CN112662684A - Method for improving male fertility of cotton at high temperature - Google Patents

Abstract

The invention belongs to the technical field of plant molecular breeding, and particularly relates to a method for improving male fertility of cotton at high temperature. The invention discovers that the expression of jasmonate synthetase gene GhACO2 in cotton anther is inhibited at high temperature, so that the content of endogenous jasmonic acid in the anther is reduced. A cotton mutant is obtained by knocking out a GhACO2 gene, and the mutant shows male sterility phenotypic characteristics at normal temperature. And the cotton mutant with the GhACO2 gene knocked out is sprayed with methyl jasmonate in the bud stage, so that the male fertility of the mutant can be restored. The method can obviously reduce the cotton male abortion caused by high temperature and the problem of great cotton yield reduction caused by the cotton male abortion.

Description

Method for improving male fertility of cotton at high temperature

Technical Field

The invention belongs to the technical field of plant molecular breeding, and particularly relates to a method for improving male fertility of cotton at high temperature.

Background

The cotton is an important economic crop, the optimal growth temperature is 20-30 ℃, the activity of the cotton pollen is reduced when the optimal growth temperature is exceeded, the bolling rate is reduced, the fiber development is hindered, and the yield and the quality of the cotton fiber are seriously influenced (Pettigrew 2008). In recent years, the cotton production area in China frequently encounters extreme high-temperature weather of over 35 ℃ in 7-8 months in summer, so that a great amount of key buds and bolls fall off in the boll formation period, and the reason is mainly male abortion caused by high temperature, such as: pollen abortion, anther non-dehiscence, eventually leading to pollination losses, resulting in a significant yield drop (Min et al, 2013; 2014). Therefore, in order to deal with the serious yield reduction caused by high temperature, a series of researches and researches on protective measures are necessary.

At present, no effective field chemical control and management means are available at home and abroad to improve the male fertility of cotton at high temperature, and a reliable measure for improving the fertility of male reproductive organs of cotton at high temperature is urgently needed in the field to improve the resistance of cotton and achieve the purpose of stable yield.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provide a method for improving and improving the male fertility of cotton at high temperature.

The invention discovers that the expression of jasmonate synthetase gene GhACO2 in cotton anther is inhibited at high temperature, so that the content of endogenous jasmonic acid in the anther is reduced. A cotton mutant is obtained by knocking out a GhACO2 gene, and the mutant shows male sterility phenotypic characteristics at normal temperature. And the cotton mutant with the GhACO2 gene knocked out is sprayed with methyl jasmonate in the bud stage, so that the male fertility of the mutant can be restored. The method can obviously reduce the cotton male abortion caused by high temperature and the problem of great cotton yield reduction caused by the cotton male abortion.

The technical scheme of the invention is as follows:

(1) according to the technical scheme shown in FIG. 1, firstly, the high-temperature sensitive cotton material is subjected to high-temperature treatment, transcriptome sequencing is performed at different anther development stages, the jasmonic acid metabolic pathway is found to be disturbed, and the expression change of acetyl coenzyme A oxidase (GhACO2) is found to be most obvious (FIG. 2);

(2) the jasmonic acid content of the anthers in three key periods under the high-temperature stress of the sensitive high-temperature cotton material is measured, and the jasmonic acid content in three key periods of anther development is found to be reduced by the high temperature (figure 3);

(3) through sequence analysis and cloning, a DNA fragment of the GhACO2 gene which can be used as a molecular marker for auxiliary selection is obtained, and the obtained fragment is named as Gh _ A11G1832, and the nucleotide sequence of the DNA fragment is shown in a sequence table SEQ ID NO:1 is shown. The sequence of the DNA fragment is used for designing sgRNA1 and sgRNA2 of two target sites, and the two target sites can be used for creating a CRISPR mutant of cotton;

wherein:

the nucleotide sequence of sgRNA1 is shown below:

sgRNA1：TCGCCAGCGTGACCCGTCGC；

the nucleotide sequence of sgRNA2 is shown below:

sgRNA2：GCTGAGGTGAACGTTGGAGG。

the two target sites are shown in SEQ ID NO: the sequence position shown in 1 is 44-63bp and 102-121 bp. Under the guidance of the two sgRNAs, the editing element can accurately find the position to be edited and carry out site-directed mutation on the target gene.

