CN118271440A

CN118271440A - Antibodies targeting IL13 ra 2 and immune effector cells targeting IL13 ra 2

Info

Publication number: CN118271440A
Application number: CN202311861924.6A
Authority: CN
Inventors: 尚小云; 蒋海娟; 马少文; 李博
Original assignee: Maohang Pharmaceutical Suzhou Co ltd
Current assignee: Maohang Pharmaceutical Suzhou Co ltd
Priority date: 2022-12-30
Filing date: 2023-12-29
Publication date: 2024-07-02

Abstract

The application discloses a targeted IL13 Ralpha 2 monoclonal antibody or antigen binding fragment thereof and an immune effector cell containing the antibody.

Description

Antibodies targeting IL13 ra 2 and immune effector cells targeting IL13 ra 2

Technical Field

The application relates to the field of biological medicine, relates to a gene knockout strategy, a molecular biological method and the field of immunotherapy of solid tumors, in particular to an antibody targeting IL13R alpha 2, an IL13R alpha 2UCAR-T cell based on gene editing and preparation thereof.

Background

Chimeric antigen receptor T cells (CAR-T) have shown exciting clinical efficacy in the treatment of hematological malignancies. Two CAR-T cell based drugs Kymriah (Tisagenlecleucel) and Yescarta (AxicabageneCilleucel) approved by the united states Food and Drug Administration (FDA) are currently used to treat acute B-cell leukemia (B-ALL) and diffuse large B-cell lymphoma (DLBCL), respectively, in the united states. Despite advances in the treatment of hematological malignancies, challenges remain in the treatment of solid tumors using CAR-T cell therapies, including life-threatening CAR-T cell-related toxicity, limited efficacy against solid tumors, antigen escape, limited persistence, poor transport and tumor infiltration, and the like. The lack of suitable targets is also a major reason for limiting solid tumor therapies, and the high expression of antigens against solid tumors, relative to hematological tumors, is mostly tumor-associated antigens (TAAs), with lower expression in normal tissues, which means a risk of off-target.

IL13R alpha 2 is a high-affinity membrane receptor of IL-13, is expressed in a large amount in various tumors, such as pancreatic cancer, ovarian cancer, breast cancer, colon cancer, glioma and the like, and normal tissues except testes are not expressed basically, so that the IL13R alpha 2 is a suitable target point of CAR-T treatment, a plurality of clinical treatments of CAR-T treatment targeting the IL13R alpha 2 have been developed in the world at present, and good treatment effects are obtained, so that the development of IL13R alpha 2 antibodies with high specificity and suitable affinity has important significance.

The invention aims to find an antibody sequence targeting IL13 Ralpha 2 with high specificity, and construct the sequence into a CAR structure, so that T cells can be effectively guided to kill tumor cells.

Disclosure of Invention

The application aims to find an antibody sequence targeting IL13 Ralpha 2 with high specificity, and construct the sequence into a CAR structure, so that T cells can be effectively guided to kill tumor cells.

In particular, the application relates to the following aspects:

In one aspect, the application relates to a IL13Rα2-targeting monoclonal antibody or antigen-binding fragment thereof comprising an antibody heavy chain Variable (VH) region comprising heavy chain complementarity determining region 1 (CDR-H1), heavy chain complementarity determining region 2 (CDR-H2) and heavy chain complementarity determining region 3 (CDR-H3) and an antibody light chain Variable (VL) region comprising light chain complementarity determining region 1 (CDR-L1), light chain complementarity determining region 2 (CDR-L2) and light chain complementarity determining region 3 (CDR-L3), wherein,

The CDR-H1, CDR-H2 and CDR-H3 each comprise a sequence selected from the group consisting of ：SEQ ID No:1、SEQ ID No:2、SEQ ID No:3、SEQ ID No:19、SEQ ID No:20、SEQ ID No:21、SEQ ID No:37、SEQ ID No:38、SEQ ID No:39、SEQ ID No:55、SEQ ID No:56、SEQ ID No:57、SEQ ID No:73、SEQ ID No:74、SEQ ID No:75、SEQ ID No:91、SEQ ID No:92、SEQ ID No:93、SEQ ID No:109、SEQ ID No:110、SEQ ID No:111、SEQ ID No:127、SEQ ID No:128、SEQ ID No:129、SEQ ID No:145、SEQ ID No:146、SEQ ID No:147;

The CDR-L1, CDR-L2 and CDR-L3 each comprise a sequence selected from the group consisting of ：SEQ ID No:10、SEQ ID No:11、SEQ ID No:12、SEQ ID No:28、SEQ ID No:29、SEQ ID No:30、SEQ ID No:46、SEQ ID No:47、SEQ ID No:48、SEQ ID No:64、SEQ ID No:65、SEQ ID No:66、SEQ ID No:82、SEQ ID No:83、SEQ ID No:84、SEQ ID No:100、SEQ ID No:101、SEQ ID No:102、SEQ ID No:118、SEQ ID No:119、SEQ ID No:120、SEQ ID No:136、SEQ ID No:137、SEQ ID No:138、SEQ ID No:154、SEQ ID No:155、SEQ ID No:156.

Further, the CDR-H1, the CDR-H2 and the CDR-H3 respectively comprise amino acid sequences shown as SEQ ID No. 1, SEQ ID No. 2 and SEQ ID No. 3; or the amino acid sequence shown as SEQ ID No. 19, SEQ ID No. 20 and SEQ ID No. 21; or the amino acid sequence shown as SEQ ID No. 37, SEQ ID No. 38 and SEQ ID No. 39; or the amino acid sequence shown as SEQ ID No. 55, SEQ ID No. 56 and SEQ ID No. 57; or the amino acid sequence shown as SEQ ID No. 73, SEQ ID No. 74 and SEQ ID No. 75; or the amino acid sequence shown as SEQ ID No. 91, SEQ ID No. 92 and SEQ ID No. 93; or the amino acid sequence shown as SEQ ID No. 109, SEQ ID No. 110 and SEQ ID No. 111; or the amino acid sequence shown as SEQ ID No. 127, SEQ ID No. 128 and SEQ ID No. 129; or the amino acid sequence shown as SEQ ID No. 145, SEQ ID No. 146 and SEQ ID No. 147;

further, the CDR-L1, the CDR-L2 and the CDR-L3 respectively comprise amino acid sequences shown as SEQ ID No. 10, SEQ ID No. 11 and SEQ ID No. 12; or the amino acid sequence shown as SEQ ID No. 28, SEQ ID No. 29 and SEQ ID No. 30; or the amino acid sequence shown as SEQ ID No. 46, SEQ ID No. 47 and SEQ ID No. 48; or the amino acid sequence shown as SEQ ID No. 64, SEQ ID No. 65 and SEQ ID No. 66; or the amino acid sequence shown as SEQ ID No. 82, SEQ ID No. 83 and SEQ ID No. 84; or the amino acid sequence shown as SEQ ID No. 100, SEQ ID No. 101 and SEQ ID No. 102; or the amino acid sequence shown as SEQ ID No. 118, SEQ ID No. 119 and SEQ ID No. 120; or the amino acid sequence shown as SEQ ID No. 136, SEQ ID No. 137 and SEQ ID No. 138; or the amino acid sequence shown as SEQ ID No. 154, SEQ ID No. 155 and SEQ ID No. 156.

Further, CDR-H1, CDR-H2 and CDR-H3 of the VH region comprise amino acid sequences as shown in SEQ ID No.1, SEQ ID No. 2 and SEQ ID No. 3 respectively, and CDR-L1, CDR-L2 and CDR-L3 of the VL region comprise amino acid sequences as shown in SEQ ID No. 10, SEQ ID No. 11 and SEQ ID No. 12 respectively; or (b)

CDR-H1, CDR-H2 and CDR-H3 of the VH region respectively comprise amino acid sequences shown as SEQ ID No. 19, SEQ ID No. 20 and SEQ ID No. 21, and CDR-L1, CDR-L2 and CDR-L3 of the VL region respectively comprise amino acid sequences shown as SEQ ID No. 28, SEQ ID No. 29 and SEQ ID No. 30; or (b)

CDR-H1, CDR-H2 and CDR-H3 of the VH region respectively comprise amino acid sequences shown as SEQ ID No. 37, SEQ ID No. 38 and SEQ ID No. 39, and CDR-L1, CDR-L2 and CDR-L3 of the VL region respectively comprise amino acid sequences shown as SEQ ID No. 46, SEQ ID No. 47 and SEQ ID No. 48; or (b)

CDR-H1, CDR-H2 and CDR-H3 of the VH region respectively comprise amino acid sequences shown as SEQ ID No. 55, SEQ ID No. 56 and SEQ ID No. 57, and CDR-L1, CDR-L2 and CDR-L3 of the VL region respectively comprise amino acid sequences shown as SEQ ID No. 64, SEQ ID No. 65 and SEQ ID No. 66; or (b)

CDR-H1, CDR-H2 and CDR-H3 of the VH region respectively comprise amino acid sequences shown as SEQ ID No. 73, SEQ ID No. 74 and SEQ ID No. 75, and CDR-L1, CDR-L2 and CDR-L3 of the VL region respectively comprise amino acid sequences shown as SEQ ID No. 82, SEQ ID No. 83 and SEQ ID No. 84; or (b)

CDR-H1, CDR-H2 and CDR-H3 of the VH region respectively comprise amino acid sequences shown as SEQ ID No. 91, SEQ ID No. 92 and SEQ ID No. 93, and CDR-L1, CDR-L2 and CDR-L3 of the VL region respectively comprise amino acid sequences shown as SEQ ID No. 100, SEQ ID No. 101 and SEQ ID No. 102; or (b)

CDR-H1, CDR-H2 and CDR-H3 of the VH region respectively comprise amino acid sequences shown as SEQ ID No. 109, SEQ ID No. 110 and SEQ ID No. 111, and CDR-L1, CDR-L2 and CDR-L3 of the VL region respectively comprise amino acid sequences shown as SEQ ID No. 118, SEQ ID No. 119 and SEQ ID No. 120; or (b)

CDR-H1, CDR-H2 and CDR-H3 of the VH region respectively comprise an amino acid sequence shown as SEQ ID No. 127, SEQ ID No. 128 and SEQ ID No. 129, and CDR-L1, CDR-L2 and CDR-L3 of the VL region respectively comprise an amino acid sequence shown as SEQ ID No. 136, SEQ ID No. 137 and SEQ ID No. 138; or (b)

CDR-H1, CDR-H2 and CDR-H3 of the VH region comprise amino acid sequences shown as SEQ ID No. 145, SEQ ID No. 146 and SEQ ID No. 147 respectively, and CDR-L1, CDR-L2 and CDR-L3 of the VL region comprise amino acid sequences shown as SEQ ID No. 154, SEQ ID No. 155 and SEQ ID No. 156 respectively.

Further, the VH region of the antibody or fragment comprises an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical or 100% to the sequence shown in SEQ ID No. 8 or SEQ ID No. 26 or SEQ ID No. 44 or SEQ ID No. 62 or SEQ ID No. 80 or SEQ ID No. 98 or SEQ ID No. 116 or SEQ ID No. 134 or SEQ ID No. 152;

The VL region of the antibody or fragment comprises an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical or 100% to the sequence shown as SEQ ID No. 17 or SEQ ID No. 35 or SEQ ID No. 53 or SEQ ID No. 71 or SEQ ID No. 89 or SEQ ID No. 107 or SEQ ID No. 125 or SEQ ID No. 143 or SEQ ID No. 161.

Further, the VH region and VL region of the antibody or fragment, respectively, comprise amino acid sequences that are at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more, or 100% identical to the sequences shown in SEQ ID nos. 8 and 17; or (b)

The VH region and VL region of the antibody or fragment comprise amino acid sequences having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more or 100% identity to the sequences shown in SEQ ID nos. 26 and 35, respectively; or (b)

The VH region and VL region of the antibody or fragment comprise amino acid sequences that are at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more, or 100% different from the sequences shown in SEQ ID nos. 44 and 53, respectively; or (b)

The VH region and VL region of the antibody or fragment comprise amino acid sequences having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more or 100% identity to the sequences shown in SEQ ID No. 62 and SEQ ID No. 71, respectively; or (b)

The VH region and VL region of the antibody or fragment comprise amino acid sequences having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more or 100% identity to the sequences shown in SEQ ID No. 80 and SEQ ID No. 89, respectively; or (b)

The VH region and VL region of the antibody or fragment comprise amino acid sequences having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more or 100% identity to the sequences shown in SEQ ID No. 98 and SEQ ID No. 107, respectively; or (b)

The VH region and VL region of the antibody or fragment comprise amino acid sequences that are at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more or 100% identical to the sequences shown in SEQ ID nos. 116 and 125, respectively; or (b)

The VH region and VL region of the antibody or fragment comprise amino acid sequences having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more or 100% identity to the sequences shown in SEQ ID nos. 134 and 143, respectively; or (b)

The VH region and VL region of the antibody or fragment comprise amino acid sequences that are at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more or 100% identical to the sequences shown in SEQ ID nos. 152 and 161, respectively.

Further, the antibody or fragment has a VH region as shown in SEQ ID No. 8 or SEQ ID No. 26 or SEQ ID No. 44 or SEQ ID No. 62 or SEQ ID No. 80 or SEQ ID No. 98 or SEQ ID No. 116 or SEQ ID No. 134 or SEQ ID No. 152 or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity to the amino acid sequence as shown in SEQ ID No. 8 or SEQ ID No. 26 or SEQ ID No. 44 or SEQ ID No. 62 or SEQ ID No. 80 or SEQ ID No. 98 or SEQ ID No. 116 or SEQ ID No. 134 or SEQ ID No. 152; and

The VL region of the antibody or fragment is an amino acid sequence as shown in SEQ ID No. 17 or SEQ ID No. 35 or SEQ ID No. 53 or SEQ ID No. 71 or SEQ ID No. 89 or SEQ ID No. 107 or SEQ ID No. 125 or SEQ ID No. 143 or SEQ ID No. 161 or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity to an amino acid sequence as shown in SEQ ID No. 17 or SEQ ID No. 35 or SEQ ID No. 53 or SEQ ID No. 71 or SEQ ID No. 89 or SEQ ID No. 107 or SEQ ID No. 125 or SEQ ID No. 143 or SEQ ID No. 161.

