8 double mutant was replaced by a process similar to mitosis, followed by a second division with unbalanced chromosome allocation, resulting in severe gamete infertility. However, when the osd1 mutation that prevents the second meiosis is combined with the spo11-1/rec8 that destroys the first meiosis, the OSD1 gene mutation inhibits the unbalanced chromosome allocation of the spo11-1/rec8 double mutant, resulting in fertile apomixis gametes in which meiosis is replaced by mitosis and the genetic information is completely identical to that of the maternal parent in the spo11-1/rec8/osd1 triple mutant. Similar findings have also been made in rice. That is, three genes need to be mutated at the same time in both Arabidopsis and rice to produce fertile afusion gametes with genetic information that is completely consistent with the mother plant, which is a large workload and low efficiency. In addition, the third gene that needs to be mutated in Arabidopsis and rice, OSD1, is involved in mitosis and cell fate, and will have a negative effect on plant growth.

Summary of the invention

The purpose of the present invention is to provide a method for producing cloned gametes in plants, especially polyploid plants, which only requires mutation of two types of proteins in the plant, namely, proteins involved in meiotic DNA double-strand breaks and meiotic specific adhesion proteins, to make them lose their functions, thereby converting the meiosis of the plant's reproductive cells into mitosis-like divisions, skipping the second meiosis, and obtaining non-reduced fertile cloned gametes with the same genotype as the parent, and subsequently inducing the cloned gametes to develop into seeds or plants, thereby utilizing the hybrid vigor of the plant, more time-saving and conveniently fixing the hybrid vigor of crop hybrids, greatly improving production efficiency, and not affecting the nutritional growth of the plant.

The present invention provides a method for producing cloned gametes in plants, which causes the proteins involved in meiotic DNA double-strand breaks and the specific adhesion proteins involved in meiosis to lose their functions, convert the meiosis of reproductive cells into mitosis-like division, and produce non-reduced cloned gametes with the same genotype as the parent.

Furthermore, the proteins involved in meiotic DNA double-strand breaks include: SPO11-1, MTOPVIB, PRD1, PRD2, PRD3 and/or DFO, and the proteins involved in meiotic specific adhesion include: REC8.

Furthermore, the loss of function can be achieved through gene mutation or artificial intervention, the gene mutation includes spontaneous mutation and induced mutation, wherein spontaneous mutation is naturally generated inside the body, and induced mutation is induced by the external environment; the artificial intervention means includes gene editing technology, and the gene editing technology includes: Cre-lox system, zinc finger nuclease system, transcription activator-like effector nuclease system, CRISPR-Cas9 system, RNAi and/or base editor system.

Furthermore, the amino acid sequence of the SPO11-1 protein is shown in SEQ ID NO:1-2; the amino acid sequence of the MTOPVIB protein is shown in SEQ ID NO:3-4; the amino acid sequence of the REC8 protein is shown in SEQ ID NO:5-6; the amino acid sequence of the PRD1 protein is shown in SEQ ID NO:7-8; the amino acid sequence of the PRD2 protein is shown in SEQID NO:9-12; the amino acid sequence of the PRD3 protein is shown in SEQ ID NO:13-16; and the amino acid sequence of the DFO protein is shown in SEQ ID NO:17-18.

Furthermore, the plants include: rapeseed, cabbage, kale, wheat, oats, cotton, tobacco, forage grass, elephant grass, Sudan grass, orchard grass, timothy grass, sugarcane, banana, strawberry, cherry, apple, grape, pear, watermelon, melon, potato, sweet potato, cassava, beet, peanut, coffee, sesame, alfalfa, mustard, Chinese cabbage, purple cabbage, red cabbage, broccoli, cauliflower, cabbage, radish, Chinese mustard, tomato, eggplant, asparagus, pepper, cucumber, wax gourd, loofah, pumpkin, leek, yam, orchid, lily, daffodil, chrysanthemum, violet and/or tulip.

The invention also provides application of the method in plant breeding.