(3) The sgRNA1-guid RNA and the sgRNA2-guid RNA are connected in series by using an overlap extension PCR method (the series connection method is a common overlap extension method in the field) to form a functional element with two target site information, and then the functional element is constructed on a CRISPR/Cas9 vector pRGEB32-GhU6.7-NPT II (vector source: Wang et al.2018) by a conventional one-step cloning method to obtain a high-efficiency transformation vector GhU6.7:: sgRNA1-sgRNA 2.

(4) A transgenic cotton material is obtained by transforming cotton (the transformed variety is preferably upland cotton variety Yu 668, but the practice of the invention is not limited to this variety) using Agrobacterium-mediated genetic transformation.

(5) High-throughput sequencing of T0 generation individual strains verifies that the GhACO2 gene is edited and has no off-target phenomenon, and a mutant named Ghaco2 is obtained.

(6) By analyzing the T0 generation Ghaco2 mutant strain, the five homozygously mutated Ghaco2 strains are shown to be completely aborted in males.

(7) Through means of paraffin section, scanning electron microscope, transmission electron microscope and the like, the Ghaco2 mutant can normally form tetrad microspores, but the microspores lack contents, the contents can be gradually degraded, the microspores form cavities, and finally shrink, and active pollen cannot be developed.

(8) Searching the optimum concentration of exogenous spraying methyl jasmonate, and its concrete steps are respectively dissolving methyl jasmonate with different masses in 0.05% Tween 20 solution, preparing into 0mol/L, 5X10^-6mol/L，5×10^-4mol/L，5×10^{- 2}Spraying a methyl jasmonate solution with mol/L gradient concentration on early buds of the Ghaco2 mutant, carrying out phenotype observation, and determining the 5 multiplied by 10 of the methyl jasmonate solution by experiments^-4The mol/L is the optimal spraying concentration, and the male sterile phenotype of the Ghaco2 mutant can be recovered under the optimal spraying concentration without causing early bud shedding.

(9) Spraying 5x10 of high-temperature sensitive cotton material under high-temperature treatment^-4When the bud grows to bloom, the early bud of the cotton sprayed with the 0.05% Tween 20 solution is observed, the anther does not crack, and the pollen does not have activity. And spraying 5X10^-4most cotton anthers of the methyl jasmonate solution of mol/L crack, and most pollen has activity.

The method of the invention can effectively improve the male fertility of cotton at high temperature.

The invention has the beneficial effects that:

(1) the invention discovers that high temperature can disturb the expression of the GhACO2 gene to cause male abortion of cotton, so that the cloned GhACO2 gene segment can be used as a molecular marker for screening high-resistance materials and can be used for creating auxiliary selection of a stable sterile line of cotton.

(2) The invention demonstrates and determines that 5 multiplied by 10 is sprayed in the bud period of cotton^-4The male fertility of the sensitive high-temperature cotton material at high temperature can be restored by the methyl jasmonate solution of mol/L.

The invention has broad spectrum effect and is suitable for popularization and application in the field.

Drawings

FIG. 1: the technical route of the invention. The invention finds the key metabolic pathway and the specific gene related to the male fertility of the cotton at high temperature by using a transcriptome sequencing method, verifies the function of the GhACO2 gene, and determines that jasmonic acid is an important high-temperature resistant substance for resisting the high temperature of the reproductive organ of the cotton. Therefore, the method for effectively improving the male fertility of the cotton at high temperature by applying the methyl jasmonate externally is provided.

FIG. 2: the expression pattern of the GhACO2 gene under different treatments can disturb the expression of the GhACO2 gene under both high-day and high-night temperature treatments. In fig. 2: the markers TS, TDS and ADS correspond to three key stages of cotton anther development, respectively: tetrad period, tapetum degradation period and anther cracking period; the symbols NN, HN and NH represent normal temperature, high temperature and high night temperature, respectively.

