CN118272329A

CN118272329A - 9, 17-Dioxo-1,2,3,4,10,19-hexanorandrostane-5-carboxylic acid C-9-ketoreductase, gene and use thereof

Info

Publication number: CN118272329A
Application number: CN202211707915.7A
Authority: CN
Inventors: 金莹; 张驰
Original assignee: Shenyang Botai Biopharmaceutical Co ltd
Current assignee: Shenyang Botai Biopharmaceutical Co ltd
Priority date: 2022-12-29
Filing date: 2022-12-29
Publication date: 2024-07-02

Abstract

The invention provides a 9, 17-dioxo-1,2,3,4,10,19-hexanorandrostane-5-carboxylic acid (HIP) C-9 ketoreductase, and a gene and application thereof, wherein the enzyme can catalyze the reduction of the C-9 ketogroup of the HIP into hydroxyl, and the HIP is converted into 9-OH HIP, and the HIP is spontaneously converted into HIL. The invention discovers the gene of HIP C-9 ketoreductase in mycobacterium for the first time, and the product is HIP C-9 ketoreductase, which can participate in the catabolism of steroid substances in bacterial cells, and can convert HIP into 9-OH HIP and then spontaneously convert HIPL. The invention constructs engineering bacteria for producing HIP or HIL by knocking out the HIP C-9 ketoreductase gene or over-expressing the HIP C-9 ketoreductase gene. The present invention provides methods for producing HIP and HIL.

Description

9, 17-Dioxo-1,2,3,4,10,19-hexanorandrostane-5-carboxylic acid C-9-ketoreductase, gene and use thereof

Technical Field

The invention belongs to the fields of genetic engineering and enzyme engineering. In particular, the invention relates to a novel 9, 17-dioxo-1,2,3,4,10,19-hexanorandrostane-5-carboxylic acid C-9-ketoreductase, and a coding gene and application thereof.

Background

Microbial conversion of a steroid is a process in which a certain part of a steroid substrate is subjected to a specific chemical reaction using an enzyme of the microorganism to obtain a certain product. In this conversion process, the steroid is not a physiologically active substance in the metabolic pathway of the microorganism, but is a carbon source and an energy source substance that can be utilized by the cell, and is finally decomposed into CO ₂ and H ₂ O. There are a number of literature reports that microorganisms such as nocardia, mycobacteria, pseudomonas, rhodococcus, arthrobacter, etc. are capable of degrading sterols to produce steroid drugs and intermediates thereof, of which the use of mycobacteria and rhodococcus is most widespread.

The degradation of steroid substances in the bacteria is aerobic degradation, taking mycobacteria for degrading cholesterol as an example, the degradation process is as follows: 1. conversion of cholesterol (I, cholesterol) to cholest-4-en-3-one (cholest-4-en-3-one); 2. side chain degradation: simultaneously with the oxidation of the first step, the process is similar to beta-oxidation of fatty acid, and the side chain degradation is started by cytochrome CYP125 and CYP142, and under the catalysis of a series of enzymes, an important steroid hormone precursor namely androstane-4-alkene-3, 17-dione (II, androst-4-ene-3,17-dione, abbreviated as AD) is generated; 3. degradation of the central ring: AD is split into 2-hydroxy-2, 4-dienoic acid (IV, 2-hydroxyhexa-2,4-dienoic acid) and 9,17-dioxo-1,2,3,4,10,19-hexanorandrostane-5-carboxylic acid (V, 9, 17-dio-1,2,3,4,10,19-hexanorandrostan-5-oic acid, HIP for short) under the action of a series of enzymes (KstD, kshAB, hsaC and HsaD, etc.); 4. downstream degradation pathway: the 2-hydroxy-2, 4-dienoic acid is gradually decomposed by a series of enzymes (HsaE, hsaF and HsaG), energy enters a tricarboxylic acid cycle, and HIP is converted into 3aα -H-4α - (3 '-propionic acid) -5α -hydroxy-7aβ -methylhexahydro-1-indenone- δ -lactone (3aα -H-4α - (3' -propionic acid) -5α -hydroxy-7aβ -methylhexahydro-1-indanone- δ -lactone, abbreviated as HIL, VI) which is further completely degraded into CO ₂ and H ₂ O.

It has been reported that the degradation process of HIP may be similar to the beta-oxidation of fatty acids, and in Mycobacterium Mycobacterium tuberculosis (Mtb) the FadD3 gene product is able to activate HIP to form HIP-CoA structures, the first step in HIP degradation. In patent US20090186390A1 and EP2385836B1 it is reported that in a series of sterol metabolizing bacteria, the HIP degradation step is essentially the formation of HIP-CoA activated structure by catalysis of acyl-CoA ligase (FadD 3), followed by reduction of the ketone group at C-9 to hydroxyl group by reductase, followed by addition of double bond at C6-C7 by catalysis of acyl-CoA dehydrogenase (FadE 30), followed by dehydration of both carbon atoms by hydration, dehydrogenation and acyl transfer reactions under the action of a series of enzymes. While the key enzyme to convert HIP to HIL has not been demonstrated.

There is still a need in the art to provide insight into the degradation process of HIPs and the enzymes involved therein.

Disclosure of Invention

The invention discovers a HIP C-9 site ketoreductase HipR and a coding gene hipR thereof in mycobacterium bacteria for the first time, and the ketoreductase can catalyze the HIP to be converted into 9-OH HIP, provides a basis for the research of degradation of the HIP in mycobacterium, and can be used for constructing HIP producing bacteria.

In one aspect, the invention provides a 9, 17-dioxo-1,2,3,4,10,19-hexanorandrostane-5-carboxylic acid (HIP) C-9-ketoreductase having the following amino acid sequence, or the amino acid sequence thereof is the amino acid sequence:

(1) An amino acid sequence shown in SEQ ID NO. 1;

(2) An amino acid sequence obtained by substituting, deleting or adding one or more amino acids in the amino acid sequence shown in SEQ ID NO. 1; or (b)

(3) An amino acid sequence having more than 75% homology with SEQ ID NO. 1.