Furthermore, the plants include: rapeseed, cabbage, kale, wheat, oats, cotton, tobacco, forage grass, elephant grass, Sudan grass, orchard grass, timothy grass, sugarcane, banana, strawberry, cherry, apple, grape, pear, watermelon, melon, potato, sweet potato, cassava, beet, peanut, coffee, sesame, alfalfa, mustard, Chinese cabbage, purple cabbage, red cabbage, broccoli, cauliflower, cabbage, radish, Chinese mustard, tomato, eggplant, asparagus, pepper, cucumber, wax gourd, loofah, pumpkin, leek, yam, orchid, lily, daffodil, chrysanthemum, violet and/or tulip.

The present invention also provides a method for fixing plant heterosis, comprising the following steps:

(1) using the above method to obtain non-reduced clonal gametes with the same genotype as the parent;

(2) Induce non-reduced clonal gametes to develop into seeds or plants.

Further, the method of inducing non-reduced cloned gametes to develop into seeds or plants is any one of the following or a combination thereof:

A. This is achieved through a combination of mutations in genes involved in parthenogenesis or haploid induction. The proteins required for parthenogenesis include BBM1, BBM2, and PAR; the proteins required for mutations in haploid induction genes include CENH3, MTL, PLA1, and DMP.

B. Obtaining haploid plants with non-reduced clonal gametes through microspore culture technology;

C. Treatment of pollen with ROS inducers produces haploids.

Further, the plants include rapeseed, cabbage, kale, wheat, oats, cotton, tobacco, forage grass, elephant grass, Sudan grass, orchard grass, timothy grass, sugarcane, banana, strawberry, cherry, apple, grape, pear, watermelon, melon, potato, sweet potato, cassava, beet, peanut, coffee, sesame, alfalfa, mustard, Chinese cabbage, purple cabbage, red cabbage, broccoli, cauliflower, cabbage, radish, Chinese mustard, tomato, eggplant, asparagus, pepper, cucumber, wax gourd, loofah, pumpkin, leek, yam, orchid, lily, daffodil, chrysanthemum, violet and tulip.

Beneficial effects: The present invention only needs to mutate the proteins involved in meiotic DNA double-strand breaks in the plant body and the specific adhesion proteins involved in meiosis to make them lose their functions, so as to convert the meiosis of the plant's reproductive cells into mitosis-like divisions, skip the second meiosis, and then obtain non-reduced fertile cloned gametes with the same genotype as the parents. Subsequently, the cloned gametes can be combined with parthenogenesis or mutation induction of haploid induction genes, or microspore culture technology, etc., so that the cloned gametes develop into seeds or plants, thereby saving time and conveniently fixing the hybrid vigor of crop hybrids, greatly improving production efficiency, accelerating the breeding process of excellent hybrids, reducing production costs, and not affecting plant nutritional growth, and having broad application value. Moreover, this method is conservative in other polyploid plants such as cotton, wheat, etc., and is of great significance for polyploid crops.

BRIEF DESCRIPTION OF THE DRAWINGS

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without creative work.

Figure 1 shows the pollen staining images of WT, spo11-1 rec8-1(Westar), spo11-1 rec8-1(8x)(Westar), spo11-1rec8(Westar x J9707 F1) and mtopVIB rec8(Westar x J9707 F1) mutant plants, where 8x represents octoploid and F1 represents the first hybrid generation.

Figure 2 shows the orcein staining of Westar, spo11-1 rec8-1(Westar), spo11-1 rec8-1(8x)(Westar), Westarx J9707 F1, spo11-1 rec8(Westar x J9707 F1) and mtopVIB rec8(Westar x J9707 F1) mutant plants at the tetrad stage.

Figure 3 shows the observation of chromosome behavior in pollen mother cells of WT, spo11-1 rec8-1(Westar), spo11-1 rec8-1(8x)(Westar), spo11-1rec8(Westar x J9707 F1) and mtopVIB rec8(Westar x J9707 F1) mutant plants.