FIG. 3: in the sensitive high-temperature material used in the invention, both high day temperature and high night temperature can cause the reduction of jasmonic acid content in the anther, resulting in male sterility. Description of reference numerals: TS, TDS and ADS in panel a of fig. 3 correspond to critical stages of anther development, respectively: tetrad period, tapetum degradation period and anther cracking period; NN, HN and NH respectively represent: normal temperature, high daily temperature and high night temperature; the unit of jasmonic acid is ng/g; tetrad, T in Panel B of FIG. 3; TP, a tapetum layer; ms is microspore; p is pollen; en is the endothelial layer.

FIG. 4: the invention discloses a GhU6.7 plasmid vector map of sgRNA1-sgRNA2 for creating gene editing cotton material. The reference numerals indicate that the sgRNA function in the lower left corner of FIG. 4 has been marked with rounded boxes and the segment in between the LD T-DNA and RB T-DNA is the T-DNA segment inserted into the genome.

FIG. 5: the sequence editing map of the GhACO2 transgenic line is disclosed. Description of reference numerals: the first row in Panel A in FIG. 5 is the reference sequence, and the second row in Panel A in FIG. 5 is the wild-type sequence, -1, -2, -3, -4, -5, respectively, represent editing individuals, and the above 5 individuals all have an edit of GhACO 2. The southern results in panel B of FIG. 5 show that the transgene insert copies of-1, -2, -4, -5 are single copies. FIG. 5C shows that the expression level of GhACO2 is decreased in the-1, -4, -5 editing individuals

FIG. 6: the T0 generation transgenic cotton plant individual plant phenotype map. Description of reference numerals: FIG. 6A-C shows day-to-day flowers of WT (wild type), GhACO2-1 and GhACO2-5 individuals, respectively; FIG. 6 is a D-F diagram showing the entire anthers of WT (wild type), GhACO2-1 and GhACO2-5 on the day of flowering of the individual plants, respectively; FIG. 6, G-I shows TTC (triphenyltetrazolium chloride) staining results of pollen on the day of flowering of WT (wild type), GhACO2-1 and GhACO2-5 individuals, respectively.

FIG. 7: the GhACO2 of the invention edits anther paraffin sections of T0 generation transgenic cotton plants and wild type cotton plants. Compared with wild type, the anther of T0 generation plant shows shrinkage of pollen during the period of tapetum degradation and anther dehiscence. Description of reference numerals: FIG. 7 is a drawing A-C which shows anther sections at the time of tetrad WT (wild type), GhACO2-1 and GhACO2-5, respectively; FIG. 7, Panel D-F, shows anther chips at the time of degradation of WT (wild type), GhACO2-1 and GhACO2-5 tapetum, respectively; FIG. 7, Panel G-I, is an anther section at the time of anther dehiscence of WT (wild type), GhACO2-1, and GhACO2-5, respectively. The notation in FIG. 7: TS is tetrad period; TDS is the degradation period of the tapetum; ADS, anther cracking period; t is a tetrad; TP, a tapetum layer; ms is microspore; p is pollen; en is the endothelial layer. Scale bar: the scale bar in graph A-C in FIG. 7 is 20 μm, and the scale bar in graph D-I in FIG. 7 is 50 μm.

FIG. 8: the GhACO2 gene of the invention edits T0 generation and wild type transmission electron microscope observation results. Microspores and pollen cells of T0 generation plants lack content and appear shrunken compared to wild type. Description of reference numerals: FIG. 8 is a transmission electron microscope image of a-C diagrams in FIG. 8, which are the tetrads WT (wild type), GhACO2-1 and GhACO2-5, respectively; FIG. 8, Panel D-F, transmission electron micrographs of microspores at the time of degradation of WT (wild type), GhACO2-1, GhACO2-5 tapetum, respectively, wherein: FIG. 8, D-F, is an enlarged partial view of the above D-F, i.e., an enlarged image of the spike, respectively; FIG. 8, G-I shows transmission electron micrographs of pollen at the time of dehiscence of WT (wild type), GhACO2-1 and GhACO2-5, respectively, wherein: the G-I diagram in fig. 8 is a partially enlarged view of the G-I diagram in fig. 8, respectively. The labels in FIG. 8 illustrate TS, quadrant period; TDS is the degradation period of the tapetum; ADS, anther cracking period; in is the inner wall; ne is the inner layer of the outer wall; ba is a base pillar; te is a base cover; scale bar: 5 μm in the A-C diagram; D-I is 10 μm; FIG. 8 shows a graph d-i at 2 μm.