The ketoreductase provided by the invention can convert HIP into 9-OH HIP, and the 9-OH HIP is further spontaneously converted into 3a alpha-H-4 alpha- (3' -propionic acid) -5 alpha-hydroxy-7 a beta-methyl hexahydro-1-indenone-delta-lactone (HIL).

Preferably, the substitution, deletion or addition of one or more amino acids may be a substitution, deletion or addition of 1,2, 3,4 or 5 amino acids.

The above homology is obtained by sequence alignment using SEQ ID NO.1 as a reference sequence, and sequence alignment may be performed using, for example, blastp. The above 75% homology may be 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more.

According to some preferred embodiments of the invention, the amino acid sequence of the HIP C-9 ketoreductase is shown in SEQ ID NO. 1.

Without being bound by any theory, it is believed that the equation for converting HIP to HIL for the HIP C-9 ketoreductase provided by the present invention is as follows:

HipR in the above equation is "HIP C-9 ketoreductase" according to the present invention.

In another aspect, the invention also provides a gene encoding or expressing a ketoreductase at position C-9 of 9, 17-dioxo-1,2,3,4,10,19-hexanorandrostane-5-carboxylic acid, which has the following nucleotide sequence, or the nucleotide sequence of which is the nucleotide sequence:

(1) A nucleotide sequence shown as SEQ ID NO. 2;

(2) A nucleotide sequence which hybridizes under stringent conditions with the nucleotide sequence shown in SEQ ID NO. 2;

(3) A nucleotide sequence having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology to the nucleotide sequence shown in SEQ ID NO. 2; or (b)

(4) A nucleotide sequence capable of encoding the above amino acid sequence.

The above homology is obtained by sequence alignment using SEQ ID NO.2 as a reference sequence, and the sequence alignment may be performed using tblastn, for example.

According to some preferred embodiments of the invention, the nucleotide sequence of the gene encoding or expressing the HIP C-9 ketoreductase is shown in SEQ ID NO. 2.

In a further aspect, the invention provides a vector comprising a gene according to the invention encoding or expressing a HIP C-9 ketoreductase.

According to some embodiments of the invention, the vector is an expression vector. Preferably, the expression vector is a bacterial or yeast expression vector. The expression vector is capable of expressing the HIP C-9 ketoreductase according to the present invention in bacteria or yeasts. Wherein the bacteria may be selected from one or more of Escherichia, mycobacterium, rhodococcus, pseudomonas or Actinomyces. According to some preferred embodiments of the invention, the bacterium is a mycobacterium, preferably mycobacterium neogold (Mycobacterium neoaurum), mycobacterium smegmatis (Mycobacterium smegmatis) or mycobacterium fortuitum (Mycobacterium fortuitum); or E.coli (Escherichia coli). Specifically, the expression vector constructed by the invention is pET26b (+) -hipR or pMV261-hipR.

According to some embodiments of the invention, the vector is a knockout vector. Preferably, the vector is a bacterial knockout vector. The knockout vector is capable of inactivating the gene encoding or expressing the HIP C-9 ketoreductase according to the present invention in bacteria. Wherein the bacteria may be selected from one or more of mycobacteria, rhodococcus, pseudomonas and actinomycetes. According to some preferred embodiments of the invention, the bacterium is a mycobacterium, preferably mycobacterium neogold, mycobacterium smegmatis or mycobacterium fortuitum. Specifically, the knockout vector constructed by the invention is pK18mobSacB-hipR.

In a further aspect, the invention provides a host cell comprising or expressing a HIP C-9 ketoreductase according to the invention or a gene encoding or expressing a HIP C-9 ketoreductase according to the invention, or comprising a vector comprising a gene encoding or expressing a HIP C-9 ketoreductase according to the invention.

According to some embodiments of the invention, the host cell is a bacterial or yeast cell. Wherein the bacteria may be selected from one or more of Escherichia, mycobacterium, rhodococcus, pseudomonas or Actinomyces, preferably Mycobacterium or Escherichia coli. According to some preferred embodiments of the invention, the bacterium is Mycobacterium neogold, mycobacterium smegmatis, mycobacterium fortuitum or E.coli.

Preferably, the host cell is constructed by introducing a gene of interest capable of encoding or expressing the HIP C-9 ketoreductase according to the present invention, or the gene of interest is a gene encoding or expressing the HIP C-9 ketoreductase according to the present invention;

Or the host cell is constructed by introducing a strong promoter to enhance the expression level of a target gene capable of encoding or expressing the HIP C-9 ketoreductase according to the present invention, before the original target gene thereof, or the target gene is a gene encoding or expressing the HIP C-9 ketoreductase according to the present invention;

Or the host cell is constructed by increasing the copy number of a gene of interest, which is capable of encoding or expressing the HIP C-9 ketoreductase according to the present invention, to enhance the expression level of the gene of interest, or the gene of interest is a gene encoding or expressing the HIP C-9 ketoreductase according to the present invention.

In a further aspect, the invention provides the use of a HIP C-9 ketoreductase according to the invention, a gene encoding or expressing a HIP C-9 ketoreductase according to the invention, a vector comprising a gene encoding or expressing a HIP C-9 ketoreductase according to the invention or a host cell according to the invention in the preparation of a steroid medicament or an intermediate thereof.

According to some embodiments of the invention, the steroid drug intermediate is HIP and/or HIL. HIP and HIL are useful as important intermediates in the production of estrogenic drugs, such as estrone, estradiol, derivatives thereof, and the like.

According to some embodiments of the invention, the steroid drug or an intermediate thereof is prepared by degradation of a plant sterol by a HIP C-9 ketoreductase according to the invention.

Accordingly, the present invention provides a process for producing 3aα -H-4α - (3 '-propionic acid) -5α -hydroxy-7aβ -methylhexahydro-1-indenone- δ -lactone, which comprises preparing 3aα -H-4α - (3' -propionic acid) -5α -hydroxy-7aβ -methylhexahydro-1-indenone- δ -lactone by converting a plant sterol using the HIP C-9 ketoreductase according to the present invention, the gene encoding or expressing the HIP C-9 ketoreductase according to the present invention, the vector comprising the gene encoding or expressing the HIP C-9 ketoreductase according to the present invention, or the host cell according to the present invention.

