CN118291519A - A method for increasing the amylose content of Wxmp type semi-glutinous japonica rice - Google Patents

Abstract

The invention provides a method for improving amylose content of Wx ^mp type semi-waxy polished round-grained nonglutinous rice, which relates to the technical field of bioengineering, and comprises the steps of performing fixed-point editing on two target sequences uORF4 and uORF6 of a Wx ^mp gene in semi-waxy polished round-grained nonglutinous rice by using a CRISPR/Cas9 gene editing technology, and respectively designing an sgRNA1 target and an sgRNA2 target aiming at the two sequences, wherein the sgRNA1 target sequence is AAAAAATGGATTATATTTCC and is used for knocking out uORF4, and the sgRNA2 target sequence is TAAGTCCTTATAAGCACATA and is used for knocking out uORF6. According to the invention, the CRISPR/Cas9 gene editing technology is used for carrying out fixed-point editing on the specific sequences uORF4 and uORF6 and two sites of the half waxy japonica rice Wx ^mp gene, so that the amylose content of rice can be improved after the uORF4 and the uORF6 are mutated, and gene resources and technical ideas are provided for improving the rice quality.

Description

A method for increasing the amylose content of Wxmp type semi-glutinous japonica rice

Technical Field

The invention relates to the technical field of bioengineering, in particular to a method for increasing the content of amylose in Wx ^mp type semi-glutinous japonica rice.

Background technique

Rice is the main food crop in my country. With the improvement of people's living standards, the demand is gradually changing from "eating enough" to "eating well", and consumers have higher and higher requirements for the taste quality of rice. The taste quality of rice is most affected by the content of amylose in rice. The taste quality of rice can be improved by increasing or decreasing the content of amylose. Therefore, the content of amylose has become an important physical and chemical indicator to guide breeders to improve rice varieties.

The amylose content of rice is mainly controlled by Wx. The genotypes of Wx in indica rice, japonica rice and glutinous rice are Wx ^a , Wx ^b and wx respectively. The amylose content of rice in the Wx ^a background is generally greater than 20%, the amylose content of rice in the Wx ^b background is generally between 14% and 20%, and the amylose content of rice in the wx background is generally less than 2%. Generally speaking, the lower the amylose content of rice, the better the taste quality, so breeders have long been committed to reducing the amylose content of rice. However, some rice varieties contain rare Wx genotypes, such as Wx ^mp , whose fourth exon has a point mutation (G at position 473 mutates to A), resulting in reduced activity of its encoded protein, reduced amylose content (generally less than 10%), and slightly poor appearance quality. By slightly increasing the amylose content in these varieties, their appearance quality may be improved. Studies have shown that editing the uORF region of the gene can improve the translation efficiency of the gene, thereby playing a role in high expression, and it has been found that the Wx gene contains multiple uORF segments. Previous studies have mostly focused on editing the coding region and promoter region of the Wx gene, and there have been no reports on editing the target site in the uORF region of the Wx ^mp gene.

There have been many studies on the function and application of rice Wx gene. There are multiple natural allele variation types in this gene, including the common Wx ^a , Wx ^b , wx, and the uncommon Wx ^mp , Wx ^mw , Wx ^lv , etc. However, these variation types still cannot meet the needs of breeding. Creating new Wx locus variation is very important for improving rice quality. Gene editing has shown great potential in gene research, gene therapy and genetic improvement because it can efficiently perform site-specific genome editing and create directed variation. Traditional rice variety improvement methods are time-consuming and easily lead to changes in other traits. CRISPR/Cas9 gene editing technology-mediated variety improvement and germplasm creation overcome this shortcoming and can achieve rapid and accurate directed improvement of specific traits. Targeted improvement of rice quality, fertility, disease resistance and resistance to abiotic stress has been achieved in rice.

Summary of the invention

In view of the above-mentioned prior art, the present invention proposes a method for increasing the amylose content of Wx ^mp type semi-glutinous japonica rice. The specific sequence of the rice Wx gene is site-specifically edited through the CRISPR/Cas9 gene editing technology. After the gene mutation, the amylose content of rice can be increased, which provides genetic resources and technical ideas for rice quality improvement research.