FIG. 9: the GhACO2 gene edits F1 generation and wild exogenous methyl jasmonate spraying results. Compared with wild type, 5x10 is sprayed on early buds of F1 generations edited by GhACO2 gene at normal temperature^-4The mol/L methyl jasmonate can restore male fertility of the F1 generation edited by GhACO 2. Description of reference numerals: FIGS. 9A and C, E and G, and I and K are TTC staining results of flowers, anthers and pollen on the day of flowering after editing F1 generation with GhACO2-1 and GhACO2-5 and spraying 0.05% Tween 20 to early flower buds at room temperature, respectively; FIG. 9 shows graphs B and D, F, H, J and L as GhACO2-1 and GhACO2-5, respectively, editing F1 generation, spraying 5x10 dissolved in 0.05% Tween 20 on early bud at room temperature^-4And (4) flowers, anthers and pollen on the day of flowering after mol/L of methyl jasmonate are subjected to TTC staining.

FIG. 10: the high temperature sensitive cotton material 'H05' of the invention is externally sprayed with methyl jasmonate at high temperature. At high temperature, the methyl jasmonate treatment can effectively restore the fertility of the temperature-sensitive cotton material. Description of reference numerals: panels A, C and E in FIG. 10 are TTC staining of flowers, anthers and pollen of temperature sensitive cotton material at normal temperature. Panels B, D and F in FIG. 10 show TTC staining of flowers, anthers and pollen of temperature-sensitive cotton material under ordinary high temperature treatment. In FIG. 10, G, H and I are TTC staining of flowers, anthers and pollen of temperature-sensitive cotton material after spraying methyl jasmonate solution and high temperature treatment. The spraying of the methyl jasmonate solution can effectively restore the fertility of the temperature-sensitive cotton material at high temperature.

Detailed Description

Description of sequence listing:

sequence listing SEQ ID NO:1 is the nucleotide sequence of the Gh _ A11G1832 gene fragment isolated and cloned by the present invention. The sequence length is 2067 bp.

The specific nucleotide sequence is shown below:

the bold italic region of > Gh _ A11G1832 represents the position of the gene edited by the editing element

Sequence listing SEQ ID NO:2 and the sequence listing SEQ ID NO: 3 are nucleotide sequences of sgRNAs of two target sites of the GhACO2 gene respectively. The following were used:

Gh_A11G1832_a TCGCCAGCGTGACCCGTCGC(SEQ ID NO：2)，

Gh_A11G1832_b GCTGAGGTGAACGTTGGAGG(SEQ ID NO：3)；

sequence listing SEQ ID NO: and 4 is a functional element sequence of the GhACO2 gene editing vector.

Wherein, the sequence of the lower case letters at the two ends is a homologous sequence used by one-step cloning of infusion, and the sequence of italic letters is tRNA; the sequences with bold and frame lines are the two sgRNA sequences designed by the invention.

Example 1: test for inhibiting expression of jasmonic acid synthesis gene in cotton anther at high temperature, reducing jasmonic acid content and causing male sterility

The temperature-sensitive cotton material H05 (professor ZhulongPao of plant science and technology college of Huazhong university of agriculture, which is published by a plurality of articles such as Min et al, 2014, Ding et al, 2017 (see the document end reference 6), Maet al, 2018) is respectively treated by high-day temperature (HN) and high-night temperature (NH) (the high-day temperature treatment is set to be 40 ℃ day temperature/24 ℃ night temperature, the high-night temperature is set to be 31 ℃ day temperature/30 ℃ night temperature, the temperature of a normal temperature control is set to be 31 ℃ day temperature/24 ℃ night temperature, the photoperiod is 12 hours in the day and 12 hours in the night), and male abortion of the high-temperature-sensitive cotton material is found (see figure 2). It was also found that high temperature resulted in a decrease in jasmonic acid content in the anthers (see FIG. 2). Further analysis shows that the expression of the jasmonic acid synthesis gene GhACO2 in the high-temperature sensitive cotton material is inhibited by high temperature (see figure 3), so that the high temperature is supposed to cause male abortion by reducing the jasmonic acid content in the anther through inhibiting the expression of GhACO 2.