Based on the development and research of the technical scheme, the invention also provides the following technical scheme:

In one aspect, the invention provides an engineering bacterium for producing 9, 17-dioxo-1,2,3,4,10,19-hexanorandrostane-5-carboxylic acid (HIP) constructed by eliminating or reducing its original HIP C-9-ketoreduction activity.

According to some embodiments of the invention, the engineered bacterium is a bacterium. Wherein the bacteria may be selected from one or more of mycobacteria, rhodococcus, pseudomonas or actinomycetes, preferably mycobacteria. According to some preferred embodiments of the invention, the engineering bacteria are Mycobacterium neogold, mycobacterium smegmatis or Mycobacterium fortuitum.

Preferably, the engineering bacterium is constructed by inactivating its original target gene capable of encoding or expressing the HIP C-9 ketoreductase according to the present invention, or the target gene is a gene encoding or expressing the HIP C-9 ketoreductase according to the present invention.

The elimination or reduction of the original HIPC-9 ketoreductase activity of the engineering bacteria means that the engineering bacteria cannot express the active HIPC-9 ketoreductase or the expressed HIPC-9 ketoreductase activity is reduced. This can be performed by mutagenesis or inactivation of the original target gene having HIP C-9 ketoreductase activity, for example, by changing (inserting or deleting the sequence of) the promoter of the original HIP C-9 ketoreductase gene of the engineering bacterium, deleting a partial gene fragment of the original HIP C-9 ketoreductase gene, inserting or replacing a base in the original HIP C-9 ketoreductase gene, etc., resulting in the non-expression product of the gene in the engineering bacterium or the non-activity or low activity of the expressed product.

For the engineering bacteria for producing HIP, provided by the invention, the original HIP C-9-position ketone group reduction activity is deactivated or reduced, so that the conversion from HIP to HIL is prevented or reduced, and the accumulation of more HIP or the reduction of the HIL is realized.

Accordingly, the present invention provides a process for the production of 9, 17-dioxo-1,2,3,4,10,19-hexanorandrostane-5-carboxylic acid which comprises converting phytosterols into 9, 17-dioxo-1,2,3,4,10,19-hexanorandrostane-5-carboxylic acid by degradation of the phytosterols using the above-described engineering bacteria.

In another aspect, the present invention provides an engineering bacterium for producing 3a alpha-H-4 a- (3' -propionic acid) -5 a-hydroxy-7a beta-methylhexahydro-1-indenone-delta-lactone (HIL), which is constructed by allowing or increasing the engineering bacterium to have a C-9 ketoreduction activity of 9, 17-dioxo-1,2,3,4,10,19-hexanorandrostane-5-carboxylic acid.

According to some embodiments of the invention, the engineered bacterium is a bacterium or a yeast. Wherein the bacteria may be selected from one or more of Escherichia, mycobacterium, rhodococcus, pseudomonas or Actinomyces, preferably Mycobacterium or Escherichia coli. According to some preferred embodiments of the invention, the engineering bacteria are Mycobacterium neogold, mycobacterium smegmatis, mycobacterium fortuitum or E.coli.

Preferably, the engineering bacterium is constructed by introducing a target gene capable of encoding or expressing the HIP C-9 ketoreductase according to the present invention, or a gene encoding or expressing the HIP C-9 ketoreductase according to the present invention;

Or the engineering bacterium is constructed by introducing a strong promoter to enhance the expression level of a target gene capable of encoding or expressing the HIP C-9 ketoreductase according to the present invention before the original target gene, or the target gene is a gene encoding or expressing the HIP C-9 ketoreductase according to the present invention.

The step of enabling the engineering bacteria to have or increase the HIP C-9 ketoreductase activity means that the engineering bacteria can express the HIP C-9 ketoreductase with activity or the expressed HIP C-9 ketoreductase activity is increased. This can be carried out by introducing a target gene having HIPC-9 ketoreductase activity, for example, by introducing the target gene via a vector comprising a gene encoding or expressing HIPC-9 ketoreductase according to the present invention, or integrating the target gene into the genomic DNA of an engineering bacterium, or adding a strong promoter before the target gene to increase the expression level of the target gene.

As for the engineering bacteria for producing HIL, provided by the invention, the HIP C-9 ketone group reduction activity or activity is increased, so that the conversion from HIP to HIL is provided or enhanced, and the accumulation of more HIL or the reduction of HIP is realized.

In one aspect, the invention provides a method for converting 9, 17-dioxo-1,2,3,4,10,19-hexanorandrostane-5-carboxylic acid (HIP), comprising catalytically reducing the C-9-keto group of HIP to hydroxy group to form 9-hydroxy-17-oxo-1,2,3,4,10,19-hexanorandrostane-5-carboxylic acid (9-OH) using the HIP C-9-keto reductase according to the invention, a gene encoding or expressing the HIP C-9-keto reductase according to the invention, a vector comprising a gene encoding or expressing the HIP C-9-keto reductase according to the invention, a host cell according to the invention or an engineering bacterium for producing HIL according to the invention.

Preferably, the method further comprises using NADPH as a coenzyme.

In another aspect, the invention provides a method for producing 3a alpha-H-4 alpha- (3' -propionic acid) -5 alpha-hydroxy-7 a beta-methylhexahydro-1-indenone-delta-lactone (HIL) comprising catalytically reducing the C-9 ketogroup of HIP to hydroxy to further produce HIL using the HIP C-9 ketoreductase according to the invention, a gene encoding or expressing the HIP C-9 ketoreductase according to the invention, a vector comprising encoding or expressing the HIP C-9 ketoreductase according to the invention, a host cell according to the invention or an engineering bacterium for producing HIL according to the invention. HIL is an important intermediate in the production of estrogens, such as estrone, estradiol, and derivatives thereof.

