CN118256559A

CN118256559A - Method for preparing animal model of heart failure with preserved ejection fraction

Info

Publication number: CN118256559A
Application number: CN202410683571.3A
Authority: CN
Inventors: 王利; 李峥
Original assignee: Fuwai Hospital of CAMS and PUMC
Current assignee: Fuwai Hospital of CAMS and PUMC
Priority date: 2024-01-24
Filing date: 2024-05-29
Publication date: 2024-06-28

Abstract

The present invention relates to a method of preparing an animal model of heart failure with preserved ejection fraction (HFpEF) and the use of said animal model.

Description

Method for preparing animal model of heart failure with preserved ejection fraction

Technical Field

Background

Cardiovascular disease represents one of the challenges in medicine, heart failure being a major cause of death in patients with cardiovascular disease, and is a major problem in clinical face, including systolic dysfunction heart failure and diastolic dysfunction heart failure, which is also more broadly defined as heart failure with preserved ejection fraction (HFpEF) as medicine progresses.

The disease model is fundamental to the underlying research of the disease, and HFpEF models (see, e.g., Mishra S, Kass DA. Cellular and molecular pathobiology of heart failure with preserved ejection fraction. Nat Rev Cardiol. 2021;18(6):400-423）,, however, these HFpEF models all have certain drawbacks such as DSSR (see ,Okayama, H. et al. J. Hypertens. 15, 1767–1774 (1997);Qu, P. et al. Hypertens. Res. 23, 613–623 (2000)） for the first few months, LVEF remains unchanged, ca2+ homeostasis, ca2+ transients and cardiomyocyte shortening are normal, however, the subsequent left ventricle distention, LVEF decline, ca2+ treatment begins to resemble HFrEF; these animal angiotensin II or other hormonal blockades can be effective in ameliorating the disease, which is not the case in human HFpEF, ZSF1 rats (see ,Tofovic, S. P. et al. Ren. Fail. 22, 387–406 (2000).;Leite, S. et al. Circ. Heart Fail. 12, e005596 (2019).;Boustany-Kari, C. M. et al. Pharmacol. Exp. Ther. 356, 712–719 (2016)） for angiotensin converting enzyme inhibition, and showing HFpEF phenotype until old, furthermore, since ZSF1 rats are a mixture of various genetic models, expression of each potential phenotype is diluted, the use of L-NAME (see SCHIATTARELLA, g. Et al. Nature, 351-356 (2019)) cannot mimic hypertension, volume or salt overload and related HFpEF production in humans, and possibly cause a physiological imbalance in humans, and the pathological imbalance in most of which is not observed in human women, as compared to the physiological imbalance of the human pef, and the most of which is too severe.

In particular, the HFpEF models that have been reported to date lack the atrial fibrillation phenotype, however HFpEF with atrial fibrillation is one of the highest mortality types and accounts for nearly half of clinical HFpEF. Thus, providing HFpEF models with atrial fibrillation phenotypes is essential for basic research and drug development of HFpEF.

Disclosure of Invention

The inventor of the application discovers that Jun is an important regulatory factor for HFpEF occurrence and development for the first time, thereby providing an HFpEF animal model with atrial fibrillation phenotype, which not only accords with clinical HFpEF characteristics in heart physiological and pathological characteristics, but also accords with clinical HFpEF characteristics in transcriptome characteristics, and providing a powerful tool for basic research and drug development of HFpEF. The following application is thereby provided.

Animal model

In a first aspect, the invention provides a genetically modified non-human animal comprising a genetic modification to overexpress a Jun gene.

In certain embodiments, the genetically modified non-human animal is a non-human animal model of heart failure with preserved ejection fraction (HFpEF).

In this context, "over-expression" refers to an increase in the level of gene expression or gene product relative to the level of a control (e.g., a non-human animal that does not include the genetic modification). The term "increase" refers to a detectable increase as compared to a control. Overexpression may occur at the transcriptional level and/or at the translational level. Overexpression may be achieved by altering the expression control elements (e.g., using a strong promoter), increasing the copy number, or introducing exogenous coding sequences.

In certain embodiments, the non-human animal is a mammal.

In certain embodiments, the non-human animal is a rodent, such as a mouse or a rat.

In certain embodiments, the non-human animal is a mouse. In certain embodiments, the non-human animal is a C57BL/6 strain.

In certain embodiments, the non-human animal or cell thereof contains an exogenous expression cassette comprising a Jun coding sequence. In certain embodiments, the Jun coding sequence is of human origin. In certain embodiments, the Jun coding sequence is of the non-human animal origin. In certain embodiments, the Jun coding sequence is of mouse origin.

In certain embodiments, the exogenous expression cassette is integrated into the genome of the non-human animal.

In certain embodiments, the exogenous expression cassette is not integrated into the genome of the non-human animal, e.g., is episomal, e.g., is present in an episomal vector.

In certain embodiments, the exogenous expression cassette is introduced by a vector. In certain embodiments, the vector is a viral vector, e.g., a lentiviral vector, an adenoviral vector, an adeno-associated viral vector, a poxviral vector (e.g., a vaccinia viral vector), a herpes simplex viral vector.