Example 2: construction of Gene editing vector of GhACO2

The gene sequence of the upland cotton GhACO2 gene (login number Gh _ A11G1832) is obtained through genome sequence information, and two editing target sites are designed on the gene for constructing a vector (the sequence is shown in a sequence table SEQ ID NO: 1) to be connected with two sgRNAs, so that the total length of the vector prepared by the method is 16,598 bp. The circular map of the vector is shown in FIG. 4.

TABLE 1 sgRNA sequence of the GhACO2 gene

Table 1 illustrates: the bases in bold are PAM [ pro-spacer adjacent motifs ].

Gh_A11G1832_a_as:TCGCCAGCGTGACCCGTCGCtgcaccagccgggaat

Gh_A11G1832_b_s:GCGACGGGTCACGCTGGCGAgttttagagctagaaata

Gh_A11G1832_b_as:GCTGAGGTGAACGTTGGAGG tgcaccagccgggaat

inf Gh_A11G1832_b_as:ttctagctctaaaacGCTGAGGTGAACGTTGGAGG

The above sequence is a functional element edited by GhACO2 gene, wherein the sequence of lower case letters at two ends is a homologous sequence used by one-step cloning of infusion; italicized character sequence is tRNA; the sequences with bold and square letters are sgrnas designed by the present invention, i.e., primer sequences required for the subsequent construction of vectors.

Example 3: GhACO2 mutant screening and genotype identification

Two sgRNAs, tRNA and gRNA are connected in series by a conventional overlap extension PCR method (the series method is the current universal overlap extension PCR), and then an infusion One-Step Cloning method (Clon ExpressII One Step Cloning Kit, Cat. C112-01, manufactured by Nanjing Novone company) is used for constructing a CRISPR/Cas9 vector (CRISPR/Cas9 vector source: Wang et al, 2018) pRGEB32-GhU6.7-NPT II. The specific operating procedures are shown in Table 2.

TABLE 2 overlap extension PCR protocol for constructing GhACO2 Gene editing vector

After the infusion connection is carried out, sequencing is carried out on the functional element, and the sequence of the SEQ ID NO:4, or a sequence shown in seq id no.

The gene GhACO2 is further subjected to site-directed mutagenesis in upland cotton material Jin668 (Xiedui of academy of agricultural sciences, Henan province) through agrobacterium-mediated genetic transformation and a CRISPR/Cas9 system (Wang et al, 2018). The specific process is as follows: the hypocotyl of Jin668 is first infected with Agrobacterium of pRGEB32-GhU6.7-NPT II vector carrying the GhACO2 editing site, and after transformation by infection, the editing vector of the present invention inserts T-DNA (T-DNA part in FIG. 4) into the genome of Jin 668. The editing element in the sequence table SEQ ID NO:4 can be combined with the positions of 44bp and 102bp of a target gene under the guidance of sgRNA to edit and mutate the target gene (Wang et al, 2018 is subjected to tissue culture (Li et al 2019), and 16 transgenic positive materials are finally obtained, and the obtained transgenic materials are subjected to CRISPR/Cas9 system-induced mutation type identification by using a Hi-TOM platform And analyzing the sequencing result. The results showed that 8 individuals had edits at both sites and 3 individuals were selected as candidate material for analysis for single copy insertion of the transgene (see FIG. 5). Meanwhile, the GhACO2 genes of the selected materials are all expressed and down-regulated, and are all expressed as male sterility.