Preferably, the method further comprises using NADPH as a coenzyme.

The inventor of the application locks genes possibly having aldehyde ketone reductase and oxidoreductase activities in M.neoaurum through a series of gene comparison, verifies the function of a target gene through experiments, finds out a gene capable of catalyzing the conversion of HIP C-9 keton into hydroxyl, and proves the function of the expressed enzyme through gene expression and knockout, in particular proves that the enzyme participates in the metabolism of plant sterols in M.neoaurum.

In brief, the application takes a novel Mycobacterium aurum mutant MNPJ-1 as an original strain, and takes plant sterol as a substrate to ferment and culture the strain to generate a large amount of compound HIL and a small amount of HIP. Wherein the mutant MNPJ-1 is a laboratory preservation strain, which is a mutant strain of Mycobacterium neogold DSM 44074 and mainly accumulates HIL, and the strain has been preserved in China general microbiological culture Collection center (address: seagaku 1,3 rd way, which is the university of China, of Beijing, chaoyang area North Star) at 5-22 days, and has a preservation number of CGMCC No.14181, and classification designation of Mycobacterium neogold (Latin: mycobacterium neoaurum). Then, in the mutant MNPJ-1, the HIP C-9 ketoreductase gene hipR is blocked by a gene knockout method to obtain a mutant MN HIP-9. The strain is subjected to fermentation and extraction analysis operations, and the accumulation amount of HIL is found to be obviously reduced, while the accumulation amount of HIP is found to be obviously increased. The gene hipR was ligated with mycobacterial expression plasmid and introduced into MN HIP-9, and fermentation broth analysis revealed that the accumulation of HIL was restored and the accumulation of HIP was significantly reduced. Finally, the gene is connected with an expression vector and introduced into escherichia coli for expression, after the cells are crushed, substrate HIP, coenzyme HADPH, buffer solution and the like are added for full reaction, and then acidification extraction is carried out, so that HIL is generated. Thus, the present application firstly demonstrates that the enzyme encoded by gene hipR is involved in the degradation of HIP in Mycobacteria, and secondly demonstrates that the function of the enzyme encoded by this gene is to reduce the keto group at position C-9 of HIP to hydroxyl.

The above research process includes the following aspects:

(1) Keto reductase gene hipR left and right arm amplification

According to the complete sequence sequencing comparison of the genome DNA of the new Mycobacterium aurum (Mycobacterium neoaurum) MNPJ-1, the hipR gene and the upstream and downstream 2Kb sequences thereof are consistent with the sequence of a wild strain DSM 44074, the left arm primers SEQ ID NO.3 and SEQ ID NO.4 for hipR gene knockout are designed, and the right arm primers SEQ ID NO.5 and SEQ ID NO.6 for hipR gene knockout are designed. The left and right arms of hipR knockout plasmid are amplified by PCR with the prepared MNPJ-1 genomic DNA as a template and SEQ ID NO.3 and SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6 as primers, respectively.

(2) Construction of the knockout vector pK18mobSacB-hipR

The left and right arm fragments amplified by PCR were digested with HindIII/XbaI and XbaI/EcoRI, ligated to HindIII/EcoRI site of plasmid pK18mobSacB, E.coli DH 5. Alpha. Competent cells were transformed chemically, and recombinant bacteria were selected, and the plasmid was extracted and verified to be successful and designated as knockout vector pK18mobSacB-hipR.

(3) Construction of the expression vector pET26b (+) -hipR

According to MNPJ-1 genome DNA sequence analysis and expression plasmid pET26b (+) restriction enzyme sites, hipR gene primers SEQ ID NO.11 and SEQ ID NO.12 are designed, MNPJ-1 genome DNA is taken as a template, and SEQ ID NO.11 and SEQ ID NO.12 are taken as primers, and a hipR full sequence DNA fragment is amplified by PCR. The DNA fragment and pET26b (+) plasmid are respectively digested and recovered by NdeI/HindIII, are connected, are transformed into E.coli DH5 alpha competent cells by a chemical method, are screened for recombinant bacteria, and are named pET26b (+) -hipR after the verification of the extracted plasmid.

(4) Construction of the expression vector pMV261-hipR

According to MNPJ-1 genome DNA sequence analysis result and enzyme cutting site of plasmid pMV261, designing hipR gene primers SEQ ID NO.7 and SEQ ID NO.8, using MNPJ-1 genome DNA as template and using SEQ ID NO.7 and SEQ ID NO.8 as primers, amplifying hipR DNA fragment by PCR. The DNA fragment and pMV261 plasmid are respectively digested with EcoR I/Hind III, recovered, connected, chemically transformed into E.coli DH5 alpha competent cells, and screened for recombinant bacteria, and the expression vector pMV261-hipR is named after the successful verification of the extracted plasmid.

(5) Transformant selection for hipR Gene knockout and anaplerotic mutants

The knockdown vector pK18mobSacB-hipR is transferred into MNPJ-1 by an electrotransformation method, the knockdown mutant strain is screened, and the correct gene recombination mutant strain named MN HIP-9 is obtained by taking SEQ ID NO.9 and SEQ ID NO.10 as primers and verifying through colony PCR.

The expression vector pMV261-hipR is transferred into MN HIP-9 by an electrotransformation method, and the retrieved complement is named MN HIL-9.

(6) Mutant shaking flask fermentation and detection analysis

The blocking strain MN HIP-9, the resupply strain MN HIL-9 and the original strain MNPJ-1 are respectively inoculated into 5mL of seed culture medium, cultured for 48 hours at 32 ℃, transferred into fermentation culture medium and cultured for 15 days. After sampling and extraction every other day, gas was fed to the gas chromatograph to analyze the accumulation of the product.

(7) Expression of hipR gene in colibacillus and enzyme activity determination

The expression vector pET26b (+) -hipR and the control group pET26b (+) are converted into E.coli BL21 by a chemical method, recombinant bacteria are screened by using a kanamycin resistance flat plate, E.coli BL21 containing pET26b (+) and the expression vector pET26b (+) -hipR is inoculated into LB (Kan ^r) culture medium, and a certain concentration of IPTG is added to induce the expression of target proteins, and SDS-PAGE detection is carried out.