In certain embodiments, the exogenous expression cassette further comprises an expression regulatory element (e.g., a promoter, such as a constitutive promoter, a specific promoter, or an inducible promoter) operably linked to the Jun coding sequence.

In certain embodiments, the heart tissue of the non-human animal overexpresses the Jun gene, i.e., the heart-specific Jun gene. In certain embodiments, the cardiac tissue comprises at least cardiomyocytes.

In certain embodiments, the non-human animal or cell thereof comprises a first genetic modification and a second genetic modification, wherein:

The first genetic modification comprises a first expression cassette integrated into a safe harbor locus, the first expression cassette comprising a LoxP-Stop-LoxP (LSL) sequence and a Jun coding sequence;

The second genetic modification comprises a second expression cassette comprising a Cre recombinase coding sequence integrated into an endogenous heart-specific gene;

Wherein when Cre recombinase is expressed, it recognizes the two loxps and cleaves the terminator (stop) in between, such that heart-specific gene positive cells (e.g., heart tissue cells, such as cardiomyocytes) continuously express Jun, thereby inducing heart-specific over-expression of Jun gene.

In certain embodiments, the non-human animal is homozygous for the first genetic modification. In certain embodiments, the non-human animal is heterozygous for the first genetic modification.

In certain embodiments, the non-human animal is homozygous for the second genetic modification. In certain embodiments, the non-human animal is heterozygous for the second genetic modification.

In certain embodiments, the non-human animal is homozygous for both the first genetic modification and the second genetic modification.

In certain embodiments, the safe harbor locus is the Rosa26 locus, the H11 locus, the TIGRE locus, or the Col1a1 locus. In certain embodiments, the safe harbor locus is the Rosa26 locus. In certain embodiments, the first genetic modification is integrated at a first intron of the endogenous Rosa26 locus.

In certain embodiments, in the first expression cassette, the Jun coding sequence is located downstream of a LoxP-Stop-LoxP (LSL) sequence.

In certain embodiments, the first expression cassette further comprises an operably linked promoter (e.g., a CAG promoter).

In certain embodiments, the first expression cassette further comprises a reporter gene linked to the Jun coding sequence. In certain embodiments, the Jun coding sequence is linked to the reporter gene by an IRES.

In certain embodiments, the first expression cassette further comprises a post-transcriptional regulatory element (e.g., WPRE), e.g., at its 3' end, e.g., before the poly (a) tail, to increase the expression efficiency of the exogenous fragment.

In certain exemplary embodiments, the LSL sequence comprises a sequence as set forth in SEQ ID NO. 4. In certain exemplary embodiments, the Jun coding sequence comprises the sequence shown in SEQ ID NO. 5.

In certain exemplary embodiments, the first expression cassette has the structure shown below: CAG-LSL-Jun-IRES-EGFP-WPRE-pA. In certain exemplary embodiments, the first expression cassette comprises the sequence set forth in SEQ ID NO. 3.

In certain embodiments, the first expression cassette is flanked by 5 'and 3' homology arms.

In certain exemplary embodiments, the 5' homology arm has a sequence as set forth in SEQ ID NO. 2. In certain exemplary embodiments, the 3' homology arm has a sequence as set forth in SEQ ID NO. 6.

In certain embodiments, the heart-specific gene is a cardiomyocyte-specific gene. In certain embodiments, the heart-specific gene is the Myh6 gene. In certain embodiments, the second genetic modification is integrated at the start codon of the endogenous Myh6 gene.

In certain embodiments, the Cre recombinase is an inducible Cre recombinase. In certain embodiments, the inducible Cre recombinase is promoter-activated or ligand-inducible. In certain embodiments, the Cre recombinase is an estrogen-inducible Cre recombinase, such as Cre-ERT2.

In certain embodiments, the second expression cassette further comprises an expression regulatory element (e.g., a promoter, such as a constitutive promoter, a specific promoter, or an inducible promoter) operably linked to the Cre recombinase coding sequence.

In certain embodiments, the second expression cassette is flanked by 5 'and 3' homology arms.

Preparation of animal models

In a second aspect, the invention provides a method of preparing a heart failure with preserved ejection fraction (HFpEF) non-human animal model, the method comprising overexpressing a Jun gene in the non-human animal.

In certain embodiments, the method comprises introducing into the non-human animal an exogenous expression cassette comprising a Jun coding sequence. In certain embodiments, the Jun coding sequence is of human origin. In certain embodiments, the Jun coding sequence is of the non-human animal origin. In certain embodiments, the Jun coding sequence is of mouse origin.

In certain embodiments, the methods comprise introducing into cells of the non-human animal an exogenous expression cassette comprising a Jun coding sequence. In certain embodiments, the method further comprises producing the non-human animal from the cell.

In certain embodiments, the non-human animal is a mammal. In certain embodiments, the non-human animal is a rodent, such as a mouse or a rat. In certain embodiments, the non-human animal is a mouse.