Further, the VH region and VL region of the antibody or fragment are amino acid sequences as shown in SEQ ID No. 8 and SEQ ID No. 17, respectively, or are amino acid sequences having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity to the amino acid sequences as shown in SEQ ID No. 8 and SEQ ID No. 17, respectively; or (b)

The VH region and the VL region of the antibody or the fragment are respectively shown as SEQ ID No. 26 and SEQ ID No. 35 or are respectively amino acid sequences which have at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% and 99% identity with the amino acid sequences shown as SEQ ID No. 26 and SEQ ID No. 35; or (b)

The VH region and the VL region of the antibody or the fragment are respectively shown as SEQ ID No. 44 and SEQ ID No. 53 or are respectively amino acid sequences which have at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% and 99% identity with the amino acid sequences shown as SEQ ID No. 44 and SEQ ID No. 53; or (b)

The VH region and the VL region of the antibody or the fragment are respectively shown as SEQ ID No. 62 and SEQ ID No. 71 or are respectively amino acid sequences which have at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% and 99% identity with the amino acid sequences shown as SEQ ID No. 62 and SEQ ID No. 71; or (b)

The VH region and the VL region of the antibody or the fragment are respectively an amino acid sequence shown as SEQ ID No. 80 and SEQ ID No. 89 or are respectively an amino acid sequence which has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% and 99% of the same as the amino acid sequence shown as SEQ ID No. 80 and SEQ ID No. 89; or (b)

The VH region and VL region of the antibody or fragment are the amino acid sequences shown as SEQ ID No. 98 and SEQ ID No. 107, respectively, or are amino acid sequences having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity to the amino acid sequences shown as SEQ ID No. 98 and SEQ ID No. 107, respectively; or (b)

The VH region and VL region of the antibody or fragment are the amino acid sequences shown as SEQ ID No. 116 and SEQ ID No. 125, respectively, or are amino acid sequences having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity to the amino acid sequences shown as SEQ ID No. 116 and SEQ ID No. 125, respectively; or (b)

The VH region and the VL region of the antibody or the fragment are respectively shown as SEQ ID No. 134 and SEQ ID No. 143 or are respectively amino acid sequences which have at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% and 99% identity with the amino acid sequences shown as SEQ ID No. 134 and SEQ ID No. 143; or (b)

The VH region and VL region of the antibody or fragment are the amino acid sequences shown as SEQ ID No. 152 and SEQ ID No. 161 or the amino acid sequences which have at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% and 99% identity with the amino acid sequences shown as SEQ ID No. 152 and SEQ ID No. 161 respectively.

Further, the VH region and VL region may be joined by a linker, preferably comprising the amino acid sequence set forth in SEQ ID No. 163 or comprising a sequence encoded by the nucleotide sequence set forth in SEQ ID No. 164.

Further, the antibody or antigen binding fragment has an amino acid sequence as set forth in any one of SEQ ID Nos 167 to 175 or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or more identity to an amino acid sequence as set forth in any one of SEQ ID Nos 167 to 175.

In another aspect, the application relates to a Chimeric Antigen Receptor (CAR) that targets IL13 ra 2, wherein the chimeric antigen receptor comprises a targeting moiety and a non-targeting moiety, and the targeting moiety comprises an antibody or antigen binding fragment described in the application.

Further, the targeting moiety of the chimeric antigen receptor includes a full length antibody, fab, single chain variable fragment (scFv), or single domain antibody (VHH) that targets a monoclonal antibody to IL13 ra 2 or an antigen binding fragment thereof.

Further, the chimeric antigen receptor further comprises a transmembrane domain, and the transmembrane domain is a transmembrane domain ：CD8A、CD8B、CD28、CD3ε(CD3e)、4-1BB、CD4、CD27、CD7、PD-1、TRAC、TRBC、CD3ζ、CTLA-4、LAG-3、CD5、ICOS、OX40、NKG2D、2B4、CD244、FcεRIγ、BTLA、CD30、GITR、HVEM、DAP10、CD2、NKG2C、LIGHT、DAP12,CD40L(CD154)、TIM1、CD226、DR3、CD45、CD80、CD86、CD9、CD16、CD22、CD33、CD37、CD64 and SLAM comprising one or more proteins selected from the group consisting of.

Further, the transmembrane domain comprises an amino acid sequence selected from any one of SEQ ID No. 176-227.

Further, the chimeric antigen receptor further comprises an intracellular co-stimulatory signaling domain, and the intracellular co-stimulatory signaling domain is an intracellular co-stimulatory signaling domain ：CD28、4-1BB(CD137)、CD27、CD2、CD7、CD8A、CD8B、OX40、CD226、DR3、SLAM、CDS、ICAM-1、NKG2D、NKG2C、B7-H3、2B4、FcεRIγ、BTLA、GITR、HVEM、DAP10、DAP12、CD30、CD40、CD40L、TIM1、PD-1、LFA-1、LIGHT、JAML、CD244、CD100、ICOS、CD40 and MyD88 comprising one or more proteins selected from the group consisting of.

Further, the intracellular co-stimulatory signaling domain comprises an amino acid sequence selected from any of SEQ ID nos 228 to 262.

Further, the chimeric antigen receptor further comprises an intracellular signaling domain, and the intracellular signaling domain is an intracellular co-stimulatory signaling domain comprising one or more proteins selected from the group consisting of: CD3 ζ, CD3 δ, CD3 γ, CD3 ε, CD79a, CD79b, fceri γ, fceri β, fcgamma RIIa, bovine leukemia virus gp30, epstein-Barr virus (EBV) LMP2A, simian immunodeficiency virus PBj14 Nef, kaposi sarcoma herpes virus (HSKV), DAP10 and DAP-12 or a domain comprising at least one ITAM.

Further, the intracellular signaling domain comprises an amino acid sequence selected from any one of SEQ ID No. 263-276.

Further, the chimeric antigen receptor further comprises a hinge region, and the hinge region is a hinge region ：CD28、IgG1、IgG4、IgD、4-1BB、CD4、CD27、CD7、CD8A、PD-1、ICOS、OX40、NKG2D、NKG2C、FcεRIγ、BTLA、GITR、DAP10、TIM1、SLAM、CD30 comprising one or more proteins selected from the group consisting of LIGHT.

Further, the hinge region comprises an amino acid sequence selected from any one of SEQ ID Nos 277 to 298.

Further, the non-targeting portion of the chimeric antigen receptor comprises a CD8 transmembrane domain, a 4-1BB intracellular co-stimulatory signaling domain, a CD3 zeta intracellular signaling domain and a CD8 hinge region.

Further, the chimeric antigen receptor further comprises a signal peptide fragment, the C-terminus of which is linked to the N-terminus of the targeting moiety, preferably the signal peptide fragment comprises a CD8A peptide fragment.

Further, the non-targeting portion of the chimeric antigen receptor comprises the amino acid sequence shown as SEQ ID No. 165.

Further, the chimeric antigen receptor comprises an amino acid sequence as set forth in any one of SEQ ID Nos 299 to 307.

In yet another aspect, the application relates to one or more isolated nucleic acid molecules encoding an antibody or antigen binding fragment thereof as described herein or encoding a chimeric antigen receptor as described herein.

Further, the isolated nucleic acid molecule comprises the nucleotide sequence set forth in any one of SEQ ID Nos 308-316 or 380-388.

In yet another aspect, the application relates to a vector comprising an isolated nucleic acid molecule as described in the application.

Further, the vector is selected from any one of a DNA vector, an RNA vector, a plasmid, a lentiviral vector, an adenovirus vector, an adeno-associated virus vector, and a retrovirus vector.

Further, the vector is a lentiviral vector.

In yet another aspect, the application relates to a cell comprising an antibody or antigen binding fragment thereof as described herein or encoding a chimeric antigen receptor as described herein, an isolated nucleic acid molecule as described herein and/or a vector as described herein.

In yet another aspect, the application relates to an immune effector cell comprising an antibody or antigen binding fragment thereof as described herein or encoding a chimeric antigen receptor as described herein, an isolated nucleic acid molecule as described herein and/or a vector as described herein.

In yet another aspect, the application relates to an immune effector cell in which the function of the T cell antigen receptor (TCR) and the major histocompatibility complex (mhc i) in the cell is inhibited, and which comprises the chimeric antigen receptor described in the application.

Further, the immune effector cell is a human cell.

Further, the immune effector cell is selected from T cells, B cells, natural killer cells (NK cells), macrophages, NKT cells, monocytes, dendritic cells, granulocytes, lymphocytes, leukocytes, or peripheral blood mononuclear cells.

Further, the immune effector cells are selected from autologous or non-autologous immune effector cells.

Further, the immune effector cell is a modified immune effector cell, wherein the modification comprises down-regulation of expression and/or activity of one or more of the genes associated with immune rejection.

Further, the immune rejection-related gene is selected from one or more genes in the group consisting of: TRAC, TRBC, HLA-A, HLA-B, B2M and CIITA.

Further, the expression and/or activity of the TRAC gene and the HLA-A gene is down-regulated in the modified immune effector cells as compared to the corresponding cells that are not modified or the corresponding wild-type cells.

Further, the expression and/or activity of the CIITA gene is not down-regulated in the modified immune effector cells compared to the corresponding cells that are not modified or the corresponding wild-type cells.

Further, the expression and/or activity of the B2M gene is not down-regulated in the modified immune effector cell compared to a corresponding cell or corresponding wild-type cell that has not been modified.

Further, down-regulating the expression level and/or activity of the gene comprises down-regulating the expression and/or activity of a nucleic acid molecule encoding the gene; and/or allowing the expression and/or activity of the protein product encoded by the gene to be down-regulated.

Further, the modification comprises: gene knockout, gene mutation, and/or gene silencing.

Further, the modification comprises in the immune effector cell:

Either one of the two TRAC alleles is knocked out and either one of the two HLA-A alleles is knocked out; or (b)

Two TRAC alleles are knocked out and either one of the two HLA-A alleles is knocked out; or (b)

TRAC gene exons are knocked out and HLA-A gene exons are knocked out; or alternatively

TRAC gene exons are knocked out and HLA-B gene exons are knocked out; or alternatively

TRAC gene exons are knocked out, HLA-A gene exons are knocked out, and HLA-B gene exons are knocked out.

Further, the modification comprises administering to the immune effector cell one or more substances selected from the group consisting of: antisense RNA, siRNA, shRNA and CRISPR/Cas9 systems.

Further, the modification comprises administering a CRISPR/Cas9 system to the immune effector cell.

Further, the modification further comprises administering to the immune effector cell an sgRNA targeting an exon portion of the TRAC gene.

Further, the sgRNA targeting the exon portion of the TRAC gene comprises a nucleotide sequence selected from any one of SEQ ID No. 317 to SEQ ID No. 331.

Further, the modification further comprises administering to the immune effector cell an sgRNA targeting an exon portion of the HLA-A gene.

Further, the sgRNA targeting the exon portion of the HLA-A gene comprises a nucleotide sequence selected from the group consisting of any one of SEQ ID No. 332 to SEQ ID No. 372.

Further, the modification comprises administering to the immune effector cell an sgRNA targeting an exon portion of the HLA-B gene.

Further, the sgRNA targeting the exon portion of the HLA-B gene comprises a nucleotide sequence selected from any one of SEQ ID No. 373 to SEQ ID No. 374.

Further, the modification further comprises administering a Cas enzyme to the cell.

Further, the Cas enzyme is a Cas9 protein.

Further, the antisense RNA comprises a nucleotide sequence shown in any one of SEQ ID No. 376 to SEQ ID No. 379.

Further, the immune effector cell is an HLA-B homozygote or heterozygote cell, and/or the immune effector cell is an HLA-A homozygote or heterozygote cell.

Further, the HLA-B homozygote is selected from the group consisting of HLA-B homozygote, HLA-B homozygote 15, HLA-B homozygote 46, HLA-B homozygote 13, HLA-B homozygote 51, HLAB x 58 homozygote, HLA-B x 07 homozygote, HLA-B x 35 homozygote, HLA-B x 44 homozygote, HLA-B x 52 homozygote, HLA-B x 57 homozygote, HLA-B x 54 homozygote or HLA-B x 55 homozygote, preferably HLA-B x 40 homozygote, HLA-B x 46 homozygote;

Further, the HLA-A homozygote or heterozygote is selected from the group consisting of HLA-A x 02 homozygote, HLA-A x 11 homozygote, HLA-A x 02/a11 heterozygote and HLA-A x 24 homozygote, preferably HLA-A x 02 homozygote, HLA-A x 11 homozygote and HLA-A x 02/a11 homozygote.

In yet another aspect, the application relates to a method of preparing an immune effector cell comprising: modifying an immune effector cell prior to/after introducing into said immune effector cell a nucleic acid molecule as described herein or a vector as described herein, said modification comprising down-regulating the expression and/or activity of one or more of the genes associated with immune rejection.

Further, the gene associated with immune rejection is selected from one or more genes in the group consisting of: TRAC, TRBC, HLA-A, HLA-B, B2M and CIITA.

Further, the modification allows the expression and/or activity of TRAC gene and HLA-A gene to be down-regulated in the modified immune effector cells compared to corresponding cells or corresponding wild-type cells that have not been modified.

Further, the modification results in a modified immune effector cell that has not been down-regulated in expression and/or activity of the CIITA gene compared to a corresponding cell or corresponding wild-type cell that has not been modified.

Further, the modification results in a modified immune effector cell that has not been down-regulated in expression and/or activity of the B2M gene compared to a corresponding cell or corresponding wild-type cell that has not been modified.

Further, the modification comprises in the immune effector cell:

Further, the modification comprises administering to the immune effector cell an sgRNA targeting an exon portion of the TRAC gene.

Further, the modification comprises administering to the immune effector cell an sgRNA targeting an exon portion of the HLA-A gene.

Further, wherein the Cas enzyme is a Cas9 protein.

Further, the immune effector cell is a human cell.

Further, the immune effector cells are autologous or non-autologous immune effector cells.

Further, the immune effector cell is an HLA-B homozygote cell.

Further, the HLA-B homozygote is selected from the group consisting of HLA-B homozygote, HLA-B homozygote 15, HLA-B homozygote 46, HLA-B homozygote 13, HLA-B homozygote 51, HLAB x 58 homozygote, HLA-B x 07 homozygote, HLA-B x 35 homozygote, HLA-B x 44 homozygote, HLA-B x 52 homozygote, HLA-B x 57 homozygote, HLA-B x 54 homozygote or HLA-B x 55 homozygote, preferably HLA-B x 40, HLA-B x 46 homozygote.

Further, the immune effector cell is an HLA-A homozygote or a heterozygote cell.

Further, the HLA-A homozygote or heterozygote is HLA-A 02 homozygote, HLA-A 11 homozygote, HLA-A 02/a11 heterozygote or HLA-A 24 homozygote, preferably HLA-A 02 homozygote, HLA-A 11 homozygote and HLA-A 02/a11 homozygote.

Furthermore, the immune effector cell prepared by the method is the immune effector cell provided by the application.