Collecting thallus, breaking cells, centrifuging, collecting supernatant and precipitate, proportionally adding PBS buffer solution, NADPH and HIP, reacting at 37deg.C for 10min, acidifying, extracting, and gas-feeding to obtain the final product.

The invention discovers and proves a hipR gene for the first time, and the coded enzyme can catalyze the HIP to be converted into 9-OH HIP, so that a theoretical basis is provided for the metabolic research of the HIP in mycobacterium. In addition, the enzyme catalyzes the reproducibility of HIP metabolism, so the invention also provides a method capable of converting HIP into HIL and related application, which lays a foundation for biological conversion of HIL. Taking cholesterol as an example, the mycobacterial cholesterol metabolic pathway in which the enzyme provided by the invention participates is shown in figure 1.

Drawings

Embodiments of the present invention are described in detail below with reference to the attached drawing figures, wherein:

FIG. 1 shows the cholesterol metabolic pathway of Mycobacteria.

FIG. 2 shows a map of knockout vector pK18 mobSacB-hipR.

FIG. 3 shows a map of the expression vector pMV 261-hipR.

FIG. 4 shows a map of the expression vector pET26b (+) -hipR.

FIG. 5 shows the result of expressing the target protein HIP C-9 ketoreductase in E.coli.

FIG. 6 shows the results of gas chromatography detection of various product standards, wherein FIG. 6A is the result of detection of the standard HIP with a retention time of 5.200; FIG. 6B shows the detection result of the standard HIL with a retention time of 6.565; FIG. 6C shows the results of detection of standard HK with a retention time of 3.436.

FIG. 7 shows the results of detection of crude enzyme in-liquid reactions.

Detailed Description

The invention is described below with reference to specific examples. It will be appreciated by those skilled in the art that these examples are for illustration of the invention only and are not intended to limit the scope of the invention in any way.

The experimental methods used in the following examples are conventional methods unless otherwise specified. The strains, plasmids, kits, etc., used in the examples described below, were all commercially available products unless otherwise specified.

The Mycobacterium neogold used in the examples was the present laboratory preservation strain MNPJ-1 which was deposited at the China general microbiological culture Collection center (address: no. 3 of West road 1, division of the Korean area North Star, proc. Natl. Acad. Sci. Barbary of China, post code 100101) at 5.22 of 2017, and which was classified and named Mycobacterium neogold (Latin: mycobacterium neoaurum) with a preservation number of CGMCC No.14181.

Example 1 construction of knockout vector pK18mobSacB-hipR

According to the complete sequence sequencing comparison of the novel Mycobacterium aurum (Mycobacterium neoaurum) MNPJ-1 genome DNA, the hipR gene and the upstream and downstream 2Kb sequences thereof are consistent with the sequence of a wild strain DSM44074, no mutation occurs, and left and right arm PCR primers for knocking out the hipR gene are designed.

The upper and downstream primer sequences of the hipR gene left arm are respectively shown as SEQ ID NO.3 and SEQ ID NO. 4.

SEQ ID NO.3：

CCCCAAGCTTCACCACCAGCGGTGAGATGTTC

SEQ ID NO.4：

CAGCTCTAGACGACCTGTTCTACGGTGATGCC

The upper and downstream primers of the hipR gene right arm are shown as SEQ ID NO.5 and SEQ ID NO.6 respectively.

SEQ ID NO.5：

CAGCTCTAGAGTGATGACGGTGGCACCCTGAC

SEQ ID NO.6：

CACGGAATTCACTTGGACCCCTTATCGGTGCC

The MNPJ-1 genome DNA prepared by the conventional method is used as a template, and the following reaction conditions are adopted to carry out PCR amplification of the left and right arms of the hipR gene respectively.

The reaction system: 1. Mu.L of each of the upstream and downstream primers, 1. Mu.L of template DNA, 12.5. Mu.L of Q5 Hot Start 2X Master Mix, and 25. Mu.L of ddH ₂ O were filled in to the total volume;

Reaction conditions: the materials are recycled for 32 times at 98 ℃ for 30s,98 ℃ for 10s,55 ℃ for 30s and 72 ℃ for 45s, and stored at 72 ℃ for 2min and 4 ℃.

Referring to the instructions for the use of the enzyme, the hipR gene left arm PCR product of 939bp was digested with HindIII/Xba I, the hipR right arm PCR product of 940bp was digested with Xba I/EcoRI, then ligated with the HindIII/EcoRI double digested plasmid of pK18mobSacB using T4 ligase, E.coli DH 5. Alpha. Competent cells were transformed chemically, transformants were selected on LB kanamycin plates, plasmids were extracted using conventional methods, and the extracted plasmids were digested with HindIII/EcoRI to release gene bands of about 4.0kb and 1.9kb in size, indicating successful construction of the recombinant plasmid. The plasmid which confirmed the correct was designated as knockout vector pK18mobSacB-hipR.

Example 2 construction of expression vector pMV261-hipR

The hipR gene PCR primers SEQ ID NO.7 and SEQ ID NO.8 were designed according to MNPJ-1 genomic DNA sequence analysis.

SEQ ID NO.7：

CCCCGAATTCGTGACTGACGCGGCTGGAATC

SEQ ID NO.8：

CACGAAGCTTGGCCGTCGAGCAAACCCATT

The hipR gene was amplified by PCR using MNPJ-1 genomic DNA as a template and the following reaction conditions.

reaction conditions: the materials are stored at 98 ℃ for 30s,98 ℃ for 10s,55 ℃ for 30s,72 ℃ for 30s, cycled for 32 times, 72 ℃ for 2min and 4 ℃.