In certain embodiments, the exogenous expression cassette is present on a vector. In certain embodiments, the vector is a viral vector, e.g., a lentiviral vector, an adenoviral vector, an adeno-associated viral vector, a poxviral vector (e.g., a vaccinia viral vector), a herpes simplex viral vector.

Nucleic acid introduction

Methods that allow for the introduction of nucleic acids into cells or non-human animals are known in the art. Methods for introducing nucleic acids into various cell types include, for example, stable transfection methods, transient transfection methods, and virus-mediated methods. Non-limiting transfection methods include chemical-based transfection methods that use liposomes; a nanoparticle; a calcium phosphate; a dendrimer; or a cationic polymer (e.g., DEAE-dextran or polyethylenimine). Non-chemical methods include electroporation, sonar electroporation, and optical transfection. Particle-based transfection includes the use of gene gun or magnetic assisted transfection. Exogenous nucleic acids can also be introduced into cells by electroporation, by intracytoplasmic injection (intracytoplasmic injection), by viral infection (e.g., adenovirus, adeno-associated virus, lentivirus, retrovirus), by lipid-mediated transfection, or by nuclear transfection. Nucleic acids can also be introduced into cells (e.g., synthons) by microinjection. In zygotes (i.e., single cell stage embryos), microinjection can be into maternal and/or paternal procaryotes or into the cytoplasm. If microinjection only enters one procaryon, the parent procaryon is preferred because of its larger size. Alternatively, microinjection can be performed by injection into the nucleus/prokaryotes and cytoplasm: the needle may be introduced into the nucleus/pro-nucleus first, then a first amount may be injected, and then a second amount may be injected into the cytoplasm when the needle is removed from the single cell stage embryo. Methods of performing microinjection are well known.

Other methods of introducing nucleic acids into cells or non-human animals may include, for example, carrier delivery, particle-mediated delivery, exosome-mediated delivery, lipid nanoparticle-mediated delivery, cell-penetrating peptide-mediated delivery, or implantable device-mediated delivery. As specific examples, the nucleic acid may be introduced into a cell or non-human animal in a carrier such as PLA microspheres, PLGA microspheres, liposomes, micelles, reverse micelles, cochleates, or lipid microtubules. Some specific examples of delivery to non-human animals include hydrodynamic delivery, virus-mediated delivery (e.g., adeno-associated virus (AAV) -mediated delivery), and lipid nanoparticle-mediated delivery.

Introduction of the nucleic acid may be achieved by virus-mediated delivery (e.g., AAV-mediated delivery or lentivirus-mediated delivery). Other exemplary viral/viral vectors include retroviruses, adenoviruses, poxviruses (e.g., vaccinia virus), and herpes simplex viruses. The virus may infect dividing cells, non-dividing cells, or both dividing and non-dividing cells. The virus may or may not be integrated into the host genome. Such viruses may also be engineered to have reduced immunity. Viruses may be replication-competent or replication-defective (e.g., defective in one or more genes necessary for another round of virion replication and/or packaging). The virus may cause transient expression, long-term expression (e.g., at least 1 week, 2 weeks, 1 month, 2 months, or 3 months), or permanent expression.

Tissue-specific expression

In certain embodiments, the Jun gene is overexpressed in heart tissue of the non-human animal, i.e., the Jun gene is overexpressed heart-specifically. In certain embodiments, the cardiac tissue comprises at least cardiomyocytes.

Methods for achieving tissue-specific expression are well known to those skilled in the art, for example, using tissue-specific expression control sequences, such as tissue-specific promoters, repressors, enhancers, or combinations thereof, operably linked to a Jun coding sequence; or using a Cre-LoxP recombination system.

In certain embodiments, the heart-specific overexpression is achieved by a Cre-LoxP recombination system (e.g., an inducible Cre-LoxP recombination system).

In certain embodiments, the method comprises the steps of:

(1) Providing a first genetically modified non-human animal and a second genetically modified non-human animal, wherein:

The first genetically modified non-human animal comprises a first genetic modification comprising a first expression cassette integrated into a safe harbor locus, the first expression cassette comprising a LoxP-Stop-LoxP (LSL) sequence and a Jun coding sequence;

The second genetically modified non-human animal comprises a second genetic modification comprising a second expression cassette integrated into an endogenous heart-specific gene, the second expression cassette comprising a Cre recombinase coding sequence;

(2) Crossing the first non-human animal and the second non-human animal to obtain progeny, selecting progeny comprising both the first genetic modification and the second genetic modification, wherein when Cre recombinase is expressed, it recognizes both loxps and cleaves a terminator (stop) therebetween, such that cardiac cells (e.g., cardiomyocytes) continuously express Jun, thereby inducing heart-specific overexpression of Jun gene.

First non-human animal

In certain embodiments, the first non-human animal is homozygous for the first genetic modification. In certain embodiments, the first non-human animal is heterozygous for the first genetic modification.

In certain embodiments, the first expression cassette is flanked by 5 'and 3' homology arms. In certain exemplary embodiments, the 5' homology arm has a sequence as set forth in SEQ ID NO. 2. In certain exemplary embodiments, the 3' homology arm has a sequence as set forth in SEQ ID NO. 6.