In yet another aspect, the application relates to a pharmaceutical composition comprising an antibody or antigen binding fragment of the application or an immune effector cell of the application, and optionally a pharmaceutically acceptable carrier.

In yet another aspect, the application relates to the use of an antibody or antigen binding fragment according to the application or an immune effector cell according to the application and/or a pharmaceutical composition according to the application for the treatment of a disease or disorder associated with expression of IL13 ra 2.

Further, the diseases or disorders associated with expression of IL13Rα2 include diseases or disorders associated with upregulation of IL13Rα2 expression.

Further, the disease or disorder associated with expression of IL13Rα2 includes cancer.

Further, the cancer comprises an IL13 ra positive tumor.

Further, the IL13 ra positive tumor includes glioblastoma, colorectal cancer, cervical cancer, pancreatic cancer, skin melanoma, ovarian cancer, breast cancer, adrenocortical cancer, thymoma, uterine cancer, bladder cancer, esophageal cancer, head and neck squamous carcinoma, or gastric cancer.

In a further aspect, the application relates to the use of an antibody or antigen binding fragment according to the application or an immune effector cell according to the application and/or a pharmaceutical composition according to the application for the manufacture of a medicament for the treatment of a disease or disorder associated with expression of IL13 ra 2.

Further, the cancer comprises an IL13 ra positive tumor.

In yet another aspect, the application relates to a method of preventing or treating a disease or disorder associated with expression of IL13 ra 2 comprising administering to a subject in need thereof an effective amount of an antibody or antigen binding fragment of the application or an immune effector cell of the application and/or a pharmaceutical composition of the application.

Further, the cancer comprises an IL13 ra positive tumor.

ADVANTAGEOUS EFFECTS OF INVENTION

According to the application, through detecting the combination condition of the candidate antibody and the target cell and carrying out SPR affinity test on the antibody, the proper 9 antibodies targeting IL13R alpha 2 are selected, then the sequence is constructed into the CAR structure, and the killing effect of the CAR-T cell on the tumor in vitro and in vivo is tested.

Further, the application firstly uses IL13Rα2 antibody (murine) as the extracellular domain of CAR, and the connection sequence is VL-linker-VH. The transmembrane domain is a CD8 domain, the extracellular domain and the transmembrane domain are connected through a hinge region, the hinge region is a CD8 hinge region, the costimulatory signaling domain is a human 4-1BB intracellular region, and CD3 zeta is an activation signaling domain, so that the targeted IL13 Ralpha 2 autologous CAR-T cell with anti-tumor activity can be successfully prepared.

The application selects a commercial lentivirus expression vector pCDH-CMV-MCS-EF1-copGFP as a framework, and performs element transformation on the basis of the vector. First, the ampicillin resistance gene β -lactamase of the vector was replaced with an aminoglycoside phosphotransferase derived from Tn5, rendering the vector kanamycin resistant. Second, the CMV promoter and its adjacent downstream multiple cloning sites, which are potentially threatening in vivo applications, are deleted. Finally, the copGFP gene which is expressed by the EF1 promoter in the original vector is deleted, a SalI enzyme cutting site is reserved, and a SmaI enzyme cutting site is added at the 5' end of the SalI for constructing the vector, so that the final target vector is formed. The added SmaI cleavage site is a single cleavage site of the final target vector, and other sequence parts of the vector do not have the cleavage site.

The application is further based on the fact that the HLA-B homozygotes in the population are derived from a donor, and that one of the patient's HLA-B alleles is identical to the donor homozygote, and that cells derived from these donors are capable of covering a high proportion of the patient population. Reduce rejection reaction caused by HLA-B. HLA-B is mainly selected from higher frequency B.sub.40 homozygote, B.sub.15 homozygote, B.sub.46 homozygote, B.sub.13 homozygote, B.sub.51 homozygote, B.sub.58 homozygote, B.sub.07 homozygote, B.sub.35 homozygote, B.sub.44 homozygote, B.sub.52 homozygote, B.sub.57 homozygote, B.sub.54 homozygote, and B.sub.55 homozygote in a population. The knockout strategy is used for knocking out the TRAC and rejection highly related HLA-A molecules, and other HLA-I molecules are reserved, so that rejection of allogeneic cells is reduced, the occurrence that HLA molecules are completely knocked out and cleared by NK cells is avoided, and the half-life of allogeneic CAR-T cells in vivo is greatly prolonged. While reducing GVHD response caused by allogeneic cell therapy. The TCR gene selects the gene TRAC encoding TCR alpha chain, HLA-A selects the higher frequency homozygote A.times.02, homozygote A.times.11, homozygote A.times.02/A11 and homozygote A.times.24 in the population.

The application adopts the optimized RNP method to double knock TRAC and HLA-A genes, and the double knock efficiency can reach more than 90 percent. The application provides a preparation method of a targeting IL13Rα2 universal CAR-T cell. Specifically, the application collects peripheral blood of healthy people, performs HLA typing detection, and selects typing meeting the needs of people. Preparation of IL13R alpha 2UCAR-T cells: firstly, separating PBMC, adding CD3 magnetic beads according to a proportion for incubation, and sorting CD3+ T cells; mixing CD3/CD28 antibody coupled magnetic beads uniformly, taking out a proper amount of magnetic bead suspension according to a calculated amount, adding the magnetic bead suspension into a T cell culture system, activating T cells, and culturing overnight; the following day T cells were infected according to titers of IL13 ra 2CAR virus. Followed by gene knockout: the TRAC and HLA-A genes were knocked out simultaneously. Cells were harvested 48 hours after electrotransformation to detect knockdown efficiency. The next step was to sort CD3 negative T cells: CD3 magnetic beads were added in proportion and CD3-T cells (cells to which the magnetic beads were not bound) were collected. Fresh medium was added or passaged depending on T cell density and status, cell density was maintained between 3 x 10 ⁵-1×10⁶/ml. And (4) treating the cells on the 14 th day, taking the final product into a cell freezing bag, attaching a label on the cell freezing bag, and preserving in liquid nitrogen. And simultaneously, sample delivery and quality inspection show that the application constructs the efficient targeted IL13R alpha 2 general CAR-T cell.

Drawings

FIG. 1 is a schematic diagram showing the binding of ascites fluid containing different IL13Rα2 antibodies to target cell U251 in example 2.

FIG. 2 is a schematic diagram showing the binding of the flow assay antibody to the target cell U251 after purification of the IL13Ra2 antibody in ascites in example 3.

FIG. 3 is a schematic of the affinity of nine antibodies detected by SPR in example 6.

FIG. 4 is a schematic diagram showing the efficiency of lentivirus infection of 293T cells in example 9.

FIG. 5 is a graph showing the efficiency of T cell transfection with lentivirus in example 10.

FIG. 6A is a graph showing the results of killing target cells by UCAR-T and CAR-T cells in example 13. FIGS. 6B and 6C are schematic diagrams showing cytokine secretion assays performed by UCAR-T and CAR-T cells co-cultured with target cells, respectively, in example 13.

FIG. 7 is a graph showing the in vivo killing effect of UCAR-T cells and CAR-T cells on tumor cells in example 14.

FIG. 8 is a schematic representation of the half-life of UCAR-T cells in a humanized immune system mouse of example 15.

FIG. 9 is a schematic diagram showing the result of specific killing in example 16

FIG. 10A is a schematic representation of the results of an anti-host response in vivo in example 17 targeted IL13RA2 UCAR-T cells.

FIGS. 10B and 10C are graphs showing cytokine levels in the GVHD reaction of example 17.

FIG. 10D is a schematic representation of the staining of HE sections of the mouse organs of example 17.

Figure 10E is a graph showing copy number variation of CAR from example 17 allo-reaction.

FIGS. 10F and 10G are graphs showing cytokine levels in the allogeneic reaction of example 17.

Detailed Description

The present application will now be described in detail with reference to the embodiments thereof as illustrated in the accompanying drawings, wherein like numerals refer to like features throughout. While specific embodiments of the application are shown in the drawings, it should be understood that the application may be embodied in various forms and should not be limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the application to those skilled in the art.

It should be noted that certain terms are used throughout the description and claims to refer to particular components. Those of skill in the art will understand that a person may refer to the same component by different names. The specification and claims do not identify differences in terms of components, but rather differences in terms of the functionality of the components. As referred to throughout the specification and claims, the terms "include" or "comprising" are used in an open-ended fashion, and thus should be interpreted to mean "include, but not limited to. The description hereinafter sets forth a preferred embodiment for practicing the application, but is not intended to limit the scope of the application, as the description proceeds with reference to the general principles of the description. The scope of the application is defined by the appended claims.

Definition of terms

In the present application, the term "chimeric antigen receptor" or "CAR" generally refers to a group of polypeptides, typically two in the simplest embodiment, that when in an immune effector cell, provide cell specificity for a target cell (typically a cancer cell) and produce an intracellular signal. In some embodiments, the CAR comprises at least one extracellular antigen binding domain (such as a VHH, scFv, or portion thereof), a transmembrane domain, and a cytoplasmic signaling domain (also referred to herein as an "intracellular signaling domain") comprising a functional signaling domain derived from a stimulatory molecule and/or a co-stimulatory molecule as defined below. In some embodiments, the set of polypeptides are in the same polypeptide chain (e.g., comprise a chimeric fusion protein). In some embodiments, the set of polypeptides are discontinuous with each other, e.g., in different polypeptide chains. In some aspects, the set of polypeptides includes a dimerization switch that can couple polypeptides to each other in the presence of a dimerization molecule, e.g., can couple an antigen binding domain to an intracellular signaling domain. In one aspect, the stimulatory molecule of the CAR is a zeta chain associated with the T cell receptor complex. In one aspect, the cytoplasmic signaling domain comprises a primary signaling domain (e.g., a primary signaling domain of CD3- ζ). In one aspect, the cytoplasmic signaling domain further comprises one or more functional signaling domains derived from at least one costimulatory molecule as defined below. In one aspect, the costimulatory molecule may be selected from 4-1BB (i.e., CD 137), CD27, ICOS and/or CD28. In one aspect, the CAR comprises a chimeric fusion protein that can comprise an extracellular antigen recognition domain, a transmembrane domain, and an intracellular signaling domain comprising a functional signaling domain derived from a stimulatory molecule. In one aspect, the CAR comprises a chimeric fusion protein that can comprise an extracellular antigen recognition domain, a transmembrane domain, and an intracellular signaling domain comprising a functional signaling domain derived from a co-stimulatory molecule and a functional signaling domain derived from a stimulatory molecule. in one aspect, the CAR comprises a chimeric fusion protein that can comprise an extracellular antigen recognition domain, a transmembrane domain, and an intracellular signaling domain comprising a functional signaling domain derived from one or more co-stimulatory molecules and a functional signaling domain derived from a stimulatory molecule. In one aspect, the CAR comprises a chimeric fusion protein that can comprise an extracellular antigen recognition domain, a transmembrane domain, and an intracellular signaling domain comprising at least two functional signaling domains derived from one or more co-stimulatory molecules and a functional signaling domain derived from a stimulatory molecule. in one aspect, the CAR comprises an optional leader sequence on the amino terminus (N-ter) of the CAR fusion protein. In one aspect, the CAR further comprises a leader sequence at the N-terminus of the extracellular antigen recognition domain, wherein the leader sequence is optionally excised from the antigen recognition domain (e.g., VHH) during cell processing and localizes the CAR to the cell membrane.

In the present application, the term "interleukin-13 receptor subunit α -2 (IL-13 RA 2)" (also known as CD213A2, 213A2 cluster of differentiation) has its ordinary and conventional meaning and may include, but is not limited to, a membrane-bound protein encoded by the IL-13RA2 gene in humans, for example. IL-13Rα2 is closely related to subunit IL-13Rα1 of the interleukin-13 receptor complex. IL-13R alpha 2 usually with high affinity binding IL-13, but lacks any obvious cytoplasmic domain, and does not appear to act as a signaling mediator. However, it is able to modulate the effects of both IL-13 and IL-4, although it cannot bind directly to the latter. It is reported to also play a role in the internalization of IL-13.

In the present application, the term "antibody" is generally intended to be used in the broadest sense and specifically covers monoclonal antibodies, polyclonal antibodies, dimers, multimers, multispecific antibodies (e.g., bispecific antibodies), and antibody fragments so long as they exhibit the desired biological activity (MILLERETAL (2003) journal of immunology 170:4854-4861). The antibody may be murine, human, humanized, chimeric, or derived from other species.

Full length antibodies typically refer to antibodies that consist of two "full length antibody heavy chains" and two "full length antibody light chains. A "full length antibody heavy chain" is generally a polypeptide consisting of an antibody heavy chain variable domain (VH), an antibody constant heavy chain domain 1 (CH 1), an antibody Hinge Region (HR), an antibody heavy chain constant domain 2 (CH 2), and an antibody heavy chain constant domain 3 (CH 3), abbreviated as VH-CH1-HR-CH2-CH3, in the N-terminal to C-terminal direction; and optionally also antibody heavy chain constant domain 4 (CH 4) in the case of antibodies of the IgE subclass. In some embodiments, a "full length antibody heavy chain" is a polypeptide consisting of VH, CH1, HR, CH2, and CH3 in the N-to C-terminal direction. A "full length antibody light chain" is generally a polypeptide consisting of an antibody light chain variable domain (VL) and an antibody light chain constant domain (CL), abbreviated VL-CL, in the N-to C-terminal direction. The antibody light chain constant domain (CL) may be kappa (kappa) or lambda (lambda). The two full length antibody chains are linked together by an inter-polypeptide disulfide bond between the CL domain and the CH1 domain and an inter-polypeptide disulfide bond between the hinge regions of the full length antibody heavy chains. Examples of typical full length antibodies are natural antibodies such as IgG (e.g., igG1 and IgG 2), igM, igA, igD, and IgE.