And recovering the PCR product of hipR genes according to the instruction of a PCR recovery kit provider to obtain 816bp DNA fragment, wherein the sequencing result shows that the sequence is SEQ ID NO.2. The DNA fragment and pMV261 plasmid were digested with EcoR I/HindIII and recovered, respectively, and the E.coli DH 5. Alpha. Competent cells were transformed chemically (refer to the method of the supplier), transformants were selected on kanamycin plates, and plasmids were extracted by the conventional method, and the extracted plasmids were digested with EcoR I/HindIII to release gene bands of about 4.3kb and 0.8kb in size, indicating successful construction of the recombinant plasmids, and were subjected to DNA sequencing, and aligned with SEQ ID NO.2. The plasmid that was confirmed to be correct was designated as expression vector pMV261-hipR.

EXAMPLE 3 novel Mycobacterium aurum hipR Gene knockout

The knockout vector pK18mobSacB-hipR was transformed into the existing MNPJ-1 by electrotransformation under 2500V,600Ω, 25. Mu.F. 200. Mu.l of the shocked cells were transferred to NA plates containing 50. Mu.g/mL kanamycin and cultured at 32℃for 4-7 days to obtain transformants. Transformants were then transferred to NA plates without antibiotics and cultured for 2-3 days. Bacterial suspension is prepared from NA plate, diluted 100-1000 times, 100 μl of diluted liquid is coated on NA plate containing 5% sucrose for culturing for 3-5 days, and recombinants are obtained. Colony PCR amplification was performed using SEQ ID NO.9 and SEQ ID NO.10 as PCR primers.

SEQ ID NO.9：

AGCCGTCCAGTCCGACACCGAT

SEQ ID NO.10：

GATGGCGTTGACGGGTGGGTAA

And verifying hipR whether the gene is knocked out successfully, and obtaining a strain which is knocked out successfully, wherein the strain is named as MN HIP-9.

EXAMPLE 4 Gene hipR knockout Strain hipR Gene complementation

The expression vector pMV261-hipR was transformed into MN HIP-9 by electrotransformation under the conditions described in example 3, and transferred to kanamycin resistance plates for 3-4 days after electric shock, and single colonies were obtained as transformants designated MN HIL-9.

Example 5 shake flask fermentation and fermentation broth detection analysis

The mutant MN HIP-9, the anaplerotic strain MN HIL-9 and the original strain MNPJ-1 are respectively inoculated into 5mL of seed culture medium (formula: beef extract 0.3g/L, peptone 1.0g/L, yeast powder 0.3g/L, glycerol 1.5g/L, pH is regulated to 7.2, sterilization is carried out at the temperature of 121 ℃ for 20min after cooling, and use) and cultured for 48h at 32 ℃, 50mL of fermentation medium (formula: glycerol 2.0g/L, citric acid 1.5g/L and ferric ammonium citrate 0.04g/L,K₂HPO₄ 0.5g/L,MgSO₄·7H₂O 0.5g/L,NH₄NO₃ 2.5g/L. are prepared into a 0.2% Tween-80 solution, 10g/L of phytosterol is added while stirring, heating is carried out to 50 ℃, then the components are added, pH is regulated to 7.4, sterilization is carried out at the temperature of 121 ℃ for 20min after cooling, and use is carried out at the temperature of 32 ℃ for 11 days, 400 mu L of fermentation broth sample is taken, HCl is acidified to pH=2, and then 6 times volume of ethyl acetate is used for extraction, and the product accumulation is analyzed by phase chromatography.

Gas chromatography analysis: the formation of the products was examined using different peak times for each material against HIP, HIL purchased from Baoding Jiufu Biotechnology Co., ltd., HIP and HK (3aα -H-4α - [3'-propanol ] -7aβ -methylhexahydro-1, 5-indendione hemiketal, 3aα -H-4α - [3' -propanol ] -7aβ -methylhexahydro-1,5-indandione hemiketal) were isolated from the laboratory. Peak time of each substance: HIP retention time t=5.200; HIL retention time t= 6.565; HK retention time t=3.436, as shown in fig. 6A, 6B, and 6C.

Gas chromatography measurement conditions: the chromatographic column is AGILENT HP-5; the detector is an FID detector; the sample injection amount is 1 mu L, and the temperature of a sample injection port is 240 ℃; the detector temperature was 280 ℃; the temperature programming is adopted: the initial temperature is 180 ℃,7min, the temperature rising rate is 30 ℃ and ^-1 min, and the temperature is raised to 240 ℃ for 6min.

The results of the fermentation broth analysis are shown in Table 1.

TABLE 1 accumulation of products detected on day11

"-" Represents that no peak of the substance was detected.

As a result, it was found that the starting strain MNPJ-1 was shake-flask fermented for 11 days, and that the fermentation broth was found to accumulate only HIL and by-product HK, without HIP production. Knocking out hipR genes to obtain a strain MN HIP-9, fermenting for 11 days to find that the HIL yield is reduced by 79%, and accumulating a large amount of HIP. The strain MN HIL-9 is obtained through hipR gene back-complementation, and the fermentation product composition is found to be basically consistent with the result of the original strain MNPJ-1 after 11 days of fermentation, so that HIP is not accumulated any more and HIL production is recovered.

The above results demonstrate that the function of hipR gene is to control the conversion of HIP to HIL in M.neoaurum.

EXAMPLE 6 construction of the expression vector pET26b (+) -hipR

The hipR gene PCR primers SEQ ID NO.11 and SEQ ID NO.12 were designed according to MNPJ-1 genomic DNA sequence analysis.

SEQ ID NO.11：

CCCCCATATGACTGACGCGGCTGGAATC

SEQ ID NO.12：

CACGAAGCTTGGCCGTCGAGCAAACCCATT

PCR amplification of hipR gene was performed using MNPJ-1 genomic DNA as a template and the following reaction conditions.

And recovering the PCR product of hipR genes according to the instruction of a PCR recovery kit provider to obtain 812bp DNA fragments, wherein the sequencing result shows that the sequence is SEQ ID NO.2. The DNA fragment and pET26b (+) plasmid were digested with NdeI/HindIII and recovered, respectively, and the E.coli DH 5. Alpha. Competent cells were transformed chemically (see methods of suppliers), transformants were selected on kanamycin plates, plasmids were extracted by the conventional method, and the extracted plasmids were digested with NdeI/HindIII to release gene bands of about 5.3kb and 0.8kb in size, indicating successful construction of recombinant plasmids, and DNA sequencing was performed, which was error-free compared with SEQ ID NO.2. The plasmid that was verified to be correct was designated as expression vector pET26b (+) -hipR.