In certain embodiments, the first genetic modification is effected by a gene editing system. The gene editing system may be any site-specific (sequence-specific) genome editing system now known. In certain embodiments, the genome editing system comprises at least one site-specific nuclease, such as an RNA-guided nuclease (e.g., cas nuclease), zinc finger nuclease, megabase meganuclease, TALE-nuclease, recombinase, transposase, and any combination thereof. In certain embodiments, the site-specific endonuclease targets a safe harbor locus, induces DNA fragmentation at the target site, and integration is accomplished by, for example, homologous Recombination (HR).

In certain embodiments, the gene editing system is selected from CRISPR/Cas, TALEN, ZFN.

In certain embodiments, the gene editing system comprises an RNA-guided endonuclease and a guide RNA (gRNA) comprising a guide sequence that has complementarity to a target sequence in a target locus. In certain embodiments, the gene editing system is present on one or more vectors.

In certain embodiments, the gene editing system is a CRISPR/Cas system comprising a Cas effector protein (including, without limitation, cas9, cas12a (Cpf 1), cas12b (C2C 1), cas13a (C2), C2C3, cas13 b), and a corresponding guide RNA (gRNA). The CRISPR/Cas system recruits Cas enzyme proteins to target loci to accomplish modification by guide RNAs (grnas) that contain guide sequences that have complementarity to target sequences in the target loci. In certain embodiments, the gRNA may be a chimeric guide RNA or a single guide RNA (sgRNA). In certain embodiments, the gRNA comprises a guide sequence and a tracr mate sequence (or direct repeat sequence). In certain embodiments, the gRNA comprises a guide sequence, a tracr mate sequence (or direct repeat sequence), and a tracr sequence. In certain embodiments, the CRISPR-Cas system does not comprise and/or is independent of the presence of a tracr sequence (e.g., if the Cas protein is Cas12 a).

In certain embodiments, the first genetic modification may be accomplished using any of the methods known in the art for introducing transgenes into non-human animals. Such techniques include, but are not limited to: pronucleus microinjection, viral infection, and transformation of embryonic stem cells and iPS cells.

In certain embodiments, the first genetically modified non-human animal is obtained by:

(a) Introducing (e.g., microinjection) the first expression cassette into a fertilized egg of a non-human animal;

(b) Transplanting fertilized eggs into pseudopregnant animals;

(c) Allowing fertilized eggs to develop to term; and

(D) Identifying a progeny comprising said first genetic modification.

In certain embodiments, step (a) comprises: one or more vectors expressing the CRISPR/Cas9 system and the first expression cassette are introduced into fertilized eggs. In certain embodiments, step (a) comprises: a vector expressing Cas9 mRNA and gRNA and a vector comprising a first expression cassette are introduced into fertilized eggs. In certain exemplary embodiments, the gRNA comprises a sequence as set forth in SEQ ID NO. 1.

In certain embodiments, step (d) comprises PCR identification and/or sequencing using primers targeting the 5 'homology arm and/or the 3' homology arm.

Second non-human animal

In certain embodiments, the second non-human animal is homozygous for the second genetic modification. In certain embodiments, the second non-human animal is heterozygous for the second genetic modification.

In certain embodiments, the Cre recombinase is an inducible Cre recombinase, the method further comprising: the progeny rodent inducer is administered to induce heart-specific over-expression of the Jun gene.

By "inducible Cre recombinase" is meant a Cre recombinase that requires activation of the activity or expression of the Cre recombinase by an inducer. Inducible Cre recombinases are well known to those skilled in the art and include, but are not limited to, promoter-activated or ligand-inducible.

"Promoter-activating" modulates the activity of a promoter driving Cre recombinase by an inducer, such as tetracycline-inducible, interferon-inducible, etc.

The "ligand-inducible" is a fusion protein that localizes to the cytosol by fusing Cre recombinase with the ligand-binding domain (LBD) of the hormone receptor, and only after hormone induction, will the fused Cre protein dissociate from the dockerin HSP90 via conformational changes, enter the nucleus, recognize loxP sites and recombine, e.g., estrogen-inducible. An "estrogen-inducible" is a fusion protein (Cre-ER) that fuses the ligand binding domain of an estrogen receptor (estrogenreceptor, ER for short) with Cre recombinase to form a localized cytoplasmic fusion protein. Thus, by controlling the injection time of estrogen, the specificity of the gene recombination time can be regulated and controlled. To avoid interference with endogenous estrogens, mutations G521R are introduced in the ligand-binding region of the human ER to form Cre-ERT or mutations C400V/M543A/L544A are introduced to form Cre-ERT2, which are responsive only to induction by exogenous synthetic estrogens (e.g., tamoxifen, 4-OHT).

In certain embodiments, the Cre recombinase is an estrogen-inducible Cre recombinase, such as Cre-ERT2.

In certain embodiments, the Cre recombinase is Cre-ERT2, and the method further comprises: the progeny are given synthetic estrogens (e.g., tamoxifen, 4-OHT) to induce heart-specific overexpression of the Jun gene.