Example 4: phenotypic analysis of GhACO2 mutant

Two of the 3 individuals, GhACO2-1 and GhACO2-5, were subjected to further phenotypic observations. The method comprises the following specific steps: morphological observations of flowers on the day of flowering of the mutants GhACO2-1, GhACO2-5 and wild type (WT, i.e., non-transgenic) were first made and it was found that GhACO2-1, GhACO2-5 showed smaller flowers, shorter filaments, no normal dehiscence of anthers, and no staining of pollen by TTC, compared to WT (see FIG. 6). Further observation by paraffin sectioning revealed that quartets were normally formed in both mutant plants, but microspore dysplasia was found in the mid-late stage (fig. 7). Finally, transmission electron microscope observation shows that quartets can be normally formed in two mutant plants, but microspores at the middle and later stages are abnormal in development, and the microspores are lack of contents; pollen shriveled in the middle and later stages, and a typical male sterile phenotype appeared (see fig. 8).

Example 5: biological verification of spraying exogenous methyl jasmonate solution

In this example, a spraying test of exogenous methyl jasmonate solution was designed for mutants GhACO2-1 and GhACO2-5, and the concentration gradient was set as follows: 0 mol/L; 5X10^-6mol/L；5×10^-4mol/L；5×10^-2Spraying the mixture on early buds of the Ghaco2 mutant at mol/L, performing phenotypic observation, and finally determining 5x10^-4The optimal spraying concentration is the methyl jasmonate solution of mol/L, and the methyl jasmonate solution of the optimal concentration can restore the male sterile phenotype of the Ghaco2 mutant and can not cause early bud shedding (figure 9). Then 5x10 spray-coating on the early bud of high-temperature sensitive cotton material H05^-4Spraying 0.05% Tween 20 pure solution as a control in mol/L methyl jasmonate solution, observing when the flower buds grow to blossom, only spraying 0.05% Tween 20 to the flower buds without spraying methyl jasmonate solution, wherein anthers do not crack, and pollen does not have activity; and spraying 5X10^-4most of the anthers of the methyl jasmonate solution at mol/L cracked, and most of the pollen was active (FIG. 10). Experiments prove that the spraying of the exogenous methyl jasmonate solution can improve the jasmonic acid content in cotton anthers at high temperature, so that the male fertility of cotton at high temperature can be improved, and the cotton yield is increased.

The main references:

1.Min,L.,Zhu,L.,Tu,L.,Deng,F.,Yuan,D.,and Zhang,X.(2013).Cotton GhCKI disrupts normal male reproduction by delaying tapetum programmed cell death via inactivating starch synthase.The Plant journal 75,823-835.

2.Min,L.,Li,Y.,Hu,Q.,Zhu,L.,Gao,W.,Wu,Y.,Ding,Y.,Liu,S.,Yang,X.,and Zhang,X.(2014).Sugar and auxin signaling pathways respond to high-temperature stress during anther development as revealed by transcript profiling analysis in cotton.Plant physiology 164,1293-1308.

3.Pettigrew W.(2008).The effect of higher temperatures on cotton lint yield production and fiber quality.Crop Science 48,278-285.

4.Wang,P.,Zhang,J.,Sun,L.,Ma,Y.,Xu,J.,Liang,S.,Deng,J.,Tan,J.,Zhang,Q.,Tu,L.,Daniell,H.,Jin,S.,Zhang,X.(2018).High efficient multisites genome editing in allotetraploid cotton(Gossypium hirsutum)using CRISPR/Cas9 system.Plant Biotechnology Journal,16,137-150。

5.Li,J.,M.Wang,Y.Li,Q.Zhang,K.Lindsey,H.Daniell,S.Jin&X.Zhang(2019)Multi-omics analyses reveal epigenomics basis for cotton somatic embryogenesis through successive regeneration acclimation process.Plant Biotechnology Journal,17,435-450。

6.Ding,Y.,Ma,Y.,Liu,N.,Xu,J.,Hu,Q.,Li,Y.,Wu,Y.,Xie,S.,Zhu,L.,Min L.,Zhang,X.microRNAs involved in auxin signalling modulate male sterility under high temperature stress in cotton(Gossypium hirsutum).The Plant Journal,2017,91:977-994.