In the present application, the term "antigen binding fragment" (also referred to herein as "targeting moiety" or "antigen binding moiety") generally refers to a portion of an antibody molecule that comprises amino acids responsible for specific binding between the antibody and antigen. The portion of the antigen specifically recognized and bound by an antibody is referred to as an "epitope" as described above. The antigen binding domain may typically comprise an antibody light chain variable region (VL) and an antibody heavy chain variable region (VH); however, it does not necessarily include both. Fd fragments, for example, have two VH regions and typically retain some of the antigen-binding function of the complete antigen-binding domain. Examples of antigen-binding fragments of antibodies include (1) Fab fragments, monovalent fragments having VL, VH, constant light Chain (CL), and CH1 domains; (2) A F (ab') 2 fragment, a bivalent fragment having two Fab fragments linked by a disulfide bridge of a hinge region; (3) Fd fragment with two VH and CH1 domains; (4) Fv fragments with VL and VH domains of an antibody single arm, (5) dAb fragments (Ward et al ,"BindingActivities of a Repertoire of Single Immunoglobulin Variable Domains Secreted From Escherichiacoli,"Nature 341:544-546(1989),, which is incorporated herein by reference in its entirety) with VH domains; (6) an isolated Complementarity Determining Region (CDR); (7) Single chain Fv (scFv), e.g., derived from a scFV-library. Although the two domains of Fv fragments, VL and VH, are encoded by separate genes, they can be joined using recombinant methods by a synthetic linker such that they are made as a single protein chain in which the VL and VH regions pair to form monovalent molecules (known as single chain Fv (scFv)) (see, e.g., huston et Al ,"Protein Engineering of Antibody Binding Sites:Recovery of Specific Activity in an Anti-Digoxin Single-Chain Fv Analogue Produced in Escherichia coli,"Proc.Natl.Acad.Sci.USA85:5879-5883(1988)); and (8) VHH, "VHH" involves the variable antigen binding domain of heavy chain antibodies from camelidae (camelid, dromedary, llama, alpaca, etc.) (see, n.k. Et Al, 2000,The EMBO Journal,19, 921-930;Muyldermans S, 2001,J Biotechnol, 74, 277-302 and reviewed Vanlandschoot p. Et Al, 2011,Antiviral Research 92, 389-407). VHH, also known as Nanobody (Nb) and/or single domain antibodies).

In the present application, the term "single domain antibody" or "VHH" generally refers to a class of antibodies that lack the light chain but only the heavy chain variable region of the antibody. In some cases, the single domain antibody may be from a Bactrian camel, droctrian camel, alpaca, llama, nurse shark, dairy shark or ray (see, e.g., kang Xiaozhen et al, bioengineering journal, 2018, 34 (12): 1974-1984). For example, the single domain antibody may be from alpaca. Single domain antibodies may be composed of heavy chain variable regions (VH). The term "heavy chain variable region" generally refers to the amino terminal domain of the heavy chain of an antigen binding fragment. The heavy chain variable region can be further divided into hypervariable regions called Complementarity Determining Regions (CDRs) interspersed with regions that are more conserved as Framework Regions (FR). Each heavy chain variable region may be composed of three CDRs and four FR regions, which may be arranged from amino-terminus to carboxy-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3 and FR4. The heavy chain variable region contains a binding domain that interacts with an antigen.

In the present application, the term "single chain variable fragment" or "scFv" has its ordinary and conventional meaning and may include, for example, but is not limited to, fusion proteins comprising a heavy chain (VH) variable region and a light chain (VL) variable region of an immunoglobulin, which are linked to each other with a short linker peptide. Without limitation, the linker may comprise glycine (for flexibility) and a hydrophilic amino acid (e.g., serine or threonine) (for solubility). The linker may connect the N-terminus of the VH to the C-terminus of the VL, or may connect the C-terminus of the VH to the N-terminus of the VL. In some alternatives, the ligand binding domain present on the CAR is a single chain variable fragment (scFv). The CARs of the application may be constructed in VH-VL or VL-VH configurations with variations in the linker, hinge, transmembrane domain, co-stimulatory domain and/or conductive domain, and still retain their efficacy. In some embodiments, the scFv domain present on the CAR is specific for an IL-13 a 2 receptor (IL 13 ra 2) present on a tumor cell.

The CARs of the application may comprise linker residues between the individual domains added for proper spacing and conformation of the molecule, e.g., a linker comprising an amino acid sequence that connects the VH and VL domains and provides a spacer function compatible with the interaction of the two sub-binding domains such that the resulting polypeptide retains specific binding affinity for the same target molecule as an antibody comprising the same light and heavy chain variable regions. The CARs of the application may comprise one, two, three, four, or five or more linkers. In particular embodiments, the linker is about 1 to about 25 amino acids in length, about 5 to about 20 amino acids, or about 10 to about 20 amino acids in length, or any intervening length of amino acids. Illustrative examples of linkers include glycine polymers; glycine-serine polymer; glycine-alanine polymer; alanine-serine polymers; other flexible joints are known in the art, such as a Wheatstone joint. Glycine and glycine-serine polymers are relatively unstructured and therefore can act as neutral tethers between domains of fusion proteins (e.g., CARs of the application).

In the present application, the term "complementarity determining region" (CDR) generally refers to complementarity determining regions within the variable region of an antigen binding fragment. In the present application, there are 3 CDRs of the heavy chain variable region, which are designated HCDR1, HCDR2 and HCDR3 for each variable region. The exact boundaries of these CDRs have been defined differently from system to system. The system described by Kabat (Kabat et al, sequences of Proteins of Immunological Interest (National Institutes of Health, bethesda, md. (1987) and (1991)) provides not only a defined residue numbering system applicable to any variable region of an antigen binding fragment, but also precise residue boundaries defining 3 CDRs. 901-917 (1987) and Chothia et al, nature 342:877-883 (1989)) found that while having a large diversity at the amino acid sequence level, some of the subfractions within the Kabat CDRs adopt nearly identical peptide backbone conformations, these subfractions are designated L1, L2 and L3 or H1, H2 and H3, where "L" and "H" refer to the light and heavy chain regions, respectively.

In the present application, the term "FR" generally refers to the more highly conserved portion of an antibody variable domain, which is referred to as the framework region. For example, the variable domains of the natural heavy and light chains may each comprise four FR regions, namely four in VH (H-FR 1, HFR2, H-FR3 and H-FR 4), and four in VL (L-FR 1, L-FR2, L-FR3 and L-FR 4). "framework region" generally refers to the portion of an antibody variable region recognized in the art that exists between the more divergent (i.e., hypervariable) CDRs. Such framework regions are typically referred to as frameworks 1 to 4 (FR 1, FR2, FR3 and FR 4) and provide a framework for presenting six CDRs (three from the heavy chain and three from the light chain) in three-dimensional space to form an antigen binding surface.

In the present application, the term "homology" may be generally equivalent to the sequence "identity". Homologous sequences may include amino acid sequences that may be at least 80%, 85%, 90%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9% identical to the subject sequence. Typically, the homologue will comprise the same active site or the like as the subject amino acid sequence. Homology may be considered in terms of similarity (i.e., amino acid residues having similar chemical properties/functions), or homology may be expressed in terms of sequence identity. In the present application, a sequence of any one of the mentioned amino acid sequences or nucleotide sequences of SEQ ID NOs having a percent identity refers to a sequence having said percent identity over the entire length of the mentioned SEQ ID NOs.

To determine sequence identity, sequence alignments can be performed in a variety of ways known to those skilled in the art, e.g., using BLAST, BLAST-2, ALIGN, NEEDLE or Megalign (DNASTAR) software, etc. One skilled in the art can determine the appropriate parameters for alignment, including any algorithms needed to achieve optimal alignment in the compared full-length sequences.

In the present application, the term "KD" is used interchangeably with "KD" and generally refers to the dissociation equilibrium constant of a particular antibody-antigen interaction in M (mol/L). KD can be calculated from the concentration of substance AB and its dissociation to give substance a and substance B: kd=c (a) c (B)/c (AB). From this equation, the larger the KD value, the more dissociation, representing weaker affinity between species A, B; conversely, a smaller KD value indicates less dissociation, representing a stronger affinity between species A, B.

In the present application, the term "isolated nucleic acid molecule" generally refers to any length of isolated form of nucleotide, deoxyribonucleotide or ribonucleotide or analog thereof, either isolated from the natural environment or synthesized.

In the present application, the term "vector" generally refers to a nucleic acid molecule capable of self-replication in a suitable host, which transfers the inserted nucleic acid molecule into and/or between host cells. The vector may include a vector mainly used for inserting DNA or RNA into a cell, a vector mainly used for replicating DNA or RNA, and a vector mainly used for expression of transcription and/or translation of DNA or RNA. The carrier also includes a carrier having a plurality of functions as described above. The vector may be a polynucleotide capable of transcription and translation into a polypeptide when introduced into a suitable host cell. Typically, the vector will produce the desired expression product by culturing a suitable host cell comprising the vector.

In the present application, the term "viral vector" is used broadly to refer to a nucleic acid molecule (e.g., a transfer plasmid) or a viral particle that mediates nucleic acid transfer, including virus-derived nucleic acid elements that generally promote transfer or integration of a nucleic acid molecule into the genome of a cell. Viral particles typically include various viral components, and sometimes host cell components in addition to nucleic acids. A viral vector may refer to a virus or viral particle capable of transferring a nucleic acid into a cell, or the transferred nucleic acid itself.

In the present application, the term "lentivirus" generally refers to a group (or genus) of complex retroviruses. Exemplary lentiviruses include, but are not limited to: HIV (human immunodeficiency virus; including HIV type 1 and HIV type 2); weicina-Meidi virus (visnamaedivirus, VMV) virus; goat arthritis-encephalitis virus (CAEV); equine Infectious Anemia Virus (EIAV); feline Immunodeficiency Virus (FIV); bovine Immunodeficiency Virus (BIV); and Simian Immunodeficiency Virus (SIV). In one embodiment, an HIV-based vector backbone (i.e., HIV cis-acting sequence elements) is preferred. In particular embodiments, the lentivirus is used to deliver a polynucleotide comprising a CAR to a cell.

In the present application, the term "host cell" or "cell" generally refers to an individual cell, cell line or cell culture that may or has contained a vector comprising an isolated nucleic acid molecule of the application, or that is capable of expressing an isolated antigen binding fragment of the application. The host cell may comprise progeny of a single host cell. The daughter cells may not necessarily be identical in morphology or in genome to the original parent cells due to natural, accidental or deliberate mutation, but may be capable of expressing the isolated antigen-binding fragments of the present application. The host cell may be obtained by transfecting the cell in vitro using the vector of the present application. The host cell may be a prokaryotic cell (e.g., E.coli) or a eukaryotic cell (e.g., a yeast cell, such as COS cells, chinese Hamster Ovary (CHO) cells, heLa cells, HEK293 cells, COS-1 cells, NS0 cells, or myeloma cells). For example, the host cell may be an E.coli cell. For example, the host cell may be a yeast cell. For example, the host cell may be a mammalian cell. For example, the mammalian cell may be a CHO-K1 cell.

In the present application, the term "T cell" or "T lymphocyte" may be any T cell, such as a cultured T cell, e.g. a primary T cell, or a T cell from a cultured T cell line, e.g. Jurkat, supTI, etc., or a T cell obtained from a mammal (preferably a primate, species including monkey, dog or human). If obtained from a mammal, T cells may be obtained from a number of sources including, but not limited to, blood, bone marrow, lymph nodes, thymus, or other tissues or fluids. T cells may also be enriched or permeabilized. T cells may be obtained by maturation of hematopoietic stem cells into T cells in vitro or in vivo. In an exemplary aspect, the T cell is a human T cell. In an exemplary aspect, the T cell is a T cell isolated from a human. The T cells may be any type of T cell, including NKT cells, and may have any stage of development, including but not limited to cd4+/cd8+ double positive T cells; cda+ helper T cells; such as Th1 and Th2 cells, cd8+ T cells (e.g., cytotoxic T cells); peripheral Blood Mononuclear Cells (PBMCs); peripheral Blood Leukocytes (PBLs); tumor infiltrating cells (TIL); memory T cells; untreated T cells, and the like. Preferably, the T cells are cd8+ T cells or cd4+ T cells. In some alternatives, the T cells are allogeneic (from different donors of the same species) to the recipient cell or to the recipient subject to whom the cell is to be received (e.g., the cell is in the form of a therapeutic composition); in some alternatives, the T cells are autologous (donor and recipient identical); in some alternatives, the T cells are syngeneic (syngeneic) (donor and recipient are different, but syngeneic twins).

In the present application, the term "immune effector cell" generally refers to an immune cell involved in an immune response and functioning as an effector. For example, the effector function may include clearing foreign antigens or promoting immune effector responses, etc. Immune effector cells may include plasma cells, T cells, B cells, natural Killer (NK) cells, natural Killer T (NKT) cells, mast cells, and bone marrow-derived phagocytes.

The immune effector cells of the application may be autologous/autologous (autologous/autogeneic) ("autologous") or non-autologous ("non-autologous", e.g., allogeneic, syngeneic or xenogeneic). In the present application, the term "autologous" generally refers to cells from the same subject. "allogeneic" generally refers to cells of the same species but genetically different than that of the cell. "isogenic" generally refers to cells of different subjects that are genetically identical to the cells being compared. "allogeneic" generally refers to cells of a different species than the cells to which they are compared. In some embodiments, the cells of the application are autologous or allogeneic.

In the present application, the term "modification" generally refers to changing the state or structure of a cell and/or changing the state or structure of a cell. The alteration, which is typically a change in the level or function of endogenous gene expression compared to the state or structure of a corresponding cell that has not been modified, may include, for example, down-regulation, up-regulation, or non-expression of the endogenous gene expression level of the cell by genetic engineering means, which may include homologous recombination, CRISPR/Cas9 system gene editing, and the like; the alteration may also include a change in cellular protein expression, structure or function, such as a change in the expression of a corresponding protein by a change in the level or function of the endogenous gene, such as a change in protein expression, structure or function by modulating protein translation, post-translational modification; the alteration may also include introducing an exogenous gene, expressing an exogenous protein, and the like.

In the present application, the term "TRAC" generally refers to the T cell receptor alpha chain constant region (T cell receptor alpha constant). T Cell Receptors (TCRs) generally refer to specific receptors located on the surface of T cells that recognize antigens bound to Major Histocompatibility Complex (MHC) molecules. TCRs are typically composed of two distinct protein chains (i.e., heterodimers). In humans, TCRs in most T cells consist of an alpha chain and a beta chain (encoded by TRA and TRB, respectively), which are called αβ T cells, and in a few T cells, TCRs consist of gamma and delta chains (encoded by TRG and TRD, respectively), which are called γδ T cells. Typically, αβ T cells account for about 95% of the total T cells, γδ T cells account for about 5% of the total T cells, and the ratio varies during ontogenesis and in disease states (e.g., leukemia), and from species to species. Each chain constituting the TCR contains a variable region and a constant region, and in humans, the gene encoding the alpha chain (TRA, e.g., information shown in HGNC: 12027) is located on chromosome 14, and consists of a multiple gene fragment comprising a variable segment (V), a junction segment (J) and a constant region (C), TRAC gene generally refers to a gene sequence encoding the T cell receptor alpha chain constant region (C) (e.g., information shown in HGNC: 12029) located on chromosome 14 (14q11.2; 14:22,547,505-22,552,131). Typically 1 of the variable segment (V) genes encoding the N-segment antigen recognition domain rearranges with one of the junction segments (J) to produce a functional V region exon that is transcribed and joined to the constant region (C) by splicing, thereby forming the T cell receptor alpha chain coding sequence.