In exemplary certain embodiments, the second genetically modified non-human animal is a Myh6-cre ^ERT2 mouse (southern model organism, NM-KI-200125) in which CreERT2-pA is inserted at the mouse Myf6 gene start codon.

In certain embodiments, the second genetic modification is effected by a gene editing system. The gene editing system may be any site-specific (sequence-specific) genome editing system now known. In certain embodiments, the genome editing system comprises at least one site-specific nuclease, such as an RNA-guided nuclease (e.g., cas nuclease), zinc finger nuclease, megabase meganuclease, TALE-nuclease, recombinase, transposase, and any combination thereof. In certain embodiments, the site-specific endonuclease targets an endogenous heart-specific gene, induces DNA fragmentation at the target site, and integration is accomplished by, for example, homologous Recombination (HR).

In certain embodiments, the gene editing system is a CRISPR/Cas system comprising a Cas effector protein (including, without limitation, cas9, cas12a (Cpf 1), cas12b (C2C 1), cas13a (C2), C2C3, cas13 b), and a corresponding guide RNA (gRNA).

In certain embodiments, the second genetic modification may be accomplished using any of the methods known in the art for introducing transgenes into non-human animals. Such techniques include, but are not limited to: pronucleus microinjection, viral infection, and transformation of embryonic stem cells and iPS cells.

In certain embodiments, the second genetically modified non-human animal is obtained by:

(a) Introducing (e.g., microinjection) the second expression cassette into a fertilized egg of a non-human animal;

(b) Transplanting fertilized eggs into pseudopregnant animals;

(c) Allowing fertilized eggs to develop to term; and

(D) Identifying a progeny that contains the second genetic modification.

In certain embodiments, step (a) comprises: one or more vectors expressing the CRISPR/Cas9 system and the second expression cassette are introduced into fertilized eggs. In certain embodiments, step (a) comprises: a vector expressing Cas9 mRNA and gRNA and a vector comprising a second expression cassette are introduced into fertilized eggs.

In another aspect, the invention also provides a non-human animal model produced by the method of the second aspect.

Carrier and kit

In a third aspect, the invention provides a vector (e.g., an expression vector) comprising an expression cassette comprising a LoxP-Stop-LoxP (LSL) sequence and a Jun coding sequence.

In certain embodiments, the Jun coding sequence is located downstream of the LSL sequence.

In certain embodiments, the expression cassette further comprises an operably linked promoter (e.g., a CAG promoter).

In certain embodiments, the expression cassette further comprises a reporter gene linked to the Jun coding sequence. In certain embodiments, the Jun coding sequence is linked to the reporter gene by an IRES.

In certain embodiments, the expression cassette further comprises a post-transcriptional regulatory element (e.g., WPRE), e.g., at its 3' end, e.g., before the poly (a) tail, to increase the expression efficiency of the exogenous fragment.

In certain exemplary embodiments, the expression cassette has the structure shown below: CAG-LSL-Jun-IRES-EGFP-WPRE-pA. In certain exemplary embodiments, the first expression cassette comprises the sequence set forth in SEQ ID NO. 3.

In certain embodiments, the expression cassette is flanked by 5 'and 3' homology arms to allow integration of the expression cassette into the genome. In certain exemplary embodiments, the 5' homology arm has a sequence as set forth in SEQ ID NO. 2. In certain exemplary embodiments, the 3' homology arm has a sequence as set forth in SEQ ID NO. 6.

In a fourth aspect, the invention provides a kit comprising a vector as described above.

In certain embodiments, the kit further comprises a second vector comprising an expression cassette comprising a Cre recombinase coding sequence.

In certain embodiments, the expression cassette is flanked by 5 'and 3' homology arms to allow integration of the expression cassette into the genome.

In certain embodiments, the Cre recombinase is an inducible Cre recombinase as defined in the second aspect.

In another aspect, the invention also relates to the use of a vector or kit as described above for the preparation of a heart failure with preserved ejection fraction (HFpEF) non-human animal model.

Application of animal model

In another aspect, the invention provides the use of a genetically modified non-human animal as described herein as a heart failure with preserved ejection fraction (HFpEF) non-human animal model.

In another aspect, the invention provides the use of a genetically modified non-human animal as described herein, or a non-human animal model of HFpEF produced by a method as described herein, for or as an animal model for screening a medicament for the prevention and/or treatment of heart failure with preserved ejection fraction (HFpEF).

In another aspect, the invention provides the use of a genetically modified non-human animal as described herein, or a non-human animal model of HFpEF produced by a method as described herein, for or as an animal model for studying heart failure with preserved ejection fraction (HFpEF).

In another aspect, the present invention provides a method of screening for a drug for preventing and/or treating heart failure with preserved ejection fraction (HFpEF), the method comprising: administering a drug candidate to a genetically modified non-human animal described herein, or to a non-human animal model of HFpEF produced by a method described herein; evaluating whether the candidate drug is capable of (i) improving diastolic function, e.g., decreasing diastolic function parameters E/E' and/or E/a; and/or (ii) inhibiting Jun gene expression.