The present invention provides a method for improving the amylose content of Wx ^mp type semi-glutinous japonica rice, comprising a sgRNA1 target point and a sgRNA2 target point, wherein the sgRNA1 target point sequence is AAAAAATGGATTATATTTCC, and the sgRNA2 target point sequence is TAAGTCCTTATAAGCACATA; the sgRNA1 target point and the sgRNA2 target point are respectively designed with two sequences uORF4 and uORF6 of Wx ^mp as target sequences, the uORF4 sequence is ATGGATTATATTTCCTGGGCTAAAAGAATTGTTGATTTGGCACAATTAAATTCAGTGTCAAGGTTTTGTGCAAGAATTCAGTGTGAAGGAATAGATTCTCTTCAAAACAATTTAATCATTCATCTGATCTGCTCAAAGCTCTGTGCATCTCCGGGTGCAACGGCCAGGATATTTATTGTGCAGTAA, and the uORF6 sequence is ATGGCATTGTAA.

The present invention also provides a recombinant vector comprising the sgRNA target sequence, wherein the basic plasmid of the recombinant vector comprises CRISPR/Cas9-U6a-sgRNA1 and CRISPR/Cas9-U6a-sgRNA2.

The present invention also provides the use of the sgRNA target sequence or the recombinant vector in increasing the amylose content of Wx ^mp type semi-glutinous japonica rice.

The present invention also provides the use of the sgRNA target sequence or the recombinant vector in editing the semi-glutinous japonica rice Wx ^mp gene.

The present invention also provides the use of the sgRNA target sequence or the recombinant vector in editing uORF4 and uORF6 of the semi-glutinous japonica rice Wx ^mp gene.

Preferably, the editing comprises causing deletion and/or insertion and/or substitution of one or more bases in uORF4 and uORF6 of the semi-glutinous japonica rice Wx ^mp gene.

Preferably, the semi-glutinous japonica rice is Wx ^mp type semi-glutinous japonica rice.

In the specific creation of the present invention, by constructing a Wx ^mp gene editing vector, the U6a linker sequence containing the sgRNA target sequence is introduced into the recipient rice through the editing vector, so as to obtain gene-edited rice in which the uORF4 or uORF6 target site of the Wx ^mp gene is mutated; compared with the recipient rice, the amylose content of the gene-edited rice is significantly improved.

Compared with the prior art, the beneficial effects of the present invention are:

1. The present invention uses CRISPR/Cas9 technology to successfully edit the uORF4 and uORF6 sites of semi-glutinous japonica rice, cultivates new rice germplasm with significantly improved amylose content, and confirms the contribution of Wx ^mp gene to the amylose content of rice, which will have great application value in the field of rice molecular breeding. In traditional rice amylose directional improvement breeding, hybridization and backcrossing are mainly used for breeding, but due to factors such as unstable offspring separation, long cycle and linkage drag of unfavorable genes, it is difficult to cultivate excellent varieties with stable inheritance and fine-tuning of amylose content. Therefore, CRISPR/Cas9 technology is widely used in rice trait improvement and new germplasm creation because of its advantages such as simple operation, high editing efficiency and low cost.

2. Different from the existing reports on gene editing in terms of target sequence and target selection, the present invention uses the editing of the uORF4 and uORF6 segments of the Wx ^mp gene, which not only ensures the gene editing efficiency, but also does not change the coding region of the Wx ^mp gene. In addition, the translation efficiency is improved by editing the uORF segment of the Wx ^mp gene, that is, the accumulation of the Wx ^mp protein is increased without changing the genotype of the coding region, thereby achieving the purpose of finely regulating the content of amylose. Therefore, the CRISPR/Cas9 vector constructed by the present invention has important significance and advantages in finely increasing the amylose content of semi-glutinous japonica rice.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG1 is a schematic diagram of the structure of the rice Wx ^mp gene and the position of sgRNA in an embodiment of the present invention.

FIG. 2 is a schematic diagram of a pYLCRISPR/Cas9-Wx vector for editing a single target site of rice Wx ^mp gene in an embodiment of the present invention.

FIG3 is a schematic diagram of the mutation method of Wx ^mp editing rice in an embodiment of the present invention.