In the present application, the term "major histocompatibility complex antigen" ("MHC", also referred to as "human leukocyte antigen" ("HLA") in the case of humans) generally refers to a protein expressed on the surface of a cell that confers unique antigen identity to the cell. MHC/HLA antigens are target molecules recognized by T cells and NK cells as being derived from the same hematopoietic stem cell source ("self") as immune effector cells or as being derived from another hematopoietic reconstitution cell source ("non-self"). Two major classes of HLA antigens are identified: HLA class I and HLA class II. HLA class I antigens (A, B, C in humans) allow each cell to be recognized as "self", while HLA class II antigens (DR, DP and DQ in humans) are involved in the reaction between lymphocytes and antigen presenting cells. Both have been implicated in rejection of transplanted organs. An important aspect of the HLA gene system is its polymorphism. There are different alleles for each gene, MHC class I (A, B and C) and MHC class II (DP, DQ and DR). HLA alleles are indicated by numbers and subscripts. For example, two unrelated individuals might carry HLA class I-B genes B5 and Bw41, respectively. The allele products differ in one or more amino acids of the alpha and/or beta domains. A number of specific antibodies or nucleic acid reagents are used to genotype an individual with leukocytes expressing class I and class II molecules. Genes commonly used for HLA typing are six MHC class I and class II proteins, namely HLA-A; HLA-B and HLA-DR each have two alleles. HLA genes cluster in a "superlocus" present at chromosome position 6p21, which encodes 6 classical transplantation HLA genes and at least 132 protein-encoding genes that play an important role in the regulation of the immune system as well as some other essential molecules and cellular processes. The complete locus is roughly 3.6Mb with at least 224 loci. One effect of such clustering is "haplotype", i.e., a set of alleles present on a single chromosome that are inherited from one parent, tending to inherit as a set. A set of alleles inherited from each parent form a haplotype, with some alleles tending to be related together. Identifying patient haplotypes can help predict the probability of finding a matching donor and help formulate search strategies because some alleles and haplotypes are more common than others and they are distributed differently across different ethnicities and nations.

In the present application, "HLA-A" generally refers to a class of human leukocyte antigen (human leukocyte antigens) polypeptide chains encoded by the HLA-A gene (e.g., information as shown in HGNC: 4931) located on human chromosome 6p21.3. HLA-A is one of three major polypeptide types constituting human cell surface class I MHC molecules, others also include HLA-B and HLA-C. The heterodimer consisting of the alpha chain encoded by the HLA-A gene and the beta chain (beta 2-microglobulin) encoded by the B2M gene is HLAA class MHC I molecule. The alpha chain encoded by the HLA-A gene may comprise an alpha 1 domain, an alpha 2 domain, an alpha 3 domain, a transmembrane region, and a cytoplasmic region, wherein the alpha 1 domain, the alpha 2 domain may bind to a peptide fragment for presentation of the peptide fragment to an immune system cell by an MHC I molecule (e.g., HLA-A). In humans, like most mammals, the α chain of MHC I molecules is polymorphic, with major changes in primary structure, and by 2013, there are 2432 known HLA-A alleles encoding 1740 active proteins and 117 inactive proteins. In the present application, the HLA-A alleles may include sequence information for the different HLA-A alleles named by the WHO HLA factor naming Committee, as documented by the IMGT/HLA database, 3.38.0 edition (https:// www.ebi.ac.uk/ipd/IMGT/HLa /).

In the present application, the term "HLA-B" generally refers to a portion of the gene family of the Human Leukocyte Antigen (HLA) complex. HLA is a human version of the Major Histocompatibility Complex (MHC), a family of genes found in many species. The complex genes are divided into three basic groups: class I, class II and class III. In humans, HLA-B genes and two related genes HLA-A and HLA-C are the major genes of MHC class I. The HLA-B gene is located in cell band 21.3 of chromosome 6 short (p) arm, from base pair 31,353,871 to 31,357,211.HLA-B is one of three major HLAs that should be matched between donor and recipient. They are HLA-A, HLA-B (both MHC class I) and HLA-DR (MHC class II). If the two tissues have the same genes encoding the three HLAs, the likelihood and severity of rejection is minimized. Hundreds of versions (alleles) of HLA-B are known, each with a specific number (e.g., HLAB. Sup.27). Closely related alleles are grouped together; for example, at least 28 very similar alleles are subtypes HLAB 27. These subtypes are designated as HLA-B2701 to HLA-B2728.

In the present application, the term "HLA-matched" refers to a donor-recipient pair in which there is no mismatch in HLA antigens between a donor, such as a donor that provides a hematopoietic stem cell graft to a recipient in need of hematopoietic stem cell transplantation therapy. HLA-matched (i.e., where all 6 alleles are matched) donor-recipient pairs have a reduced risk of graft rejection, as endogenous T cells and NK cells are less likely to recognize the incoming graft as foreign and are therefore less likely to generate an immune response against the graft.

In the present application, the term "HLA-mismatched" refers to a donor-recipient pair in which at least one HLA antigen (particularly for HLA-a, HLA-B, and HLA-DR) is mismatched between a donor and a recipient, such as a donor that provides a hematopoietic stem cell graft to a recipient in need of hematopoietic stem cell transplantation therapy. In some embodiments, one haplotype is matched and the other is unmatched. HLA-mismatched donor-recipient pairs may have an increased risk of graft rejection relative to HLA-matched donor-recipient pairs, because in the case of HLA-mismatched donor-recipient pairs, endogenous T cells and NK cells are more likely to recognize the incoming graft as foreign, and such T cells and NK cells are therefore more likely to generate an immune response against the graft.

In the present application, the term "B2M" generally refers to β2 microglobulin (β2-microglobulin), which is one of the components of MHC class I molecules. Beta 2 microglobulin (also referred to as beta chain) may constitute MHC class I molecules with HLA-encoded alpha chains.

B2M is typically expressed in cells of all nuclei. In humans, the β2 microglobulin is encoded by the B2M gene located at 15q21.1 (e.g., the information shown in HGNC: 914).

In the present application, the term "CIITA" generally refers to a transactivator of the major histocompatibility complex class ii (MHC ii). The transactivator may be a protein having an acidic transcriptional activation domain, 4 LRRs (leucine rich repeats) and a GTP binding domain. The proteins may be located in the nucleus as positive regulators of transcription of class II major histocompatibility complex (MHC II) genes, known as "master control factors" for expression of these genes. The protein can also bind GTP and utilize binding to GTP to transport itself into the nucleus where it generally acts in a coactivator-like manner by Acetyltransferase (AT) activity. In humans, the protein is encoded by a gene located at 16p13.13 (e.g. the information shown in HGNC: 7067) and is capable of producing several transcript variants encoding different isoforms.

In the present application, the term "wild-type cell" generally refers to a cell that is naturally occurring or of natural origin.

In the present application, the term "nucleic acid" or "polynucleotide" or "nucleic acid molecule" refers generally to deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) and polymers thereof in single-stranded or double-stranded form. Unless specifically limited, the term may include nucleic acids comprising analogs of natural nucleotides that have similar binding properties as the reference nucleic acid (e.g., sequence information is shown) and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise indicated, the sequence of a nucleic acid may include variants thereof that are conservatively modified, such as degenerate codon substitutions, alleles, orthologs, SNPs, and complementary sequences, as well as the sequences explicitly indicated.

In the present application, the term "expression" generally refers to transcription and/or translation of a particular nucleotide sequence.

In the present application, the term "gene mutation" generally refers to a change in the base pair composition or arrangement order of a gene occurring structurally. Such as point mutations caused by single base changes, or deletions, duplications, insertions of multiple bases, etc.

In the present application, the term "gene silencing" generally refers to the prevention of expression of certain genes by regulatory mechanisms. Two main categories can be included: one is gene silencing at the transcriptional level due to factors such as DNA methylation, heterochromatin and positional effects (transcriptional GENE SILENCING, TGS), the other is post-transcriptional gene silencing (post-transcriptional GENE SILENCING, PTGS), i.e. the expression of genes is affected at the post-transcriptional level by specific intervention on the target RNA. Typically when a gene is silenced, the corresponding gene expression is down-regulated/reduced. And when a gene is knocked out, it usually appears that it is not expressed, for example, in a cell, all alleles of a particular gene are knocked out, and the expression of the gene is lost. Gene silencing is generally considered to be a mechanism of gene knockdown, and methods commonly used to silence genes can be, for example, RNAi.

In the present application, the term "endogenous" refers to any substance from or produced within an organism, cell, tissue or system.

In the present application, the term "exogenous" refers to any substance introduced from outside the organism, cell, tissue or system or produced outside thereof.

In the present application, the term "antisense RNA" generally refers to a single-stranded RNA complementary to the mRNA (messenger RNA) of the transcription product. Antisense RNA can inhibit gene expression by binding to mRNA. For example, binding of antisense RNA to target mRNA causes increased sensitivity of the double stranded RNA molecule to RNase III, which degrades it; for example, antisense RNA binds to an upstream non-coding region of mRNA, thereby directly inhibiting translation of the target mRNA. In the present application, the term "siRNA" generally refers to the abbreviation SMALL INTERFERING RNA (small interfering RNA) or short INTERFERING RNA (short interfering RNA). siRNA is a double-stranded, non-coding RNA molecule of about 18-28 base pairs in length that can interfere with expression of a particular gene by causing degradation of mRNA through complementary binding to mRNA. In certain embodiments, the siRNA may be a long double stranded RNA or a product of shRNA treatment with Dicer enzyme. In certain embodiments, the siRNA enters the cell to form an RNA-induced silencing complex (RISC) with other proteins, the sense strand degrades, and the antisense strand can bind to a complementary targeting sequence, thereby effecting gene silencing.

In the present application, the term "shRNA" generally refers to the abbreviation of short HAIRPIN RNA, i.e. "short hairpin RNA". shRNA typically comprises two short inverted repeats, separated by a stem-loop (loop) sequence, constituting a hairpin structure. Usually 5-6T bases can also be included as transcription terminators for RNA polymerase III. In certain embodiments, shRNA may be introduced into cells via viral vectors or plasmids, transcribed by polymerase ii or iii, and the transcripts exported from the nucleus (typically via Exportin) and processed by Dicer and delivered to RISC, where the sense strand degrades and the antisense strand may bind to a complementary targeting sequence, thereby effecting gene silencing.

In the present application, the term "CRISPR/Cas system" generally refers to a set of molecules comprising an RNA-guided nuclease or other effector molecule and a gRNA molecule capable of directing and effecting modification of a nucleic acid at a target sequence by the RNA-guided nuclease or other effector molecule, e.g., causing degradation of the target sequence. In certain embodiments, the CRISPR system comprises a gRNA and a Cas protein, e.g., a Cas9 protein. The system comprising Cas9 or a functional mutant thereof is referred to herein as a "Cas9 system" or a "CRISPR/Cas9 system". In certain embodiments, the gRNA molecule and the Cas molecule can complex to form a Ribonucleoprotein (RNP) complex.

In the present application, the terms "gRNA molecule" or "guide RNA", "guide RNA molecule", "gRNA" are used interchangeably and generally refer to a nucleic acid molecule capable of promoting specific guide RNA-guided nucleases or other effector molecules (typically complexed with a gRNA molecule) onto a target sequence. In certain embodiments, the directing is achieved by hybridization of a portion of the gRNA to DNA (e.g., by a gRNA guide domain) and binding of a portion of the gRNA molecule to an RNA-guided nuclease or other effector molecule (e.g., at least by GRNATRACR). In certain embodiments, the gRNA molecule consists of a single, contiguous polynucleotide molecule, referred to herein as a "single guide RNA" or "sgRNA" or the like. In other embodiments, the gRNA molecule consists of multiple (e.g., two) polynucleotide molecules that are themselves capable of associating (typically by hybridization), referred to herein as "dual guide RNAs" or "dgRNA" or the like.

In the present application, the term "Cas protein" generally refers to the enzyme responsible for cleaving DNA in a CRISPR/Cas system. Enzymes from type I, II, III CRISPR/Cas systems can be included. For example, cas3, cas9, cas10.

In the present application, the term "Cas9 protein" generally refers to an enzyme from bacterial type II CRISPR/Cas system responsible for cleaving DNA. Cas9 may include wild-type proteins and functional mutants thereof.

In the present application, the term "allele" generally refers to a form of different variation that a gene sequence at a locus may have. A locus, also referred to as a genetic locus or site, refers to a fixed location on a chromosome, for example, where a gene is located. The arrangement of loci in the genome is called a genetic map (GENETIC MAP).

In the present application, the term "homozygote" generally refers to an individual of the same genotype with two alleles of a homologous chromosome at the same locus. A pair of opposing genes may have individuals of both AA and AA genotypes.

In the present application, the term "heterozygote" generally refers to an individual of a genotype, such as Aa, in which the two alleles at the same position on a homologous chromosome in a diploid. Heterozygous genotypes are generally more adaptable than either homozygous dominant or homozygous recessive genotypes, a phenomenon known as heterozygous dominance.

In the present application, the terms "tumor" and "cancer" are used interchangeably and generally refer to a disease characterized by rapid and uncontrolled growth of abnormal cells. Cancer cells may spread to other parts of the body locally or through the blood stream and lymphatic system. Examples of various cancers are described herein and include, but are not limited to, breast cancer, prostate cancer, ovarian cancer, cervical cancer, skin cancer, pancreatic cancer, colorectal cancer, renal cancer, liver cancer, brain cancer, lymphoma, leukemia, lung cancer, and the like. The term "cancer" or "tumor" includes premalignant as well as malignant cancers and tumors, as well as solid tumors and non-solid tumors. High levels of interleukin 13 receptor alpha 2 (IL-13 ra 2) are found on many cancer cells, including pancreatic, breast and ovarian cancers, or glioblastomas, such as glioblastomas. IL-13Rα2 can also be overexpressed in the vast majority of human patients with high-grade astrocytomas (see PLoS one.2013Oct 16;8 (10): e77719; expressly incorporated herein by reference in its entirety). Furthermore, decreasing the amount of IL13RA2 expression in cancer cells significantly slowed tumor growth in the model (Breast CANCER RESEARCH,2015;17 (1); expressly incorporated herein by reference in its entirety). Very few types of normal tissues are expected to express IL13ra2, and in such cases only at low levels. In the case of glioblastoma multiforme (GBM), high expression of IL13ra2 can be a prognostic marker for tumor progression and poor patient survival.