In certain embodiments, inhibiting Jun gene expression comprises inhibiting Jun expression at the RNA or protein level, e.g., knocking out Jun gene, reducing or inhibiting transcription of gene, and/or reducing or inhibiting translation of mRNA product of the gene. In certain embodiments, the determination of expression levels may be performed at the nucleic acid level or the protein level. Methods for determining expression at the nucleic acid level include, but are not limited to, northern blotting, PCR, RT-PCR, or real-time (real) RT-PCR. Methods for determining expression at the protein level include, but are not limited to, western blotting or polyacrylamide gel electrophoresis in combination with protein staining techniques such as coomassie brilliant blue or silver staining, mass spectrometry, ELISA, and the like.

Definition of terms

In the present invention, unless otherwise indicated, scientific and technical terms used herein have the meanings commonly understood by one of ordinary skill in the art. For a better understanding of the present invention, definitions and explanations of the relevant terms are provided below.

As used herein, the term "ejection fraction preserved heart failure (HFpEF)" refers to a type of clinical syndrome in which impaired ventricular diastolic function and reduced compliance result in reduced ventricular filling and increased filling pressure, resulting in pulmonary and systemic congestion, with normal or slightly reduced ventricular contractility. HFpEF typically refers to diastolic dysfunction of heart failure. In certain embodiments, the clinical diagnostic criteria for HFpEF consist essentially of: (1) the presence of symptoms and/or signs of heart failure; (2) The heart imaging examination (mainly TTE examination) indicates that LVEF is more than or equal to 50%; (3) There is objective evidence of cardiac structure and/or dysfunction consistent with left ventricular diastolic dysfunction and/or elevated left ventricular filling pressure, where the structural and/or dysfunctional indicators of left ventricular diastolic dysfunction and/or elevated left ventricular filling pressure mainly include: (a) an average E/E' ratio >15; (b) The left atrial volume index is > 40 ml/m ² (atrial fibrillation).

As used herein, the term "Jun" refers to the Jun proto-oncogene, AP-1 transcription factor subunit (Jun proto-oncogene, AP-1 transcription factor subunit), also known as AP1, AP-1, cJun or c-Jun. Jun may be of human origin or may be a homologous gene from another species (e.g., non-human mammal, fish, reptile or bird, e.g., rodent such as mouse, rat, hamster, guinea pig, rabbit, dog, cat, horse, cow, sheep, pig, goat, primate, etc.). The sequences of Jun are well known to those skilled in the art and can be found in various public databases, for example, exemplary gene sequences of human Jun can be found in GenBank: NM-002228.4, exemplary protein sequences can be found in NCBI: NP-002219.1; exemplary gene sequences for mouse Jun can be found in Ensembl: ENSMUSG00000052684 NCBI Gene ID 16476, exemplary protein sequences can be found in UniProtKB:P 05627, NCBI:NP-034721.1.

As used herein, the term "safe harbor locus" refers to a chromosomal locus at which a transgene or other exogenous nucleic acid insert can be stably and reliably expressed in all tissues of interest without significantly altering the cell's behavior or phenotype (i.e., without any deleterious effect on the host cell). See, e.g., SADELAIN ET AL (2012) Nat Rev Cancer 12:51-58, which is incorporated by reference herein in its entirety for all purposes. For example, a safe harbor locus may be one in which the expression of the inserted gene sequence is not interfered with by any read-through expression of neighboring genes. For example, a safe harbor locus may include a chromosomal locus, wherein exogenous DNA can integrate and function in a predictable manner without adversely affecting the structure or expression of the endogenous gene. The safe harbor locus may include an extragenic or intragenic region, e.g., a locus within a gene that is not required, can be omitted, or can be disrupted without obvious phenotypic consequences. For example, the Rosa26 locus and its equivalent in humans provide an open chromatin structure pattern in all tissues and are ubiquitously expressed during embryonic development and in adults. See, e.g., zam browicz et a l (1997) Proc. Natl. Acad. Sci. USA 94:3789-3794, incorporated herein by reference in its entirety for all purposes. In addition, the Rosa26 locus can be targeted efficiently and disruption of the Rosa26 gene does not produce a significant phenotype. Other examples of safe harbor loci include H11, TIGRE, col1a1.

As used herein, the term "promoter" is a regulatory region of DNA that generally comprises a TATA box capable of directing RNA polymerase II to initiate RNA synthesis at the appropriate transcription initiation site of a particular polynucleotide sequence. The promoter may additionally contain other regions that influence the transcription initiation rate. The promoter may be, for example, a constitutively active promoter, a conditional promoter (conditional promoter), an inducible promoter, a time limited promoter (temporally restricted promoter) (e.g., a developmentally regulated promoter (developmentally regulated promoter)), or a spatially limited promoter (SPATIALLY RESTRICTED promoter) (e.g., a cell-specific or tissue-specific promoter).