FIG. 4 is a comparison of seeds of WT and spo11-1 rec8-1 mutant plants.

Detailed ways

The following examples are only used to more clearly illustrate the technical scheme of the present invention, and are therefore only used as examples, and cannot be used to limit the scope of protection of the present invention. It should be noted that, unless otherwise stated, the technical terms or scientific terms used in this application should be the usual meanings understood by those skilled in the art to which the present invention belongs. Unless otherwise stated, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art. Unless otherwise stated, the reagents and materials used in the following examples are commercially available.

Example 1 Creation of the Brassica napus SPO11-1 mutant

1. Construction of CRISPR expression vector

1. Two targets were designed using the CRISPR-P v2.0 website for BnaA01.SPO11-1 and BnaC01.SPO11-1 as shown in SEQ ID NO: 1-2.

2. Design four primers as follows:

BnaSPO11-1DT1-BsF:

ATATATGGTCTCGATTGATCTGCTTCGAAAGATCAAGTT

BnaSPO11-1-DT1-F0:

TGATCTGCTTCGAAAGATCAAGTTTTAGAGCTAGAAATAGC

BnaSPO11-1-DT2-R0:

AACTCGACTTCCTCTACAAGAACAATCTCTTAGTCGACTCTAC

BnaSPO11-1-DT2-BsR:

ATTATTGGTCTCGAAACTCGACTTCCTCTACAAGAACAA

3. Use 1 ng/μl pCBC-DT1T2 as template for four-primer PCR amplification. BnaSPO11-1DT1BsF/BnaSPO11-1-DT2-BsR is the normal primer concentration; BnaSPO11-1-DT1--F0/BnaSPO11-1-DT2--R0 is diluted 20 times.

4. Purify and recover the PCR product, and establish a 15μl restriction enzyme digestion-ligation reaction system, which includes 2μl PCR fragment, 2μl pKSE401 vector plasmid, 1.5μl 10xT4Buffer, 1.5μl 10xBSA, 1μl BsaI, 1μl T4 Ligase and 6μl _ddH2O .

5. Take 5 μl of Top10 colon competent cells and screen them using Kana plates. After placing in a 37°C constant temperature incubator for about 12 hours, pick the plaques for colony PCR identification. Then select the correct plaques for shaking, and extract the plasmid the next day to obtain the CRISPR expression vector.

2. Obtaining mutants

The CRISPR expression vector was transformed into Agrobacterium GV301, and then the spring Brassica napus Westar was used as the recipient material to infect its hypocotyl with Agrobacterium. Subsequently, it was transferred to the medium for inducing callus tissue and cultured for 2 to 3 weeks. The callus tissue with good growth was selected for 2 to 3 subcultures. The callus tissue that has grown seedlings was cut and transferred to the rooting medium for continued culture until the roots visible to the naked eye grew. The rooted seedlings were transferred to the field and then cultivated and managed.

The T0 generation seedlings were sequenced using specific primers, and eventually two strains, Bnaspo11-1-1 and Bnaspo11-1-2, were obtained.

The primers used are as follows:

BnaSPO11-1-A1-T1-F2:

GAGTGAAGTAATAAAACGGCGCG

BnaSPO11-1-A1-T1-R1:

GAACATAGCAGAAACGAACGGTAAAC

BnaSPO11-1-A1-T2-F2:

CTGTTATGAGGCATGTCCTTATTTCAAG

BnaSPO11-1-A1-T2-R2:

GTCCCGATCACAATATTGTCAG

BnaSPO11-1-C1-T1-F3:

GCGAAGGTAGTAATAAAGCGGCACG

BnaSPO11-1-C1-T1-R2:

GCCCTTCCAAAATTTACCTTTGAATGC

BnaSPO11-1-C1-T2-F3:

GGTGGGTACTTCTGACAGCGATTAC

BnaSPO11-1-C1-T2-R3:

CCAAGCTCCTGGAATTAAGTTATG

Example 2: Creation of a mutant of the Brassica napus gene REC8

1. Construction of CRISPR expression vector

1. Two targets were designed using the CRISPR-P v2.0 website for BnaA10.REC8 and BnaC09.REC8 as shown in SEQ ID NO:5-6.

2 Design four primers as follows:

BnaREC8DT1-BsF:

ATATATGGTCTCGATTGTAAAGGACGAACCCACGCCGTT

BnaREC8-DT1-F0:

TGTAAAGGACGAACCCACGCCGTTTTAGAGCTAGAAATAGC

Bn REC8-DT2-R0:

AACTTCAAAGCGATCATACGTCCAATCTCTTAGTCGACTCTAC

BnaREC8-DT2-BsR:

ATTATTGGTCTCGAAACTTCAAAGCGATCATACGTCCAA

3. Use 1 ng/μl pCBC-DT1T2 as template for four-primer PCR amplification. BnaSPO11-1DT1BsF/BnaSPO11-1-DT2-BsR is the normal primer concentration; BnaSPO11-1-DT1--F0/BnaSPO11-1-DT2--R0 is diluted 20 times.

4. Purify and recover the PCR product, and establish a 15μl restriction enzyme digestion-ligation reaction system, which includes 2μl PCR fragment, 2μl pKSE401 vector plasmid, 1.5μl 10xT4Buffer, 1.5μl 10xBSA, 1μl BsaI, 1μl T4 Ligase and 6μl _ddH2O .

5. Take 5 μl of Top10 colon competent cells and screen them using Kana plates. After placing in a 37°C constant temperature incubator for about 12 hours, pick the plaques for colony PCR identification. Then select the correct plaques for shaking, and extract the plasmid the next day to obtain the CRISPR expression vector.

3. Obtaining mutants

The CRISPR expression vector was transformed into Agrobacterium GV301, and then the spring Brassica napus Westar was used as the recipient material to infect its hypocotyl with Agrobacterium. Subsequently, it was transferred to the medium for inducing callus tissue and cultured for 2 to 3 weeks. The callus tissue with good growth was selected for 2 to 3 subcultures. The callus tissue that has grown seedlings was cut and transferred to the rooting medium for continued cultivation until the roots visible to the naked eye grew. The rooted seedlings were transferred to the field and then cultivated and managed.

The T0 generation seedlings were sequenced using specific primers, and eventually two strains, Bnarec8-1 and Bnarec8-2, were obtained.

The primers used are as follows:

BnaREC8-A10-T2-R1:

CTGCTGCAAGATGGAAAAACATAAATAGTG

BnaREC8-C9-T2-R1:

AAGATGGATGAACGAAAATACAGAAAGAGC

BnaREC8-F1:

CGAGAGGAAAGTAAAGCTCCTATTCGG

BnaREC8-A10-T1-seqF1:

CCGTCAAAATTGATATTTCC

BnaREC8-C9-T1-seqF1:

CTTCTGGTAGAAATTAATGG

Example 3: Creation and cytological analysis of the Bnaspo11-1 rec8 double mutant

The Bnaspo11-1 mutant and the Bnarec8 mutant were hybridized to obtain the Bnaspo11-1rec8 mutant, and subsequent cytological analysis was performed.

1. Use Alexander stain to stain the pollen of the Bnaspo11-1-1rec8-1 mutant. First, use a pipette to draw 15μl of Alexander stain and drop it on a glass slide, then take a fresh rapeseed flower and dip it in the stain, then immediately cover it with an 18×18cm coverslip and heat it on a 90℃ heating plate for 15min, and finally observe the pollen staining under a 10× microscope. The results are shown in Figure 1. The Bnaspo11-1-1rec8-1 mutant is full of fertile and plump pollen grains, and is uniformly larger than the wild type.