In the present application, the term "pharmaceutically acceptable" generally refers to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.

In the present application, the term "pharmaceutically acceptable carrier" generally refers to any of those carriers conventionally used, and is limited only by physical-chemical considerations (such as solubility and lack of reactivity with active binders), and by the route of administration. Pharmaceutically acceptable carriers, such as vehicles, adjuvants, excipients and diluents described herein are well known to those skilled in the art and are readily available to the public. In one aspect, the pharmaceutically acceptable carrier is a carrier that is chemically inert to the active ingredient of the pharmaceutical composition and is a carrier that does not have adverse side effects or toxicity under the conditions of use. In some embodiments, the carrier does not produce an adverse, allergic, or other untoward reaction when administered to an animal or human. In some aspects, the pharmaceutical composition is free of pyrogens and other impurities that may be harmful to humans or animals. Pharmaceutically acceptable carriers include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like; the use thereof is well known in the art.

Acceptable carriers, excipients, or stabilizers are non-toxic to the recipient and are preferably inert at the dosage and concentration employed, and include buffers such as phosphate, citrate, or other organic acids; antioxidants such as ascorbic acid; a low molecular weight polypeptide; proteins, such as serum albumin, gelatin or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salts form counterions, such as sodium; and/or nonionic surfactants such as Tween, pluronics or polyethylene glycol (PEG).

In the present application, the term "effective amount" or "effective dose" generally refers to an amount sufficient to achieve or at least partially achieve the desired effect. A "therapeutically effective amount" or "therapeutically effective dose" of a drug or therapeutic agent is generally any amount of drug that, when used alone or in combination with another therapeutic agent, promotes regression of the disease (as evidenced by a decrease in severity of symptoms of the disease, an increase in the frequency and duration of disease asymptomatic periods, or prevention of damage or disability due to the disease).

A "therapeutically effective amount" or "effective amount" of an anti-IL-13Rα2CAR-T cell is also an amount or dose of any toxic or detrimental effect, e.g., CRS, of the anti-IL-13Rα2CAR-T cell that is therapeutically beneficial. The term "therapeutically effective amount" encompasses an amount effective to "treat" a subject (e.g., a patient). In one embodiment, the therapeutically effective dose is the Minimum Effective Dose (MED) of anti-IL-13 Rα2CAR-T cells for treating a brain tumor in a subject. In one embodiment, the therapeutically effective dose is the Maximum Tolerated Dose (MTD) of anti-IL-13 ra 2CAR-T cells that does not result in unresolved CRS in the subject.

In the present application, the term "up-regulation of expression" generally refers to an increase in the expression of the mRNA level of a nucleic acid or an increase in the expression of the polypeptide level. The term may also relate to post-translational modifications required for increased polypeptide activity and/or function, e.g., addition of sugar moieties, phosphorylation, etc.

In the present application, the term "comprising" generally means containing, summarizing, containing or comprising. In some cases, the meaning of "as", "consisting of … …" is also indicated.

In the present application, the term "about" generally means ranging from 0.5% to 10% above or below the specified value, e.g., ranging from 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, or 10% above or below the specified value.

In the present application, the term "subject" generally refers to a human or non-human animal, including but not limited to cats, dogs, horses, pigs, cows, sheep, rabbits, mice, rats or monkeys, etc.

Examples

The materials used in the test and the test methods are described generally and/or specifically in the examples which follow,% represents wt%, i.e. weight percent, unless otherwise specified. The reagents or apparatus used were conventional reagent products commercially available without the manufacturer's knowledge.

EXAMPLE 1 screening of IL13Rα2-targeting monoclonal antibody hybridoma cell lines preparation of mouse ascites containing the corresponding antibody

1.1 First immunization: 30ug of immunogen was mixed homogeneously with the corresponding volume of Freund's complete adjuvant and injected subcutaneously at multiple points.

1.2 2 Nd-3 rd booster immunizations: mixing Freund's incomplete adjuvant with corresponding volume of 30ug protein, subcutaneously injecting at multiple points, and immunizing for 14 days.

1.3 At 7 days post 3 rd immunization, tail vein blood was taken to detect serum antibody titers, and mice with highest titers were selected for fusion.

1.4 Impact immunization 3 days prior to fusion: 100ug of the immunogen solution was injected into the abdominal cavity of the mice.

1.5 Spleen cells and myeloma cells SP2/0 of the mice were taken at a ratio of 10:1 ratio, and selection culture by HAT screening medium.

1.6 Inoculating the hybridoma into the mouse, culturing for several days, taking ascites from the mouse, and performing ELASE

1.7 Antigen was coated on ELISA plates in carbonate buffer at pH 9.6, 25 ng/well, overnight at 4 ℃.5% milk-PBST blocking solution was used overnight at 4 ℃.

1.8 Ascites, 30 ul/well, 1% milk-PBST blocking solution was added to 100 ul/well and incubated for 1 hour at 37 ℃. Washing with running water for 5 times, and beating on a towel for 6 times.

1.9 Adding the prepared TMB color developing solution, adding the TMB color developing solution into an ELISA plate, developing the color at 100 mu L/hole, standing at 37 ℃ for 15 minutes, taking out, and adding a stop reaction solution.

1.10 Detection with a microplate reader, selection of 450nm wavelength, and final screening of 34 antibody titers as shown in Table 1.

TABLE 1 ELISA results for 34 ascites

Example 2 flow assay of ascites fluid containing specific antibodies binding to target cells

2.1 Culturing U251 cells to log phase of growth.

2.2 Cells were divided into several parts, each cell number 5X 10 ⁵.

2.3 Screening 9 ascites fluids from example 1 were incubated with cells, respectively.

2.4 500G room temperature centrifugation for 5 minutes, discard supernatant, use PBS washing cells 3 times.

2.5 1. Mu.L of FITC-labeled anti-mouse IgG antibody was added, mixed and incubated at room temperature for 30 minutes in the dark.

2.6 500G room temperature centrifugation for 5 minutes, discard supernatant, use PBS washing cells 3 times.

2.7 Flow assays were performed using 500. Mu.L of resuspended cells.

The experimental results are shown in FIG. 1.

Example 3 flow-detection of purified antibodies binding to target cells

The antibodies in ascites in example 2 were purified and then subjected to flow assay.

3.1 Antibody purification column packing Protein G packing 1mL

3.2 Ascites containing antibody and equal volume of binding buffer mix

3.3 Centrifuging at 12000rpm and 4 ℃ for 10min, and taking the supernatant after centrifuging.

3.4 During ascites treatment, the Protein G column was removed, equilibrated for 5min at room temperature, and then equilibrated with binding buffer 10 column volumes.

3.5 After binding buffer flows out, covering a small Huang Gai at the bottom of the Protein G column, sucking the treated ascites by using a 1mL pipetting gun, slowly adding the ascites into the Protein G column, covering a cover at the top end of the Protein G column, sealing by using a sealing film, and uniformly mixing by rotating at room temperature for 1h.

3.6, Firstly opening the top cover, then opening the bottom small Huang Gai, collecting the flowing liquid into a 15mL centrifuge tube which is put in advance, marking the ascites number and date on the tube wall, and remarking "flow through".

3.7Washing buffer Man Zhu (about 10 column volumes), the column was washed 3 times.

3.8 Preparation of 5mL EP tubes 1, labeling of ascites number, purification date, and finally addition of 150. Mu.L of 1M Tris-HCl (pH 9.0) and 300. Mu.L of antibody protection solution for purification while washing the column.

3.9 After the washing buffer was drained, 500. Mu. L0.1M pH3.0 glycine solution was added to the Protein G small column (1 mL of the packing) to carry out the column top, and 3mL of 0.1M pH3.0 glycine solution was added after the drainage to carry out the elution and collection

3.10 Cells U251 in log-log phase were taken.

3.11 Cells were divided into several parts, each cell number 5X 10 ⁵.

3.12 Incubation with cells using purified 9 antibodies, respectively.

3.13 500G room temperature centrifugation for 5 minutes, discard supernatant, use PBS washing cells 3 times.

3.14 1. Mu.L of FITC-labeled anti-mouse IgG antibody was added, mixed well and incubated at room temperature for 30 minutes in the dark.

3.15 500G room temperature centrifugation for 5 minutes, discard supernatant, use PBS washing cells 3 times.

3.16 Flow assays were performed using 500. Mu.L of resuspended cells.

The experimental results are shown in FIG. 2.

Example 4 confirmation of antibody sequences by sequencing

The monoclonal hybridoma cells corresponding to the 9 antibodies in example 3 were selected and sequenced to obtain the 9 antibodies (3L21,3E3,4N14,4M2,1C15,4B1,1O19,1B22,4H1) of the present application, which were analyzed according to IMGT system, and the corresponding sequencing work was carried out by the company of the blumea-specific medicine science (Shanghai).

EXAMPLE 5 preparation of Single chain antibodies

The antibody sequence obtained in example 4 was constructed as a single chain antibody having a structure of signal peptide-light chain-connecting region-heavy chain-Fc segment (source human IGG 1), and the DNA sequence was codon-optimized to improve yield. The specific sequence is shown in SEQ ID No. 167-175.

Example 6 SPR detection of antibody affinity

IL13R alpha 2-Fc recombinant protein was immobilized on a CM5 chip using 10mM acetate buffer, and the binding ability of the antibodies obtained by screening to BCMA-Fc recombinant protein was examined using the single-chain antibodies in example 5 as mobile phase, respectively.

6.1 Reagent configuration

Running the reagent: 10mM N- (2-hydroxyethyl) piperazine-N-2 sulfonic acid (HEPES), 150mM sodium chloride (NaCl), 3mM ethylenediamine tetraacetic acid (EDTA), 0.005% Tween-20 (Tween-20), and pH was adjusted to 7.4.

A human IgG (Fc) capture kit comprising: mouse anti-human IgG (Fc) antibody, fixative reagent (sodium acetate, ph 5.0), rejuvenating reagent (magnesium chloride).

An amino coupling kit comprising: n-hydroxysuccinimide (NHS), 1-ethyl- (3-dimethylaminopropyl) carbodiimide hydrochloride (EDC) and ethanolamine (pH 8.5). 10mL of deionized water is added into each tube of EDC and NHS respectively, and the mixture is packaged and stored to the temperature of minus 18 ℃ to lower temperature, and the shelf life is two months.

6.2 Chip preparation

The murine anti-human IgG (Fc) antibody was diluted with an immobilization reagent (sodium acetate, pH 5.0), and 950 μl of the immobilization reagent was added to 50 μl of the murine anti-human IgG (Fc) antibody for immobilization of the eight channels. First, the surface of the CM5 chip was activated with EDC and NHS at a flow rate of 10. Mu.L/min for 360 s. Next, a murine anti-human IgG (Fc) antibody was injected into the channel (channel 1-8, fc1, 2) at a flow rate of 10. Mu.L/min for about 360s in a fixed amount of about 7000 to 14000RU. Finally, the chip was blocked with ethanolamine at 10. Mu.L/min for 420 s.

6.3 Buffer replacement

The human IL13Ra2 protein is subjected to buffer replacement by using a desalting column and a corresponding running reagent, and the concentration of the replaced sample is measured.

6.4 Capture antibodies

Antibodies were diluted to 10 μg/mL with running reagent and injected into a human IgG (Fc) capture experimental channel (Fc 2) at a flow rate of 10 μl/min at about 300RU. The reference channel (Fc 1) does not require capture of the ligand.

6.5 Analyte Multi-cycle analysis

Human IL13Ra2 protein was diluted 2-fold with running reagent. The diluted human IL13Ra2 protein is sequentially injected into the experimental channel and the reference channel at a flow rate of 30 mu L/min, and is combined and dissociated for corresponding time. The binding dissociation steps are all performed in running reagents. After each concentration analysis, the chip was regenerated with magnesium chloride at a flow rate of 20. Mu.L/min for 30s, washing off the ligand and undissociated analyte. The experimental channel needs to recapture the same amount of ligand for the next concentration analysis.

6.6. Data analysis

KD values were calculated for each sample using Biacore 8K analysis software Biacore Insight Evaluation Software. The reference channel (Fc 1) was used for background subtraction.

As shown in Table 2 and FIG. 3, the IL13Ra2 antibodies of the present application all have good affinity with human IL13Ra2 protein.

Table 2 SPR detection of affinity of nine antibodies

Example 7 design of anti-IL 13Rα2 Chimeric Antigen Receptor (CAR)

The anti-IL 13 ra 2CAR (murine) structure includes: an IL13Rα2 antigen binding region (derived from the anti-IL 13Rα2 murine monoclonal antibody Scfv), a CD8A extracellular hinge region, a CD8A transmembrane region, a 4-1BB intracellular co-stimulatory domain and a CD3 zeta activating signal domain. The DNA sequence is shown as SEQ ID No. 308-316, and the amino acid sequence is shown as SEQ ID No. 299-307.

EXAMPLE 8 lentiviral vector construction of anti-IL 13Rα2CAR

And constructing an IL13R alpha 2CAR lentiviral expression vector according to the IL13R alpha 2 sequence information and the CAR vector structure. And (3) optimizing: the commercial lentivirus expression vector pCDH-CMV-MCS-EF1-copGFP is selected as a framework, and element modification is performed on the basis of the vector. First, the ampicillin resistance gene β -lactamase of the vector was replaced with an aminoglycoside phosphotransferase derived from Tn5, rendering the vector kanamycin resistant. Second, we deleted the CMV promoter and its adjacent downstream multiple cloning sites that are potentially threatening in vivo applications. Finally, the copGFP gene which is expressed by the EF1 promoter in the original vector is deleted, a SalI enzyme cutting site is reserved, and a SmaI enzyme cutting site is added at the 5' end of the SalI for constructing the vector, so that the final target vector is formed. The added SmaI cleavage site is a single cleavage site of the final target vector, and other sequence parts of the vector do not have the cleavage site. After optimization, constructing a chimeric antigen receptor lentivirus expression vector, and after the sequence is confirmed to be correct by sanger sequencing, carrying out lentivirus packaging. The correspondence between the carrier names and the antibody names is shown in Table 3.

TABLE 3 lentiviral vector name and antibody name correspondence for anti-IL 13Rα2CAR

Antibody name	Lentiviral vector name
		3E3	MK015-A
4N14	MK016-A
		3L21	MK018-A
4M2	MK020-A
		1C15	MK021-A
4B1	MK023-A
		1O19	MK024-A
1B22	MK025-A
		4H1	MK026-A

Example 9 lentiviral preparation and infection of 293T cells to verify if CAR protein can be expressed normally

Expression testing in 293T cells using MK016-A, MK020-A, MK021-A, MK024-A, MK025-A, MK018-A

9.1 Cell plating was performed the day before transfection and 293T cell density was controlled to be between 60% and 70% the next day.