A "constitutive promoter" is a promoter that is active in all tissues or in a particular tissue at all stages of development. Examples of constitutive promoters include the human early (IMMEDIATE EARLY) cytomegalovirus (hCMV) promoter, the mouse early cytomegalovirus (mCMV) promoter, the human elongation factor 1 alpha (hef1α) promoter, the mouse elongation factor 1 alpha (mEF 1α) promoter, the mouse phosphoglycerate kinase (PGK) promoter, the chicken beta actin hybrid (CAG or CBh) promoter, the SV40 early promoter, and the beta 2 tubulin promoter.

Examples of "inducible promoters" include, for example, chemically regulated promoters and physically regulated promoters. Chemically regulated promoters include, for example, alcohol regulated promoters (e.g., alcohol dehydrogenase (alcA) gene promoters), tetracycline regulated promoters (e.g., tetracycline responsive promoters, tetracycline operator sequences (tetO), tet-On promoters, or tet-Off promoters), steroid regulated promoters (e.g., promoters of the rat glucocorticoid receptor, estrogen receptor, or ecdysone receptor), or metal regulated promoters (e.g., metalloprotease promoters). Physically regulated promoters include, for example, temperature regulated promoters (e.g., heat shock promoters) and light regulated promoters (e.g., light inducible promoters or light repressible promoters (light-repressible promoter)).

The "tissue-specific promoter" may be, for example, a neuron-specific promoter, a glial cell-specific promoter, a muscle cell-specific promoter, a heart cell-specific promoter, a kidney cell-specific promoter, a bone cell-specific promoter, an endothelial cell-specific promoter, or an immune cell-specific promoter (e.g., a B cell promoter or a T cell promoter). In certain embodiments, the tissue-specific promoter is preferably a heart cell-specific promoter.

As used herein, the term "operably linked" refers to the juxtaposition of two or more components, such as a promoter and another sequence element, such that both components function normally and at least one component is permitted to mediate a function imposed upon at least one other component. For example, a promoter may be operably linked to a coding sequence if it controls the level of transcription of the coding sequence in response to the presence or absence of one or more transcriptional regulators. An operable linkage may include sequences that are contiguous with each other or act in trans (e.g., regulatory sequences may act at a distance to control transcription of a coding sequence).

As used herein, the term "expression cassette" refers to a recombinant nucleic acid comprising a desired coding sequence operably linked to nucleic acid sequences necessary for expression in a particular host cell or organism. Nucleic acid sequences required for expression in prokaryotes typically include promoters, operators (optional) and ribosome binding sites, as well as other sequences. Eukaryotic cells typically utilize promoters, enhancers, and termination and polyadenylation signals, although some elements may be deleted and others added without sacrificing necessary expression.

As used herein, the term "endogenous" refers to a nucleic acid sequence that naturally occurs in a cell or non-human animal. For example, an endogenous Rosa26 sequence of a non-human animal refers to a native Rosa26 sequence that naturally occurs at the Rosa26 locus of the non-human animal.

As used herein, the term "exogenous" molecule or sequence includes molecules or sequences that are not normally present in the cell in that form. Typical presence includes presence at a particular developmental stage of the cell and environmental conditions. For example, the exogenous molecule or sequence may comprise a mutant form of the corresponding endogenous sequence in the cell (e.g., a humanized version of the endogenous sequence), or may comprise a sequence that corresponds to the endogenous sequence in the cell but is not in the same form (i.e., not within the chromosome). In contrast, endogenous molecules or sequences include molecules or sequences that are normally present in that form in a particular cell at a particular stage of development under particular loop conditions.

As used herein, the term "vector" refers to a nucleic acid vehicle into which a polynucleotide may be inserted. When a vector enables expression of a protein encoded by an inserted polynucleotide, the vector is referred to as an expression vector. The vector may be introduced into a host cell by transformation, transduction or transfection such that the genetic material elements carried thereby are expressed in the host cell. Vectors are well known to those skilled in the art and include, but are not limited to: a plasmid; phagemid; a cosmid; artificial chromosomes, such as Yeast Artificial Chromosome (YAC), bacterial Artificial Chromosome (BAC), or P1-derived artificial chromosome (PAC); phages such as lambda phage or M13 phage, animal viruses, etc. Animal viruses that may be used as vectors include, but are not limited to, retrovirus (including lentivirus), adenovirus, adeno-associated virus, herpes virus (e.g., herpes simplex virus), poxvirus, baculovirus, papilloma virus, papilloma vacuolation virus (e.g., SV 40). A vector may contain a variety of elements that control expression, including, but not limited to, promoter sequences, transcription initiation sequences, enhancer sequences, selection elements, and reporter genes. In addition, the vector may also contain a replication origin.

Advantageous effects

The inventors of the present application for the first time provided an HFpEF animal model with atrial fibrillation phenotype that not only met the cardiac physiopathological features with clinical HFpEF characteristics, but also the transcriptome features with clinical HFpEF characteristics. In particular, HFpEF with atrial fibrillation is one of the highest mortality types and accounts for nearly half of clinical HFpEF. Therefore, the HFpEF model with atrial fibrillation phenotype has important significance and application value for the basic research of HFpEF and the research and development of medicines.