2. Use orcein dye to stain the tetrad stage of the Bnaspo11-1-1rec8-1 mutant. First, pick out an anther of the appropriate period and heat it in 1mol/L HCl at 60℃ for 1min. Then take out the anther and soak it in water for 1min, then crush the anther with a hook-shaped dissecting needle in the orcein dye solution, immediately cover it with an 18×18cm coverslip and observe it under a 40× microscope. The results are shown in Figure 2. The wild type is basically a balanced tetrad during the tetrad period, while the Bnaspo11-1-1rec8-1 mutant is mostly dyads during this period. Therefore, the Bnaspo11-1-1rec8-1 mutant skipped the second meiotic division.

3. Observe the chromosome behavior of the Bnaspo11-1-1rec8-1 mutant during meiosis. The steps are as follows:

(1) Take fresh flower buds of appropriate age and fix and decolorize them with Carnoy's fixative (absolute ethanol: glacial acetic acid = 3:1; volume ratio).

(2) The fixed and decolorized flower buds were selected for meiosis using Carbofusin dye, and then immersed in 0.01 mol/LPH = 4.5 sodium citrate buffer for 30-60 min.

(3) Place the anthers in the enzymatic solution for enzymatic hydrolysis at 37°C for 50 min. Use a pipette to draw 5 μl of H ₂ O and drop it in the center of the slide. Then use tweezers to pick up two anthers and put them in water. Then use a curved hook-shaped dissecting needle to knock them into a homogenate. Then use a pipette to draw 15 μl of 60% acetic acid and drop it in. Continue to knock it into a transparent cell suspension, and then add 15 μl of 60% acetic acid. Then, spread the slide on a heating plate at 45°C. When the droplets on the slide are about to dry, rinse them with pre-cooled Carnoy's fixative. Finally, place them on a heating plate at 45°C to air dry.

(4) After the slide is dry, add 4’,6’-diamidino-2-phenylindole (DAPI) for staining, and then observe chromosome behavior using a fluorescence microscope.

The results are shown in Figure 3. In the wild-type pollen mother cells, 19 pairs of bivalents are orderly arranged on the equatorial plate in metaphase I. In anaphase I, homologous chromosomes separate and migrate to the two poles in opposite directions, resulting in the formation of dyads containing 19 chromosomes each in telophase I. After the second meiotic division, four daughter cells containing 19 chromosomes are formed in telophase II. In the Bnaspo11-1-1rec8-1 mutant, we observed 38 univalents orderly arranged on the equatorial plate in metaphase I. Subsequently, the sister chromatids of the univalents separated and moved to the two poles in advance in anaphase I. Finally, in telophase I, dyads containing 38 chromosomes each are formed. In addition, the male mother cells of the Bnaspo11-1-1rec8-1 mutant did not undergo the second meiotic division. This indicates that the meiosis of the mutant has been transformed into mitotic-like division, producing clonal non-reduced gametes.

Example 4: Cytological analysis of self-pollinated progeny of Bnaspo11-1 rec8 mutant

The Bnaspo11-1-1rec8-1 mutant was full of fertile and plump pollen grains, and was uniformly larger than the wild type (Figure 1). This also caused the Bnaspo11-1-1rec8-1 mutant to produce larger seeds than the wild type after self-pollination (as shown in Figure 4). These self-pollinated seeds were subsequently planted in the greenhouse for conventional cultivation and management. After the plants budded, the flower buds at the appropriate period were taken and fixed and decolorized with Carnoy's fixative (anhydrous ethanol: glacial acetic acid = 3:1; volume ratio).

1. The pollen of the Bnaspo11-1 rec8-1(8x) mutant was stained with Alexander stain, and the staining steps were as described in Example 3. As shown in FIG1 , the Bnaspo11-1 rec8-1(8x) mutant was full of fertile and plump pollen grains, and was uniformly enlarged compared with the Bnaspo11-1-1 rec8-1 mutant.

2. The tetrad stage of the Bnaspo11-1 rec8-1(8x) mutant was stained with orcein dye, and the experimental steps were as described in Example 3. As shown in Figure 2, the wild type was basically a balanced tetrad during the tetrad stage, while the Bnaspo11-1 rec8-1(8x) mutant was mostly a dyad during this period. Therefore, the Bnaspo11-1rec8-1(8x) mutant also skipped the second meiotic division.