9.2 The following day after mixing the plasmid required for lentiviral packaging with transfection reagent, adding into 293T culture system, and replacing fresh medium after 6 h.

9.3 After 48 hours, the virus-containing supernatant medium was collected and subjected to filtration and ultracentrifugation to concentrate the lentivirus, frozen at-80 ℃ for subsequent use.

9.4 Expression of CAR protein was examined in a flow-through manner after 293T cells were infected with the concentrated lentivirus, and the specific results are shown in FIG. 4.

EXAMPLE 10 lentiviral transfected T cells test whether CAR protein was normally expressed

Expression testing in T cells using MK020-A, MK021-A

10.1 Activation of T cells using CD3CD28 magnetic beads the day before transfection, incubation at 37℃with 5% CO ₂.

Transviral: 24 hours after activation of the beads.

10.2 The following day the lentiviruses obtained in example 9 were added with an appropriate volume of virus according to the corresponding MOI, centrifuged at room temperature, and incubated at 37℃in 5% CO ₂ for 24h after centrifugation.

10.3, Centrifugally changing the liquid, adjusting the density of the T cells and continuously culturing.

10.4T cells were transfected for 5 days and the expression of CAR proteins was checked in a flow-through manner. The specific results are shown in FIG. 5.

EXAMPLE 11 preparation of Targeted IL13Rα2UCAR-T

The application provides an IL13Rα2UCAR-T cell with higher safety, which is mainly characterized by two strategies:

First donor source screening strategy: first, donor sources are based on HLA-A and/or HLA-B homozygotes in a population, one of the alleles of patient HLA-A or HLA-B is identical to the donor HLA-A or HLA-B homozygote, and cells derived from these donors can cover a high number of patient populations. Reduce rejection caused by HLA-A and/or HLA-B subtype inconsistencies. HLA-A selects the higher frequency homozygote A.02, homozygote A.11, homozygote A.02/A.11 and homozygote A.24 in the population. HLA-B is mainly selected from higher frequency B.sub.40 homozygote, B.sub.15 homozygote, B.sub.46 homozygote, B.sub.13 homozygote, B.sub.51 homozygote, B.sub.58 homozygote, B.sub.07 homozygote, B.sub.35 homozygote, B.sub.44 homozygote, B.sub.52 homozygote, B.sub.57 homozygote, B.sub.54 homozygote, and B.sub.55 homozygote in a population.

Second knockout strategy: the HLA-A and/or HLA-B molecules with high correlation with TCR and rejection are knocked out, other HLA-I molecules are reserved, rejection of allogeneic cells is reduced, the occurrence that HLA molecules are completely knocked out and cleared by NK cells is avoided, and the half life of allogeneic CAR-T cells in vivo is greatly prolonged. Simultaneous TCR knockout can reduce GVHD response from allogeneic cell therapy. The TCR gene selects the gene TRAC encoding TCR alpha chain, HLA-A selects the higher frequency homozygote A.times.02, homozygote A.times.11 and A.times.02/A.11 heterozygote in the population, HLA-B selects the higher frequency homozygote B.times.40 and homozygote B.times.46 in the population.

EXAMPLE 12 preparation method of targeting IL13Rα2UCAR-T and CAR-T cells

12.1 Preparation of TRAC, HLA-A double knocked IL13Rα2-specific UCAR-T cells

And collecting peripheral blood of healthy people, performing HLA typing detection, and selecting typing meeting the needs of people.

PBMC isolation: transferring blood in a blood collection tube or a blood collection bag into a 50mL centrifuge tube, centrifuging, discarding upper plasma, adding an equal volume of PBS into a lower blood cell layer, uniformly mixing, then sucking the mixed solution, slowly adding into the centrifuge tube filled with lymphocyte separation liquid, and DPBS: blood: lymphocyte isolate = 1:1:1, taking a white membrane layer after centrifugation, centrifugally washing with PBS, diluting and counting, and reserving 1X 10 ⁶ cells to be placed in an EP tube for flow detection.

Freezing PBMC: and determining whether to freeze according to the actual situation.

Cd3+ T cell sorting: re-suspending cells by using a certain amount of buffer, uniformly mixing, adding CD3 magnetic beads into 20 mu L of CD3 magnetic beads/10 ⁷ cells, uniformly mixing, then placing in a refrigerator at 4 degrees for incubation, adding buffer to wash cells and centrifuging, re-suspending cells for magnetic bead separation, firstly placing column on a magnetic pole, placing a centrifuge tube corresponding to the lower side, and infiltrating column (LS) by using buffer; adding cells onto column without generating bubbles, cleaning column with buffer for 3 times, taking down column, and placing into clean 15mL centrifuge tube to collect CD3+ T cells; the buffer was pipetted onto column and CD 3-labeled cells were eluted by piston pushing and part of the cells were counted.

CD3CD28 bead activation: cells were resuspended at a density of 1X 10 ⁶/mL according to the cell count, and an activating reagent was prepared and added to the whole medium (containing cytokines IL2, IL7, IL 15) to fully resuspend the cells, and incubated at 37℃with 5% CO ₂.

Transviral: 24 hours after activation of the magnetic beads, the lentivirus obtained in example 9 was added according to the MOI of IL13Rα2 virus, centrifuged at room temperature, and incubated at 37℃in 5% CO ₂ for 24 hours after centrifugation.

Gene knockout: after sampling and counting, cells were collected and centrifuged, cell pellet was resuspended in PBS and prepared for electrotransfer buffer: nucleofector Solution: the support is configured according to 82:18; partitioning RNP complex (Cas 9: sgrna=2:1) was performed using 1×10 ⁷ cells per electrotransformation system, electrotransformation was performed, cells were harvested 48 hours after electrotransformation, sanger sequencing detected editing efficiency, while harvest FACS detected knockdown efficiency,

Wherein the sgRNA sequence TRAC sgRNA：AGAGUCUCUCAGCUGGUACA(SEQ ID No:317),A02 sgRNA(HLa-a02sg5)：CUGACCAUGAAGCCACCCUG(SEQ ID No:334),A11 sgRNA(HLa-a11 sg21)：

GGCCCCUCCUGCUCUAUCCA(SEQ ID No:364)

CD3 negative T cell sorting: sorting CD3 negative T cells, centrifuging after cell counting, and discarding the supernatant; the cells are resuspended by buffer and evenly mixed, 20 mu L of CD3 magnetic beads/10 ⁷ cells are added with CD3 magnetic beads, after being evenly mixed, the mixture is put into a 4-DEG refrigerator for incubation, the buffer is added for washing the cells, the magnetic beads are separated after centrifugation, the column is firstly put on a magnetic pole, a centrifuge tube is correspondingly put below, the column (LD) is infiltrated by the buffer, the cells are added on the column without generating bubbles, the buffer is used for washing the column for 2 times, the washed liquid (CD 3-T cells) is collected in a 15ml centrifuge tube, and part of the cells are taken for cell counting.

Cell culture: observing cell state under a mirror, taking cells for dilution and counting, supplementing a whole culture medium to maintain the cell density at 3×10 ⁵-1×10⁶/mL, supplementing/changing liquid in the middle, and culturing at 37 ℃ in 5% CO ₂. Cell harvesting: collecting the cells in a cell centrifuge tube, centrifuging, washing the cells again with normal saline, centrifuging to prepare frozen solution, re-suspending the centrifuged cells, sucking the cell suspension into a cell freezing bag for final products by using a syringe, and labeling the cell freezing bag for the next freezing.

12.2 Preparation of TRAC, HLA-B double knocked IL13Rα2-specific UCAR-T cells

The preparation procedure is the same as 12.1, except that the used HLA-A gene knockout sgRNA is replaced with HLA-B sgRNA, HLA-B40 Sg6:5-CAUGUCCCGGCCCGGCCGCG-3 (SEQ ID No: 373).

12.3 Preparation of TRAC, HLA-A and HLA-B triple-knocked IL13Rα2-specific UCAR-T cells

The procedure is the same as in example 12.1, except that the used HLA-A knockdown sgRNA is replaced with an equal mixture of HLA-AsgRNA and HLA-B sgRNA.

12.4 Preparation of autologous IL13Rα2-specific CAR-T cells

The preparation procedure was the same as in example 12.1, with the gene knockout and CD3 negative T cell sorting steps removed. The specific method comprises the following steps:

PBMC isolation: transferring blood in a blood collection tube or a blood collection bag into a 50ml centrifuge tube, centrifuging, discarding upper plasma, adding an equal volume of PBS into a lower blood cell layer, uniformly mixing, then sucking the mixed solution, slowly adding into the centrifuge tube filled with lymphocyte separation liquid, and DPBS: blood: lymphocyte isolate = 1:1:1, centrifuging, taking a white membrane layer, centrifuging and washing by using PBS, diluting and counting, and reserving 1x 10-class 6 cells to put into an EP tube for flow detection.

Cd3+ T cell sorting: re-suspending cells by using a certain amount of buffer, uniformly mixing, adding CD3 magnetic beads into 20 mu L of CD3 magnetic beads/10 ⁷ cells, uniformly mixing, then placing in a refrigerator at 4 degrees for incubation, adding buffer to wash cells and centrifuging, re-suspending cells for magnetic bead separation, firstly placing column on a magnetic pole, placing a centrifuge tube corresponding to the lower side, and infiltrating column (LS) by using buffer; adding cells onto column without generating bubbles, cleaning column with buffer for 3 times, taking down column, and collecting CD3+ T cells in clean 15ml centrifuge tube; the buffer was pipetted onto column and CD 3-labeled cells were eluted by piston pushing and part of the cells were counted.

Transviral: 24 hours after activation of the magnetic beads, adding the slow virus obtained in the example 9 according to the MOI of the IL13R alpha 2 virus, centrifuging at normal temperature, and after centrifugation, placing in 37 ℃ and 5% CO ₂ for culturing for 24 hours until the preparation of the IL13R alpha 2-targeted CAR-T cells is completed.

Example 13 in vitro cytotoxicity assays of UCAR-T and CAR-T cells targeting IL13Rα2

Based on the procedure described in example 12, experiments were performed using MK020-A, MK021-A, and different types of T cells were prepared as follows:

A: TRAC, HLA-A double knock IL13R alpha 2UCAR-T cell (MK 020-A)

B: TRAC, HLA-A double knock IL13R alpha 2UCAR-T cell (MK 021-A)

C: TRAC, HLA-B double knocked IL13R alpha 2UCAR-T cells (MK 020-A)

D: TRAC, HLA-A, HLA-B triple-knocked IL13R alpha 2UCAR-T cells (MK 020-A)

E: IL13Rα2CAR-T cells (MK 020-A)

F: wild type T cells

13.1IL13R α2 target cells: U251-LG (luciferase+GFP); adjusting the state of the target cells to the logarithmic growth phase, and carrying out continuous passage for 2 times before carrying out experiments;

13.2 target cells 2X 10 ⁵ were seeded into wells of 24-well plates.

13.3 Effector cells are added in an E/T (effective target ratio, effector cells: target cells) ratio. Each well was filled to a maximum volume (here 600 μl). The control group was inoculated with the same number of target cells, without effector cells (medium was supplemented to 600. Mu.L). Wherein E/T:0.5:1,1:1,2:1,5:1,10:1, three replicates.

13.4 Plates were placed in a 5% CO ₂ incubator at 37℃and incubated for 24 hours. 13.5 after 24 hours of incubation, the well plate was removed from the incubator and 200. Mu.L of supernatant was collected. The ability of CAR-T cells to lyse target cells was then reflected by detection of Luciferase activity.

13.6 Calculation of percent target cell lysis formula:

The experimental results show that: IL13R alpha 2UCAR-T (UCAR-T of 3 MK020-A, UCAR-T of 1 MK 021-A) and CAR-T (MK 020-A) had significant killing effect on U251-LG cells, as shown in FIG. 6A. Meanwhile, cytokine secretion of supernatant of the co-culture system was examined, and found that both IL13-Rα2UCAR-T and IL13-Rα2CAR-T were significantly activated, and IL-2 (shown in FIG. 6B) and IFN-gamma (shown in FIG. 6C) were secreted in large amounts. Wherein each set of histograms in FIGS. 6A, 6B, and 6C represents, in order from left to right, a WT set (wild-type T cells), an IL13Rα2CAR-T cell (MK 020-A) set, TRAC, an HLA-A double-knocked IL13Rα2UCAR-T cell (MK 021-A) set, TRAC, an HLA-B double-knocked IL13Rα2UCAR-T cell (MK 020-A) set, TRAC, HLA-A, and an HLA-B triple-knocked IL13Rα2UCAR-T cell (MK 020-A) set.

Example 14 UCAR-T and CAR-T cell cytotoxicity assays targeting IL13 ra 2 in vivo experiments were performed using MK020-a,

NSG mice, 8-10 weeks old, were subcutaneously injected with tumor cells U251-LG 2X 10 ⁶, and the mice were divided into four groups of 5. After the tumor model is successfully established, the tumor-bearing models of the mice are grouped according to tumor volume, and three groups of cells, namely, wild T cells, IL13R alpha 2CAR-T cells (MK 020-A), TRAC and HLA-A double-knocked IL13R alpha 2UCAR-T cells (MK 020-A), are respectively injected into the tumors of each group of mice, and 50 mu L/each of the three groups of cells is injected into PBS of each group of mice. The mice were then monitored for tumor volume changes and the results are shown in figure 7.

The experimental results show that: after mice were injected with IL13-Rα2UCAR-T and IL13-Rα2CAR-T, the tumor volumes showed significant regression, and good tumor inhibition was exhibited.

Example 15 targeting IL13Rα2UCAR-T in vivo half-life assay

10 Humanized immune system mice (hHSC-NCG) were prepared. The experimental group prepared TRAC, HLA-A double knock-targeting IL13R alpha 2UCAR-T cells (MK 020-A) cells, mice were injected with 1X 10 ⁷ CAR+ cells in vivo, the control group was injected with PBS, and blood was collected at different time points as D1, D3, D7, D14, D21, D28, D35, D42, D49, D56, D63. Genome was extracted from blood samples at various time points, copy/100ng genome DNA was calculated by qPCR absolute quantification, UCAR-T cells harvested on day 14 were used as positive control, DEPC water was used as negative control, and the results are shown in FIG. 8.

The experimental results show that: the targeted IL13Rα2UCAR-T cells prepared by the universal knockout strategy can effectively reduce rejection, have secondary expansion in the humanized immune system mice and are long-lasting.