7.Ma,Y.,Min L.,Wang,M.,Wang,C.,Zhao,Y.,Li,Y.,Fang,Q.,Wu,Y.,Xie,S.,Ding,Y.,Su,X.,Hu,Q.,Zhang,Q.,Li,X.,Zhang,X.Disrupted genome methylation in response to high temperature has distinct affects on microspore abortion and anther indehiscence.Plant Cell,2018,30:1387-1403。

sequence listing

<110> university of agriculture in Huazhong

<120> a method for improving male fertility of cotton at high temperature

<141> 2020-05-31

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2067

<212> DNA

<213> upland cotton (Gossypium hirsutum)

<220>

<221> gene

<222> (1)..(2067)

<400> 1

atggaaccga gtcagacgat cgaggatgaa tcacaaccat ccatcgccag cgtgacccgt 60

cgcatccaac gtttgtctct tcaccttatc ccacttccgt tcctccaacg ttcacctcag 120

ctggacatgc tgacatgcgc caaggccaat aagcaggagg tcgacgtagc ctccctttca 180

agctacatga gagggaggca tagggaaatt caagagaaga tttttgattt ttttaactca 240

aggcctgatt tgcaaacccc gactgagatt tcaatgaaag aacataggga gctttgtttg 300

agacagcttt tcgggttggt tagagaagca aagatcaagc cttttagata tgttgttgaa 360

gatcctgcta agtattttgc tatttctgag gcggttggga gtattgatat atcacttggt 420

atcaaatttg gtgtccagta tagtctttgg ggaggttctg tgttgaactt aggcactaaa 480

aagcaccgag ataagtattt tgatggtatt gacaatttgg attatcttgg ttgcttcgct 540

atgacagaac tgcatcatgg ctcaaatgtt caaggtcttc aaaccgttgc aacatttgat 600

ccaattacag atgaatttat aattgacaca ccaaacgatg gggctattaa atggtggatt 660

ggcaatgctg cggttcatgg caagtttgca acagtttttg ctaggttggt tttaccaact 720

catgactcta aaggagtttc tgatatggga gtccatgcct tcattgtgcc aataagggat 780

cttaaaactc accagccact tcccggaatt gaaataaatg attgtggcca caaaattggc 840

ctgaatgggg tggataatgg agcactgaga ttccgttcag ttagaattcc ccgagataat 900

cttcttaatc gatttgggga tgtcacccga gatggaaaat acacaagtag tctccctaca 960

ataaataaac gttttgctgc tactcttggt gaacttgtag gtgggagggt tggcctcgca 1020

cattcttcag ttggtatcct caagattgct gtcactattg cagtacgata ctccttacta 1080

cgtcagcagt ttggtcctcc aaaacagcct gaagtcagca ttcttgatta tcaatctcag 1140

cagcacaagc tcatgccaat gttggcttca acttatgcat ttcattttgc cactcagtat 1200

ttggtagaga aatattcaga gatgaagaag acacatgatg aacaactggt tggagatgtg 1260

catgctcttt ctgcaggcct gaagtcctat gtgacatcat ttacagcaaa gtcattgagt 1320

acctgcaggg aagcctgtgg aggtcatggg tatgctgctg tcaaccggtt tggtaccttg 1380

aggaatgatc atgacatttt ccagacattt gaaggagaca atacagtact tctgcaacag 1440

gtagctgcag atttattgaa gcaatacaag gacaagttcc aaggtggtgc tctttctgtc 1500

acatggaact acttgagaga atctatgagc acatacttgt ctcagccaaa tcctgtaact 1560

gcccgttggg aaagtgaaga tcacttgaga gacccaaaat tccagttgga tgctttccgg 1620

taccgaacgt caagacttct tcaaagtgta gcagcacgac ttcaaaagca caccaaaact 1680

cttggcagct ttggtgcttg gaataggtgt ctgaatcacc ttctcacact tgcagagtct 1740

catattgaat ctgtcatcct cgcaaagttt attgaagctg ttcagaactg tcctgatgca 1800

agcagtcaag ctgcactaaa acttttgtgc gatctgtatg ccctggatcg gatctggaaa 1860

gacataggaa cataccgtaa tgttgattat gttgcaccaa acaaagccaa ggcaatcaac 1920

aagctcacac agtacttgag tttccaagtt cgaaatattg ccggggaagt tatagatgca 1980

tttgatcttc ctccttatat tttaagggcc ccgatcgcaa tgcagtcaga agcatattct 2040

cagtacacac agcttgtggg gttctaa 2067

<210> 2

<211> 20

<212> DNA

<213> upland cotton (Gossypium hirsutum)