3. Observe the chromosome behavior of the Bnaspo11-1 rec8-1 (8x) mutant during meiosis. The operation steps are the same as those in Example 3.

The results are shown in Figure 3. In the Bnaspo11-1 rec8-1(8x) mutant, we observed 76 univalents in metaphase I. Subsequently, in anaphase I, the sister chromatids of the univalents separated and moved to the two poles in a balanced manner in advance. Finally, in telophase I, dyads containing 76 chromosomes were formed. In addition, the male meiocytes of the Bnaspo11-1 rec8-1(8x) mutant did not undergo the second meiotic division. This also indicates that the ploidy of the self-pollinated offspring of the Bnaspo11-1-1rec8-1 mutant is increased, indirectly proving that the female meiocytes of the Bnaspo11-1-1rec8-1 mutant can also produce cloned non-reduced gametes.

Example 5: Application of the Bnaspo11-1 rec8 double mutant in the first generation hybrid of Westar and J9707

The CRISPR gene editing technology involved in Example 1 and Example 2 was used to construct a CRISPR expression vector containing both the knockout gene SPO11-1 and the REC8 target site, and tissue culture was performed using the first generation of a hybrid of Westar and J9707 as the recipient to obtain the spo11-1 rec8 mutant in the background of a hybrid of Westar and J9707.

The primers required are as follows:

MiMe-BnaSPO11-1-DT1-BsF

ATATATGGTCTCGATTGTTCTTGTAGAGGAAGTCGAGTT

MiMe-BnaSPO11-1-DT1-F0

TGTTCTTGTAGAGGAAGTCGAGTTTTAGAGCTAGAAATAGC

MiMe-BnaREC8-DT2-R0

AACGGCGTGGGTTCGTCCTTTACAATCTCTTAGTCGACTCTAC

MiMe-BnaREC8-DT2-BsR

ATTATTGGTCTCGAAACGGCGTGGGTTCGTCCTTTACAA

1. The pollen of the spo11-1 rec8 mutant in the hybrid background of Westar and J9707 was stained with Alexander stain. As shown in Figure 1, the spo11-1 rec8 mutant in the hybrid background of Westar and J9707 was full of fertile and plump pollen grains, and was uniformly larger than the wild type.

2. The spo11-1 rec8 mutant in the hybrid background of Westar and J9707 was stained with orcein red at the tetrad stage. As shown in Figure 2, the hybrid of Westar and J9707 was basically a balanced tetrad at the tetrad stage, while the spo11-1 rec8 mutant in the hybrid background of Westar and J9707 was mostly dyads at this stage. Therefore, the spo11-1 rec8 mutant in the hybrid background of Westar and J9707 skipped the second meiotic division.

3. Observe the chromosome behavior of the spo11-1 rec8 mutant during meiosis in the hybrid background of Westar and J9707. The results are shown in Figure 3. In the spo11-1 rec8 mutant in the hybrid background of Westar and J9707, we observed 38 univalents arranged in an orderly manner on the equatorial plate in metaphase I. Subsequently, in anaphase I, the sister chromatids of the univalents separated and moved to the two poles in a balanced manner in advance. Finally, in telophase I, dyads containing 38 chromosomes each were formed. In addition, the male meiocytes of the spo11-1 rec8 mutant in the hybrid background of Westar and J9707 did not undergo the second meiotic division. This shows that the meiosis of the spo11-1 rec8 mutant in the hybrid background of Westar and J9707 has been transformed into mitotic division, producing clonal non-reducing gametes.

Example 6: Application of the BnamtopVIB rec8 double mutant in the first generation hybrid of Westar and J9707

The CRISPR gene editing technology involved in Example 1 and Example 2 was used to construct a CRISPR expression vector containing both the knockout gene MTOPVIB and REC8 targets, and tissue culture was performed using the first generation of a hybrid of Westar and J9707 as a recipient to obtain an mtopVIB rec8 mutant in the background of a hybrid of Westar and J9707.