EXAMPLE 7hipR expression of Gene in E.coli

Expression vector pET26b (+) -hipR and control plasmid pET26b (+) were chemically transformed into E.coli BL21 (DE 3) and recombinant bacteria were screened using kanamycin resistance plates.

Single colonies were picked from the plates and were pET26b (+) -hipR transformants. The transformant cells were inoculated into 3mL of LB liquid medium containing kanamycin, shake-cultured overnight at 37℃and the culture product was inoculated into 8mL of LB same medium at a ratio of 2%, cultured until OD ₆₀₀ was about 0.6, added with 0.1 mmol.L ^-1 IPTG, and shake-cultured at 32℃for 6 hours to induce the expression of the target protein. In addition, E.coli BL21 containing pET26b (+) was not IPTG-induced and E.coli BL21 containing pET26b (+) was prepared with IPTG-induced culture groups, respectively, under the same conditions.

Taking 1mL of bacterial liquid from each group, centrifuging to remove the supernatant, adding 100 mu L of 1X Bug Baster cell lysate, blowing and sucking, uniformly mixing, performing room temperature pyrolysis for 15min, centrifuging for 10min, taking 15 mu L of supernatant, fully mixing with 5X SDS loading buffer solution, boiling water bath for 5min, and loading for SDS-PAGE electrophoresis; the pellet after disruption of the cells was also taken for electrophoresis, and the results are shown in FIG. 5.

The channels in fig. 5 are in order from left to right: 1. the protein markers are 170, 130, 100, 70, 55, 40, 35, 25 and 10kDa in sequence from top to bottom; 2. e.coli BL21 containing pET26b (+) is free of IPTG;3. e.coli BL21 containing pET26b (+) plus IPTG;4. supernatant after cell disruption containing pET26b (+) -hipR E.coli BL21 plus IPTG; 5. and (3) adding IPTG into pET26b (+) -hipR E.coli BL21, and performing cell disruption to obtain the sediment. It can be seen that both the supernatant and the pellet of channels 4 and 5 at about 27kDa had the desired protein, and that there was slightly more pellet, indicating that the enzyme was successfully expressed, and that the conditions were optimized to increase the amount of soluble protein in the supernatant.

Example 8 in vitro reaction and enzyme Activity determination

4ML of the induced culture of the pET26b (+) -hipR transformant of example 7 is taken, the supernatant is removed by centrifugation, 300 mu L of 1X BugBaster cell lysate is added for blowing and sucking and mixing, the mixture is lysed for 15min at room temperature, and the crude enzyme solution is obtained by centrifugation for 5 min.

The enzyme reaction system comprises the following components: 20mg/mL NADPH 50. Mu.L, 4.8mg/mL HIP 100. Mu.L, crude enzyme 300. Mu.L, PBS buffer 550. Mu.L.

In vitro reaction:

According to the above system, the components are added, and the mixture is reacted with shaking overnight at 37 ℃, HCl is acidified to pH=2, 2mL of ethyl acetate is used for extracting the reaction liquid, the extraction liquid is dried, 500 mu L of ethyl acetate is added for redissolution, gas chromatography is carried out, the conditions are the same as in example 5, and the result is shown in FIG. 7.

Enzyme activity determination:

according to the above system, the components were added and reacted at 28 ℃, 32 ℃, 37 ℃ and 42 ℃ respectively for 10min, the HCl was acidified to pH=2, 2ml of ethyl acetate was extracted to obtain a reaction solution, the reaction solution was dried, 500 μl of ethyl acetate was added for redissolution, and gas chromatography was carried out under the same conditions as in example 5.

The results showed that the enzyme activity was highest at 37 ℃. Thus, at 37℃in parallel with the above-mentioned 3 operations, the average value of the peak area of HIL was 22.3 as measured by gas chromatography, and by the external standard one-point method (peak area of standard: 685.1, concentration: 1.044 mg. ML ^-1), it was calculated that 0.034mg of HIL was produced on average, and 0.0153. Mu.M of HIL was produced per minute as calculated, to obtain the activity value of the enzyme (the enzyme activity value is defined as the amount of enzyme required for converting 1. Mu. Mole of substrate in 1 minute under specific conditions: one enzyme activity unit), and it was confirmed that hipR gene product was HIPC 9 reductase, and the C9 carbonyl of HIP was reduced to hydroxyl group.

The above description of the embodiments of the present invention is not intended to limit the present invention, and those skilled in the art can make various changes or modifications according to the present invention without departing from the spirit of the present invention, and shall fall within the scope of the appended claims.

Claims

1. A ketoreductase at position C-9 of 9, 17-dioxo-1,2,3,4,10,19-hexanorandrostane-5-carboxylic acid having the amino acid sequence or the amino acid sequence of which is:

(1) An amino acid sequence shown in SEQ ID NO. 1;

(3) An amino acid sequence having more than 75% homology with SEQ ID NO. 1;

Preferably, the amino acid sequence of the ketoreductase is shown in SEQ ID NO. 1.

2. A gene encoding or expressing a ketoreductase at position C-9 of 9, 17-dioxo-1,2,3,4,10,19-hexanorandrostane-5-carboxylic acid, which has the following nucleotide sequence, or the nucleotide sequence of which is the nucleotide sequence:

(1) A nucleotide sequence shown as SEQ ID NO. 2;

(3) Nucleotide sequence having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology to the nucleotide sequence shown in SEQ ID NO. 2; or (b)

(4) A nucleotide sequence capable of encoding the amino acid sequence of a ketoreductase according to claim 1 or an amino acid sequence which it has;

preferably, the nucleotide sequence of the gene is shown as SEQ ID NO. 2.