FIG. 4 is a schematic diagram of the amylose content of Wx ^mp gene-edited rice in an embodiment of the present invention.

Detailed ways

In order to make the technical means, creative features, objectives and effects achieved by the present invention easy to understand, the present invention is further described below in conjunction with specific embodiments.

Example 1: Target design and gene editing vector construction: The genetic transformation receptor material selected in this example is the semi-glutinous japonica rice variety Nanjing 9108. According to the prediction on the NCBI website, the rice Wx gene is located on chromosome 6 of rice. The uORF4 and uORF6 sequences of the Wx ^mp gene of Nanjing 9108 are the same as those of Nipponbare after sequencing analysis, and no mutation has occurred. sgRNA targets were designed in uORF4 and uORF6 of the Wx gene, and a 20bp conservative specific sequence was designed for each target. The nucleotides of target 1 (sgRNA1) are located at -529 to -510bp of the Wx ^mp gene, and target 2 (sgRNA2) is located at -298 to -279bp. The target positions and sgRNA sequences are shown in Figure 1.

According to the requirements of the U6a vector, U6a-sgRNA1-F/R linker and U6a-sgRNA2-F/R linker were synthesized respectively. After preparing the oligo dimer, sgRNA1 was connected to the OsU6a plasmid vector, and sgRNA2 was connected to the OsU6a plasmid vector. After two rounds of PCR amplification, the primer sequences used for PCR amplification include:

U-F:CTCCGTTTTACCTGTGGAATCG,

sgRNA1(2)-R:CGGAGGAAAATTCCATCCAC,

B1':TTCAGAGGTCTCTCTCGACTAGTGGAATCGGCAGCAAAGG,

B2:AGCGTGggtctcGtcagGGTCCATCCACTCCAAGCTC,

B2':TTCAGAggtctcTctgaCACTGGAATCGGCAGCAAAGG,

BL:AGCGTGGGTCTCGACCGACGCGTCCATCCACTCCAAGCTC),

The DNA fragments of U6a-sgRNA1 and U6a-sgRNA2 were obtained and then connected to the CRISPR/Cas9 expression vector. The specific method was referred to the operation steps of (Ma et al, Molecular Plant, 2015, 8(8): 1274-1284). Finally, the editing vector pYLCRISPR/Cas9-Wx was successfully constructed, as shown in Figure 2.

Example 2: Identification of Wx ^mp gene-edited transgenic rice and analysis of editing efficiency: The gene editing vector pYLCRISPR/Cas9-Wx plasmid was transformed into Nanjing 9108 callus tissue using the Agrobacterium EHA105-mediated rice transgenic method, and 20 independent T0 transformed strains were differentiated through hygromycin screening.

The genetic transformation process is as follows: Agrobacterium EHA105 containing pYLCRISPR/Cas9-Wx plasmid infects mature embryo callus of japonica rice recipient variety Nanjing 9108, and cultured in the dark at 26°C on the co-culture medium for 3 days. The washed callus is transferred to the selection medium containing hygromycin for resistance screening. The selected resistant callus is transferred to the pre-differentiation medium for 14 days, and then transferred to the differentiation medium for light culture. When the seedlings grow to 3 cm, they are transferred to the rooting medium to induce adventitious roots. When the seedlings grow to 10 cm in height, the seedlings are taken out, the attached solid culture medium is washed with sterile water, and they are moved to the soil and cultivated in the greenhouse. After the plants are strong, samples are taken for leaf DNA extraction.

With Nanjing 9108 as the control, PCR detection was performed using primers hygromycin marker (Hyg-F: GCTTTTCAGCTTCGATGTAGGAG, Hyg-R: CTACACAGCCATCGGTCCAGA) and nuclease marker (Cas9-F: GATCCTTACTTTCCGTATTCCTTACTACG, Cas9-R: ATACCCTCCTCAATCCTCTTCATG), and those that could amplify specific bands were positive transgenic plants. After identification, a total of 15 positive transgenic plants were screened, with a positive rate of 75.0%. The target site adjacent sequences of the positive transformed plants were amplified and sequenced by PCR using primers Wxseq-F/R (Wxseq-F: TTCAACTCTCGTTAAATCATGTCTCT, Wxseq-R: GGAGAATTGAAGTTTATTACAATTTGG). It was detected that 13 of the positive transformed plants had mutations, and the gene editing efficiency was 86.6%. However, no homozygous edited lines were identified in the _T0 transgenic plants, and all the editing sites were heterozygous.