The primers required are as follows:

MiMe-BnaMTOPVIB-DT1-BsF

ATATATGGTCTCGATTGGGTGCCCTAGAGAGTTCAAGTT

MiMe-BnaMTOPVIB-DT1-F0

TGGGTGCCCTAGAGAGTTCAAGTTTTAGAGCTAGAAATAGC

MiMe-BnaREC8-DT2-R0

AACGGCGTGGGTTCGTCCTTTACAATCTCTTAGTCGACTCTAC

MiMe-BnaREC8-DT2-BsR

ATTATTGGTCTCGAAACGGCGTGGGTTCGTCCTTTACAA

1. Alexander stain was used to stain the pollen of the mtopVIB rec8 mutant in the hybrid background of Westar and J9707. As shown in Figure 1, the mtopVIB rec8 mutant in the hybrid background of Westar and J9707 was also full of fertile and plump pollen grains, and was uniformly larger than the wild type.

2. The spo11-1 rec8 mutant in the hybrid background of Westar and J9707 was stained with orcein red at the tetrad stage. As shown in Figure 2, the hybrid of Westar and J9707 was basically a balanced tetrad at the tetrad stage, while the mtopVIB rec8 mutant in the hybrid background of Westar and J9707 was mostly dyads at this stage. Therefore, the mtopVIB rec8 mutant in the hybrid background of Westar and J9707 skipped the second meiotic division.

3. Observe the chromosome behavior of the mtopVIB rec8 mutant during meiosis in the hybrid background of Westar and J9707. The results are shown in Figure 3. In the mtopVIB rec8 mutant in the hybrid background of Westar and J9707, we observed 38 univalents arranged in an orderly manner on the equatorial plate in metaphase I. Subsequently, in anaphase I, the sister chromatids of the univalents separated and moved to the two poles in advance. Finally, in telophase I, dyads containing 38 chromosomes were formed. In addition, the male meiocytes of the mtopVIB rec8 mutant in the hybrid background of Westar and J9707 did not undergo the second meiotic division. This shows that the meiosis of the mtopVIB rec8 mutant in the hybrid background of Westar and J9707 has been transformed into mitotic division, producing clonal non-reduced gametes.

The present invention only uses SPO11-1 and MTOPVIB proteins as representatives of proteins involved in meiotic DNA double-strand breaks for verification, while proteins known in the art that can perform the same function, such as PRD1, PRD2, PRD3 and DFO, can all be used to achieve the conversion of plant reproductive cells' meiosis into mitosis-like divisions as described in the present invention to produce non-reduced fertile clonal gametes with the same genotype as the parent.

That is, the present invention edits proteins involved in meiotic DNA double-strand breaks (such as SPO11-1, MTOPVIB, PRD1, PRD2, PRD3 and DFO) and meiosis-specific adhesion proteins (such as REC 8), thereby converting the meiosis of plant germ cells into mitosis-like divisions, and producing non-reduced fertile cloned gametes with the same genotype as the parents. Subsequently, the non-reduced cloned gametes can be induced to develop into seeds or plants by combining parthenogenesis or mutation of haploid induction genes, and then used to fix plant heterosis, which improves production efficiency without affecting plant nutritional growth, and has broad application value.

The above specific embodiments describe the implementation of the present invention in detail, but the present invention is not limited to the specific details in the above embodiments. Within the scope of the claims and technical concept of the present invention, the technical solution of the present invention can be modified and changed in many simple ways, and these simple modifications all belong to the protection scope of the present invention.

Claims (10)

1. A method for producing cloned gametes in plants, characterized in that proteins involved in meiosis DNA double strand breaks and mucins involved in meiosis specific in plants are rendered nonfunctional, the meiosis of germ cells is converted to similar mitosis, and non-meiotic cloned gametes of the same genotype as the parent are produced.

2. The method of claim 1, wherein the protein involved in a meiosis DNA double strand break comprises: SPO11-1, MTOPVIB, PRD1, PRD2, PRD3 and/or DFO, the involvement in meiosis specific adhesion comprising: REC8.