Example 16 in vitro safety validation of general T cells

Alloreaction: the deletion of MHC-I molecules results in NK cell killing, which is the main reason why universal T cells are rejected. An in vitro alloreaction assay was performed using NK-92 cell line as effector cells, CAR-T, UCAR-T cells as target cells, and K562 cell line as positive control. Target cells were labeled with CELLTRACE ^TM Violet (CTV) dye, NK-92 cell density was adjusted, and co-cultured with target cells at different E/T (effector to target) ratios. Wherein E/T:0.25:1,1:1,2:1,5:1,10:1, three replicates. After 24h of co-culture, the PI antibody is incubated, detection is carried out by using a flow cytometer, and the specific killing rate is calculated according to the following calculation formula:

Specific lysis(％)＝(Dead target cells in the sample(％)–Spontaneously dead target cells(％))/(100–Spontaneously dead target cells(％))×100

The experimental results show that: CAR-T cells with intact MHC-I have no obvious allo-response; TRAC and HLA-A double-knock UCAR-T cell groups can obviously reduce the alloreaction compared with the positive control, the specific killing rate is lower than 40%, and the result is shown in figure 9.

Example 17 in vivo safety verification of Universal T cells

1) GVHD reaction: preparing TRAC, HLA-A double-knock-out CAR-T cells, TRAC, HLA-B double-knock-out CAR-T cells and TRAC, HLA-A and HLA-B triple-knock-out CAR-T cells, and T cells without gene knockouts. The NSG mice of 8-10 weeks are respectively injected with 1X 10 ⁷/group of cells, and the clinical indexes are that: survival rate, coat texture, skin integrity, etc., graft versus host response was observed. Cytokine detection: and taking peripheral blood serum, and detecting the level of cytokines such as IL-2, IFN-gamma and the like. Time point of blood collection: d-1 was returned before D2 (24 h), D7, D14, D21, D28, D35, D42, D49, D56. And (3) detecting visceral lesions: at the end of the observation period (about 2 months), the mice were dissected and generally observed, and HE section staining analysis was performed on the spleen, liver, skin, gastrointestinal tract, lung, and kidney of the mice.

The experimental results show that: of 5 mice injected with untreated T cells, 4 developed lethal xenograft versus host disease (GVHD) within 2 months after injection. Whereas none of the mice receiving TRAC, HLA-A double-knocked CAR-T cells, TRAC, HLA-B double-knocked CAR-T cells and TRAC, HLA-A and HLA-B triple-knocked CAR-T cells showed GVHD, as shown in FIG. 10A; TRAC, HLA-A double knockout T cell group, TRAC, HLA-B double knockout T cell group and TRAC, HLA-A/B triple knockout T cell group cytokines IL-2, IFN-gamma only appear to be significantly increased after 24 hours of reinfusion, later monitoring keeps the secretion level low, and the results are shown in FIG. 10B and FIG. 10C; and when the mice in each group are dissected, different organ morphologies are compared with normal untreated mice, no abnormality is found, HE staining analysis is carried out on organs of the mice in one experimental group by random collection, no abnormality is found, and the results are shown in fig. 10D, and the other animal organs are not collected. Indicating that TRAC, HLA-A double knockout T cell group greatly reduced GVHD response.

2) Alloreaction: preparing TRAC and HLA-A double-knock CAR-T cells; dividing NSG mice into four groups, and respectively injecting three groups of NSG mice into 5x10 ⁶/serving as TRAC, HLA-A double-knock CAR-T cells, TRAC, HLa-B double-knock CAR-T cells, TRAC, HLA-A triple-knock CAR-T cells and HLa-B triple-knock CAR-T cells, and injecting 5x10 ⁶/serving as allotype T cells; control mice were injected with 5x10 ⁶ CAR-T cells, while allogeneic T cells were injected with 5x10 ⁶/mouse.

Blood was taken at different time points for CAR copy number. The copy number changes of the two sets of CARs were compared and the results are shown in fig. 10E. Time point: d-1 (before reinfusion), D2 (24 h reinfusion), D5, D7, D14, D21, D28. Cytokine detection: the levels of cytokines such as IFN-. Gamma.and IL-6 were measured by taking the peripheral blood serum, and the results are shown in FIG. 10F and FIG. 10G. Time point: d-1 (before reinfusion), D2 (24 h reinfusion), D7, D14, D28.

Conclusion: the CAR-T cell group has the advantages that the CAR copy number detected after 24 hours of reinfusion is obviously less than that of a UCAR-T experimental group due to rejection reaction of an allograft, and the CAR copy number can not be basically detected after D7, but the UCAR-T cells with different knockout strategies in each group can detect the CAR copy for a long time, so that the survival time can be prolonged; meanwhile, IL-6 and IFN-gamma cytokines in serum of UCAR-T cell mice with different knockout strategies in each group only appear to be obviously increased in a short time after reinfusion, and then all keep low. The UCAR-T cells of various knockout strategies are well-preserved in vivo and have no obvious alloreaction.

The above description is only a preferred embodiment of the present application, and is not intended to limit the application in any way, and any person skilled in the art may make modifications or alterations to the disclosed technical content to the equivalent embodiments. However, any simple modification, equivalent variation and variation of the above embodiments according to the technical substance of the present application still fall within the protection scope of the technical solution of the present application.

Table 4 sequence listing

Wherein SEQ ID NO 317-379 is an RNA sequence, and "U" is replaced by "T" in the sequence table file provided by the application.

Claims

1. A monoclonal antibody or antigen-binding fragment thereof that targets IL13Rα2, comprising an antibody heavy chain Variable (VH) region comprising heavy chain complementarity determining region 1 (CDR-H1), heavy chain complementarity determining region 2 (CDR-H2), and heavy chain complementarity determining region 3 (CDR-H3) and an antibody light chain Variable (VL) region comprising light chain complementarity determining region 1 (CDR-L1), light chain complementarity determining region 2 (CDR-L2), and light chain complementarity determining region 3 (CDR-L3), wherein,

The CDR-H1, CDR-H2 and CDR-H3 each comprise a sequence selected from the group consisting of ：SEQ IDNo:1、SEQ ID No:2、SEQ ID No:3、SEQ ID No:19、SEQ ID No:20、SEQ IDNo:21、SEQ ID No:37、SEQ ID No:38、SEQ ID No:39、SEQ ID No:55、SEQ ID No:56、SEQ ID No:57、SEQ ID No:73、SEQ ID No:74、SEQ ID No:75、SEQ ID No:91、SEQ ID No:92、SEQ ID No:93、SEQ ID No:109、SEQ ID No:110、SEQ ID No:111、SEQ ID No:127、SEQ ID No:128、SEQ ID No:129、SEQ IDNo:145、SEQ ID No:146、SEQ ID No:147;

The CDR-L1, CDR-L2 and CDR-L3 each comprise a sequence selected from the group consisting of ：SEQ IDNo:10、SEQ ID No:11、SEQ ID No:12、SEQ ID No:28、SEQ ID No:29、SEQ ID No:30、SEQ ID No:46、SEQ ID No:47、SEQ ID No:48、SEQ ID No:64、SEQ ID No:65、SEQ ID No:66、SEQ ID No:82、SEQ ID No:83、SEQ ID No:84、SEQ ID No:100、SEQ ID No:101、SEQ ID No:102、SEQ ID No:118、SEQ IDNo:119、SEQ ID No:120、SEQ ID No:136、SEQ ID No:137、SEQ ID No:138、SEQ ID No:154、SEQ ID No:155、SEQ ID No:156.

2. The antibody or antigen-binding fragment thereof of claim 1, wherein:

The CDR-H1, the CDR-H2 and the CDR-H3 respectively comprise amino acid sequences shown as SEQ ID No. 1, SEQ ID No. 2 and SEQ ID No. 3; or the amino acid sequence shown as SEQ ID No. 19, SEQ ID No. 20 and SEQ ID No. 21; or the amino acid sequence shown as SEQ ID No. 37, SEQ ID No. 38 and SEQ ID No. 39; or the amino acid sequence shown as SEQ ID No. 55, SEQ ID No. 56 and SEQ ID No. 57; or the amino acid sequence shown as SEQ ID No. 73, SEQ ID No. 74 and SEQ ID No. 75; or the amino acid sequence shown as SEQ ID No. 91, SEQ ID No. 92 and SEQ ID No. 93; or the amino acid sequence shown as SEQ ID No. 109, SEQ ID No. 110 and SEQ ID No. 111; or the amino acid sequence shown as SEQ ID No. 127, SEQ ID No. 128 and SEQ ID No. 129; or the amino acid sequence shown as SEQ ID No. 145, SEQ ID No. 146 and SEQ ID No. 147;

The CDR-L1, the CDR-L2 and the CDR-L3 respectively comprise amino acid sequences shown as SEQ ID No. 10, SEQ ID No. 11 and SEQ ID No. 12; or the amino acid sequence shown as SEQ ID No. 28, SEQ ID No. 29 and SEQ ID No. 30; or the amino acid sequence shown as SEQ ID No. 46, SEQ ID No. 47 and SEQ ID No. 48; or the amino acid sequence shown as SEQ ID No. 64, SEQ ID No. 65 and SEQ ID No. 66; or the amino acid sequence shown as SEQ ID No. 82, SEQ ID No. 83 and SEQ ID No. 84; or the amino acid sequence shown as SEQ ID No. 100, SEQ ID No. 101 and SEQ ID No. 102; or the amino acid sequence shown as SEQ ID No. 118, SEQ ID No. 119 and SEQ ID No. 120; or the amino acid sequence shown as SEQ ID No. 136, SEQ ID No. 137 and SEQ ID No. 138; or the amino acid sequence shown as SEQ ID No. 154, SEQ ID No. 155 and SEQ ID No. 156.

3. The antibody or antigen-binding fragment thereof of claim 1, wherein:

CDR-H1, CDR-H2 and CDR-H3 of the VH region respectively comprise amino acid sequences shown as SEQ ID No. 1, SEQ ID No. 2 and SEQ ID No. 3, and CDR-L1, CDR-L2 and CDR-L3 of the VL region respectively comprise amino acid sequences shown as SEQ ID No. 10, SEQ ID No. 11 and SEQ ID No. 12; or (b)

4. The antibody or antigen-binding fragment thereof of claim 1, wherein:

The VH region of the antibody or fragment comprises an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to the sequence shown in SEQ ID No. 8 or SEQ ID No. 26 or SEQ ID No. 44 or SEQ ID No. 62 or SEQ ID No. 80 or SEQ ID No. 98 or SEQ ID No. 116 or SEQ ID No. 134 or SEQ ID No. 152;

5. The antibody or antigen-binding fragment thereof of claim 1, wherein:

The VH region and VL region of the antibody or fragment comprise amino acid sequences having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more or 100% identity to the sequences shown in SEQ ID nos. 8 and 17, respectively; or (b)

The VH region and VL region of the antibody or fragment comprise amino acid sequences that are at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more or 100% identical to the sequences shown in SEQ ID nos. 26 and 35, respectively; or (b)

The VH region and VL region of the antibody or fragment comprise amino acid sequences having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more or 100% identity to the sequences shown in SEQ ID nos. 62 and 71, respectively; or (b)

The VH region and VL region of the antibody or fragment comprise amino acid sequences that are at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more or 100% identical to the sequences shown in SEQ ID No. 80 and SEQ ID No. 89, respectively; or (b)

The VH region and VL region of the antibody or fragment comprise amino acid sequences having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more or 100% identity to the sequences shown in SEQ ID nos. 98 and 107, respectively; or (b)

6. The antibody or antigen-binding fragment thereof of claim 1, wherein:

The VH region of the antibody or fragment is an amino acid sequence shown as SEQ ID No. 8 or SEQ ID No. 26 or SEQ ID No. 44 or SEQ ID No. 62 or SEQ ID No. 80 or SEQ ID No. 98 or SEQ ID No. 116 or SEQ ID No. 134 or SEQ ID No. 152 or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity to an amino acid sequence shown as SEQ ID No. 8 or SEQ ID No. 26 or SEQ ID No. 44 or SEQ ID No. 62 or SEQ ID No. 80 or SEQ ID No. 98 or SEQ ID No. 116 or SEQ ID No. 134 or SEQ ID No. 152; and

7. The antibody or antigen-binding fragment thereof of claim 1, wherein:

The VH region and the VL region of the antibody or the fragment are respectively shown as SEQ ID No. 8 and SEQ ID No. 17 or are respectively amino acid sequences which have at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% and 99% identity with the amino acid sequences shown as SEQ ID No. 8 and SEQ ID No. 17; or (b)

8. The antibody or antigen-binding fragment thereof of any one of claims 1 to 7, which has an amino acid sequence as set forth in any one of SEQ ID nos 167 to 175 or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or more than 99% identity to an amino acid sequence as set forth in any one of SEQ ID nos 167 to 175.

9. A Chimeric Antigen Receptor (CAR) that targets IL13 ra 2, wherein the chimeric antigen receptor comprises a targeting moiety and a non-targeting moiety, and the targeting moiety comprises the antibody or antigen binding fragment of any one of claims 1-8.

10. One or more isolated nucleic acid molecules encoding the antibody or antigen-binding fragment thereof of any one of claims 1-8 or encoding the chimeric antigen receptor of claim 9.

11. A vector comprising the isolated nucleic acid molecule of claim 10.

12. A cell comprising the antibody or antigen-binding fragment thereof of any one of claims 1-8 or encoding the chimeric antigen receptor of claim 9, the isolated nucleic acid molecule of claim 10 and/or the vector of claim 11.

13. An immune effector cell comprising the antibody or antigen-binding fragment thereof of any one of claims 1-8 or encoding the chimeric antigen receptor of claim 9, the isolated nucleic acid molecule of claim 10 and/or the vector of claim 11.

14. An immune effector cell in which T cell antigen receptor (TCR) and major histocompatibility complex (mhc i) function is inhibited in the cell, and which comprises the antibody or antigen binding fragment thereof according to any one of claims 1-8 or encodes the chimeric antigen receptor according to claim 9, the isolated nucleic acid molecule according to claim 10 and/or the vector according to claim 11.

15. A method of making an immune effector cell comprising: modifying an immune effector cell prior to/after introducing the nucleic acid molecule of claim 10 or the vector of claim 11 into said immune effector cell, said modification comprising down-regulating expression and/or activity of one or more of the genes associated with immune rejection.

16. A pharmaceutical composition comprising the antibody or antigen-binding fragment of any one of claims 1-8 or the immune effector cell of claim 9, and optionally a pharmaceutically acceptable carrier.

17. Use of the antibody or antigen-binding fragment of any one of claims 1-8 or the immune effector cell of claim 13 or 14 and/or the pharmaceutical composition of claim 16 in the treatment of a disease or disorder associated with expression of IL13 ra 2.