Example 3: Screening of Wx ^mp homozygous edited strains without transgenic components: The gene-edited T ₀ plants can remove the transgenic tag hygromycin resistance gene and nuclease gene through self-exchange in the next generation, thereby obtaining safer edited plants without transgenic tags. Therefore, in order to obtain homozygous edited strains without transgenic components, the gene-edited T ₀ plants in Example 2 were planted to the T ₁ generation.

Leaf DNA of Nanjing 9108 and T ₁ plants were extracted respectively, and the molecular identification of transgenic components was performed by Hyg-F/R and Cas9-F/R markers with Nanjing 9108 as the control. A series of T ₁ plants without transgenic components were screened out from each line. Then, through sequencing analysis of target site adjacent sequences of plants without transgenic components, homozygous strains with base deletion were screened out, as shown in Figure 3, and the mutation types of T ₁ target sites were consistent with those of T ₀ strains, indicating that the gene editing site can be stably inherited between different generations.

Example 4: Analysis of amylose content in gene-edited homozygous plants: Using Nanjing 9108 as a control, the grains of the Wx ^mp homozygous edited plants obtained in Example 3 were ground into powder and the amylose content was determined. Statistical analysis showed that the difference in amylose content between Nanjing 9108 and the two edited plants reached an extremely significant level, with an increase of 1%-1.5%, as shown in Figure 4. Therefore, the Wx ^mp gene-edited rice obtained in this example has a significantly higher amylose content than the Nanjing 9108 variety, which is of great value in the field of rice genetic breeding.

The above are only implementation modes of the present invention, and are not intended to limit the patent scope of the present invention. Any equivalent structure made using the contents of the present invention specification, directly or indirectly used in other related technical fields, is also within the patent protection scope of the present invention.

Claims (7)

1. A method for increasing the amylose content of Wx ^mp type semi-glutinous japonica rice, characterized in that it comprises a sgRNA1 target point and a sgRNA2 target point, the sgRNA1 target point sequence is AAAAAATGGATTATATTTCC, and the sgRNA2 target point sequence is TAAGTCCTTATAAGCACATA; the sgRNA1 target point and the sgRNA2 target point are designed with two sequences uORF4 and uORF6 of Wx ^mp as target sequences, respectively, the uORF4 sequence is ATGGATTATATTTCCTGGGCTAAAAGAATTGTTGATTTGGCACAATTAAATTCAGTGTCAAGGTTTTGTGCAAGAATTCAGTGTGAAGGAATAGATTCTCTTCAAAACAATTTAATCATTCATCTGATCTGCTCAAAGCTCTGTGCATCTCCGGGTGCAACGGCCAGGATATTTATTGTGCAGTAA, and the uORF6 sequence is ATGGCATTGTAA. 2. A recombinant vector comprising the sgRNA target sequence of claim 1, characterized in that the basic plasmid of the recombinant vector comprises CRISPR/Cas9-U6a-sgRNA1 and CRISPR/Cas9-U6a-sgRNA2. 3. Use of the sgRNA target sequence according to claim 1 or the recombinant vector according to claim 2 in increasing the amylose content of Wx ^mp type semi-glutinous japonica rice. 4. Use of the sgRNA target sequence according to claim 1 or the recombinant vector according to claim 2 in editing the Wx ^mp gene of semi-glutinous japonica rice. 5. Use of the sgRNA target sequence according to claim 1 or the recombinant vector according to claim 2 in editing uORF4 and uORF6 of the Wx ^mp gene in semi-glutinous japonica rice. 6. The use according to claim 4 or 5, characterized in that the editing comprises causing one or more bases to be deleted and/or inserted and/or replaced in uORF4 and uORF6 of the Wx ^mp gene of semi-glutinous japonica rice. 7. The use according to any one of claims 3 to 5, characterized in that the semi-glutinous japonica rice is Wx ^mp type semi-glutinous japonica rice.