3. The method of claim 2, wherein the loss of function is achieved by genetic mutation or by means of human intervention, the genetic mutation comprising spontaneous mutation and induced mutation, wherein spontaneous mutation is naturally occurring in the body, and induced mutation is induced by external environment; the manual intervention means comprises a gene editing technique comprising: cre-lox system, zinc finger endonuclease system, transcription activator-like effector nuclease system, CRISPR-Cas9 system, RNAi and/or base editor system.

4. The method according to any one of claims 1-2, wherein the amino acid sequence of the SPO11-1 protein is as shown in SEQ ID No. 1-2; the amino acid sequence of MTOPVIB protein is shown as SEQ ID NO 3-4; the amino acid sequence of the REC8 protein is shown as SEQ ID NO. 5-6; the amino acid sequence of the PRD1 protein is shown in SEQ ID NO 7-8; the amino acid sequence of the PRD2 protein is shown as SEQ ID NO 9-12; the amino acid sequence of the PRD3 protein is shown as SEQ ID NO. 13-16; the amino acid sequence of the DFO protein is shown as SEQ ID NO. 17-18.

5. The method of any one of claims 1-4, wherein the plant comprises: rape, cabbage, wheat, oat, cotton, tobacco, pasture, elephant grass, sudan grass, fescue, timothy grass, sugarcane, banana, strawberry, cherry, apple, grape, pear, watermelon, melon, potato, sweet potato, cassava, beet, peanut, coffee, sesame, alfalfa, mustard, cabbage, lavender, red cabbage, broccoli, cauliflower, cabbage, radish, potherb mustard, tomato, eggplant, asparagus, chilli, cucumber, white gourd, towel gourd, pumpkin, leek, yam, orchid, lily, narcissus, chrysanthemum, violet and/or tulip.

6. Use of the method according to any one of claims 1-5 in plant breeding.

7. The use according to claim 6, wherein the plant comprises: rape, cabbage, wheat, oat, cotton, tobacco, pasture, elephant grass, sudan grass, fescue, timothy grass, sugarcane, banana, strawberry, cherry, apple, grape, pear, watermelon, melon, potato, sweet potato, cassava, beet, peanut, coffee, sesame, alfalfa, mustard, cabbage, lavender, red cabbage, broccoli, cauliflower, cabbage, radish, potherb mustard, tomato, eggplant, asparagus, chilli, cucumber, white gourd, towel gourd, pumpkin, leek, yam, orchid, lily, narcissus, chrysanthemum, violet and/or tulip.

8. A method for fixing plant hybrid vigour comprising the steps of:

(1) Obtaining non-subtractive cloned gametes of the same genotype as the parent using the method of any one of claims 1-5;

(2) Non-subtractive clonal gametes are induced to develop into seeds or plants.

9. The method of claim 8, wherein the method of inducing non-subtractive clonal gametes to develop into a seed or plant is any one or a combination of the following:

A. Through the combination of mutation of parthenogenesis or haploid induction genes, proteins required for parthenogenesis comprise BBM1, BBM2 and PAR; proteins required for haploid induction of mutation of genes include CENH3, MTL, PLA1 and DMP;

B. haploid plants of non-subtractive cloned gametes are obtained by microspore culture techniques;

C. treatment of pollen with ROS inducers produces haploids.

10. The method of claim 8, wherein the plant comprises canola, cabbage, wheat, oat, cotton, tobacco, pasture, grasses, sudan grass, cogongrass, timothy, sugarcane, banana, strawberry, cherry, apple, grape, pear, watermelon, melon, potato, sweet potato, cassava, beet, peanut, coffee, sesame, alfalfa, mustard, cabbage, laver, red tongue, broccoli, cauliflower, cabbage, radish, potherb mustard, tomato, eggplant, asparagus, capsicum, cucumber, white gourd, towel gourd, pumpkin, leek, yam, orchid, lily, narcissus, chrysanthemum, violet, and tulip.