<220>

<221> gene

<222> (1)..(20)

<400> 2

tcgccagcgt gacccgtcgc 20

<210> 3

<211> 20

<212> DNA

<213> upland cotton (Gossypium hirsutum)

<220>

<221> gene

<222> (1)..(20)

<400> 3

gctgaggtga acgttggagg 20

<210> 4

<211> 301

<212> DNA

<213> upland cotton (Gossypium hirsutum)

<220>

<221> gene

<222> (1)..(301)

<400> 4

aagcatcaga tgggcaaaca aagcaccagt ggtctagtgg tagaatagta ccctgccacg 60

gtacagaccc gggttcgatt cccggctggt gcagcgacgg gtcacgctgg cgagttttag 120

agctagaaat agcaagttaa aataaggcta gtccgttatc aacttgaaaa agtggcaccg 180

agtcggtgca acaaagcacc agtggtctag tggtagaata gtaccctgcc acggtacaga 240

cccgggttcg attcccggct ggtgcacctc caacgttcac ctcagcgttt tagagctaga 300

a 301

Claims (6)

1. A separated gene related to the male sterility character of cotton at high temperature is characterized in that the nucleotide sequence of the gene is shown as SEQ ID NO. 1, the gene causes male sterility of cotton at normal temperature after being disturbed by the expression after transgenosis, and the gene is obtained by screening through the following steps:

(1) screening out a material with reduced jasmonic acid content and male sterility caused by high-temperature stress through transcriptional genome sequencing analysis, and carrying out high-temperature treatment on a sensitive high-temperature cotton strain at different time intervals to obtain a gene segment GhACO2 with influenced expression and related to jasmonic acid metabolism, wherein the jasmonic acid content in cotton anthers is obviously reduced due to the gene;

(2) a DNA fragment Gh _ A11G1832 of the GhACO2 gene serving as a molecular marker is obtained by screening upland cotton, and the nucleotide sequence of the DNA fragment is shown as SEQ ID NO:1 is shown in the specification; as set forth in SEQ ID NO:1 as a template, designing two target sites of sgRNA1 and sgRNA2, the sequences of which are shown as follows:

sgRNA1：TCGCCAGCGTGACCCGTCGC，

sgRNA2：GCTGAGGTGAACGTTGGAGG；

(3) an sgRNA1-guid RNA and an sgRNA2-guid RNA are connected in series by an overlap extension PCR method, and then are constructed on a CRISPR/Cas9 vector by an Infusion one-step cloning method to obtain a high-efficiency transformation vector GhU6.7: sgRNA1-sgRNA2, wherein the nucleotide sequence of the high-efficiency transformation vector GhU6.7: sgRNA1-sgRNA2 is shown in SEQ ID NO: 2;

(4) the cotton is transformed by utilizing an agrobacterium-mediated genetic transformation method to obtain a cotton male sterile transgenic line.

2. The polypeptide encoded by the SEQ ID NO:1, and/or the Gh _ a11G1832 gene of SEQ ID NO:2 and Gh _ A11G1832 gene.

3. A method for improving male fertility of transgenic cotton materials and temperature-sensitive cotton materials under high temperature with wide adaptability is characterized by comprising the following steps:

(1) spraying 5 multiplied by 10 to early buds of the obtained Ghaco2 mutant^-4Recovering the male sterile phenotype of the Ghaco2 mutant by using a mol/L methyl jasmonate solution;

(2) spraying 5x10 of sensitive high-temperature cotton material under high-temperature treatment in the bud period^-4And (3) observing the activity of early buds, anthers and pollen of the cotton when the buds grow to blossom in the methyl jasmonate solution of mol/L.

4. The use of the gene of claim 1 for improving male fertility under high temperature stress in cotton.

5. The use of the plant expression vector of claim 2 for increasing male fertility under high temperature stress in cotton.

6. Use of the method of claim 3 for increasing male fertility under high temperature stress in cotton.

Images