3. A vector comprising the gene of claim 2;

preferably, the vector is an expression vector; more preferably, the expression vector is a bacterial or yeast expression vector;

Preferably, the expression vector is capable of expressing the ketoreductase according to claim 1 in bacteria or yeast; more preferably, the bacteria are selected from one or more of the group consisting of escherichia, mycobacterium, rhodococcus, pseudomonas, or actinomycetes; further preferably, the bacterium is a mycobacterium or escherichia coli; still more preferably, the bacterium is Mycobacterium neogold, mycobacterium smegmatis, mycobacterium fortuitum, or Escherichia coli.

4. A host cell comprising or expressing the ketoreductase according to claim 1 or the gene according to claim 2, or comprising the vector according to claim 3;

Preferably, the host cell is a bacterial or yeast cell; more preferably, the bacteria are selected from one or more of the group consisting of escherichia, mycobacterium, rhodococcus, pseudomonas, and actinomycetes; further preferably, the bacterium is a mycobacterium or escherichia coli; still more preferably, the bacterium is Mycobacterium neogold, mycobacterium smegmatis, mycobacterium fortuitum, or Escherichia coli;

Preferably, the host cell is constructed by introducing a gene of interest, which is capable of encoding or expressing a ketoreductase according to claim 1, or which is a gene according to claim 2;

Or the host cell is constructed by introducing a strong promoter to enhance the expression level of a target gene which encodes or expresses the ketoreductase according to claim 1, or the target gene is a gene according to claim 2, before the original target gene;

Or the host cell is constructed by increasing the copy number of a gene of interest, which is capable of encoding or expressing the ketoreductase according to claim 1, or which is a gene according to claim 2, to enhance the expression level of the gene of interest.

5. A process for the production of 3aα -H-4α - (3 '-propionic acid) -5α -hydroxy-7aβ -methylhexahydro-1-indenone- δ -lactone comprising preparing 3aα -H-4α - (3' -propionic acid) -5α -hydroxy-7aβ -methylhexahydro-1-indenone- δ -lactone by conversion of a plant sterol using a ketoreductase according to claim 1, a gene according to claim 2, a vector according to claim 3 or a host cell according to claim 4.

6. An engineering bacterium for producing 9, 17-dioxo-1,2,3,4,10,19-hexanorandrostane-5-carboxylic acid, which is constructed by eliminating or reducing the original C-9 ketoreduction activity of 9, 17-dioxo-1,2,3,4,10,19-hexanorandrostane-5-carboxylic acid;

Preferably, the engineering bacteria are bacteria; more preferably, the bacteria are selected from one or more of mycobacteria, rhodococcus, pseudomonas or actinomycetes; further preferably, the bacterium is a mycobacterium; still preferably, the engineering bacteria are Mycobacterium neogold, mycobacterium smegmatis or Mycobacterium fortuitum;

Preferably, the engineering bacterium is constructed by inactivating its original gene of interest, which is capable of encoding or expressing the ketoreductase according to claim 1, or the gene of interest is a gene according to claim 2.

7. A process for the production of 9, 17-dioxo-1,2,3,4,10,19-hexanorandrostane-5-carboxylic acid, comprising conversion of phytosterol into 9, 17-dioxo-1,2,3,4,10,19-hexanorandrostane-5-carboxylic acid using the engineered bacterium of claim 6.

8. An engineering bacterium for producing 3a alpha-H-4 a- (3' -propionic acid) -5 a-hydroxy-7a beta-methylhexahydro-1-indenone-delta-lactone, which is constructed by making the engineering bacterium have or increasing the ketoreduction activity at the C-9 position of 9, 17-dioxo-1,2,3,4,10,19-hexanorandrostane-5-carboxylic acid;

Preferably, the engineering bacteria are bacteria or yeasts; more preferably, the bacteria are selected from one or more of the group consisting of escherichia, mycobacterium, rhodococcus, pseudomonas, and actinomycetes; further preferably, the bacterium is a mycobacterium or escherichia coli; still preferably, the engineering bacteria are Mycobacterium neogold, mycobacterium smegmatis, mycobacterium fortuitum or Escherichia coli;

Preferably, the engineering bacterium is constructed by introducing a target gene capable of encoding or expressing the ketoreductase according to claim 1, or the target gene is a gene according to claim 2;

or the engineering bacterium is constructed by introducing a strong promoter to enhance the expression level of a target gene before the original target gene, the target gene being capable of encoding or expressing the ketoreductase according to claim 1, or the target gene being the gene according to claim 2;

or the engineering bacterium is constructed by increasing the copy number of a target gene, which is capable of encoding or expressing the ketoreductase according to claim 1, to enhance the expression level of the target gene, or the target gene is the gene according to claim 2.

9. A method for converting 9, 17-dioxo-1,2,3,4,10,19-hexanorandrostane-5-carboxylic acid, comprising catalytically reducing the C-9-keton-group of 9, 17-dioxo-1,2,3,4,10,19-hexanorandrostane-5-carboxylic acid to hydroxyl using a ketoreductase according to claim 1, a gene according to claim 2, a vector according to claim 3, a host cell according to claim 4 or an engineering bacterium according to claim 8 to produce 9-hydroxy-17-oxo-1,2,3,4,10,19-hexanorandrostane-5-carboxylic acid;

Preferably, the method further comprises using NADPH as a coenzyme.

10. A process for producing 3aα -H-4α - (3 '-propionic acid) -5α -hydroxy-7aβ -methylhexahydro-1-indenone- δ -lactone comprising catalytically reducing the C-9 ketogroup of 9, 17-dioxo-1,2,3,4,10,19-hexanorandrostane-5-carboxylic acid to hydroxy using a ketoreductase according to claim 1, a gene according to claim 2, a vector according to claim 3, a host cell according to claim 4, or an engineering bacterium according to claim 8 to further produce 3aα -H-4α - (3' -propionic acid) -5α -hydroxy-7aβ -methylhexahydro-1-indenone- δ -lactone;

Preferably, the method further comprises using NADPH as a coenzyme.