Embodiments of the present invention will be described in detail below with reference to the accompanying drawings and examples, but it will be understood by those skilled in the art that the following drawings and examples are only for illustrating the present invention and are not to be construed as limiting the scope of the present invention. Various objects and advantageous aspects of the present invention will become apparent to those skilled in the art from the following detailed description of the preferred embodiments and the accompanying drawings.

Drawings

Fig. 1: construction strategy schematic of Jun-Rosa26 ^LSL/LSL mice.

Fig. 2: schematic representation of the identification strategy of Jun-Rosa26 ^LSL/LSL mice.

Fig. 3: PCR identification of electropherograms by the 5 'and 3' homology arms of F1 generation mice from Jun-Rosa26 ^LSL/LSL mice. The number: f1 generation mice were numbered; wt: a wild-type control; m:1kb DNA ladder.

Fig. 4: PCR characterization of Myh6-cre ^ERT2/Jun-Rosa26^LSL/- mice electrophoretogram (1% agarose gel).

Fig. 5: jun overexpression efficiency detection in Myh6-cre ^ERT2/Jun-Rosa26^LSL/- mice. A, an experimental flow diagram; b: detecting the over-expression degree of Jun-OE in tamoxifen to the fifth day by real-time quantitative PCR; c: immunofluorescence staining demonstrated that Jun was overexpressed in Jun-OE mice; d: immunofluorescent staining of Jun-OE mice in lung tissue.

Fig. 6: and (5) detecting the contractile function and structural parameters of the Myh6-cre ^ERT2/Jun-Rosa26^LSL/- mice. A, counting the survival curve of the mice; b: counting the short axis shortening rate of the left chamber of the mouse; c: results of the left room ejection fraction of mice; d: schematic diagram for detecting the contraction function of the left chamber of the mouse; E-G, mouse left chamber volume weight (E), end diastole left chamber volume (F) and end systole left chamber volume (G).

Fig. 7: tissue dissection assay of Myh6-cre ^ERT2/Jun-Rosa26^LSL/- mice. Myh6-cre ^ERT2/Jun-Rosa26^LSL/- mice were induced with tamoxifen and then stained with HE; b: wet dry weight ratio statistics of lung after Myh6-cre ^ERT2/Jun-Rosa26^LSL/- mice tamoxifen induction; c: a four-chamber heart ultrasonic result diagram of the mouse heart; d: morphological changes in lung after tamoxifen induction; e: lung tissue HE staining and EVG staining after Myh6-cre ^ERT2/Jun-Rosa26^LSL/- mice tamoxifen induction.

Fig. 8: diastolic function detection in Myh6-cre ^ERT2/Jun-Rosa26^LSL/- mice. A, a schematic diagram of detection of the diastolic function of the left chamber of the mouse; b: E/A statistics of the left chamber of the mouse; c: left chamber E/E' statistics in mice.

Fig. 9: electrocardiogram monitoring results of Myh6-cre ^ERT2/Jun-Rosa26^LSL/- mice.

Fig. 10: comparison of transcriptome characteristics of Jun-OE mouse samples with HFpEF patients. A, sample similarity analysis of the intersection of the Jun-OE mice and HFpEF patients published by the article; b, sample similarity PCA clustering of the intersection of the Jun-OE mice and HFpEF patients published by the article; c: expression trend of Jun gene in Jun-OE mice and HFpEF patients published in the paper.

Sequence information

A description of the sequences to which the present application relates is provided in the following table.

Table 1: sequence information.

Detailed Description

The invention will now be described with reference to the following examples, which are intended to illustrate the invention, but not to limit it.

Those skilled in the art will appreciate that the examples describe the application by way of example and are not intended to limit the scope of the application as claimed. The experimental methods in the examples are all conventional methods unless otherwise specified. The specific conditions are not noted in the examples and are carried out according to conventional conditions or conditions recommended by the manufacturer. The reagents or apparatus used were conventional products commercially available without the manufacturer's attention.

Experimental materials and methods

Animals: c57BL/6N wild type mice were purchased from Beijing vitamin Toril Lihua; myh6-cre ^ERT2 mice were purchased from Shanghai Nannon model biotechnology Co., ltd, strain full name C57BL/6Smoc-Myf6 ^{em1(CreERT2-pA)Smoc} (Nannon model organism, NM-KI-200125); jun-Rosa26 ^LSL/LSL mice were purchased from Shanghai Nannon model biotechnology Co., ltd, and were Rosa26 site-directed knock-in heterozygous mice that were conditionally overexpressed the CAG-LSL-Jun-IRES-EGFP-WPRE-pA gene obtained using CRISPR/Cas9 technology.

The reagents are as follows:

table 2: reagent information.

Animal experiment criterion

In this example, all animal studies were conducted under the direction of the animal care and use committee laboratory animal center, the cardiovascular disease center, fu-outer hospital in China. All mice were propagated and bred in the same environment, and the mice were randomly grouped during the experiment. Echocardiographic analysis is performed by an independent researcher who is unaware of the study objectives.

Routine ultrasonic testing

All mice were given a conventional ultrasound test after five weeks of feeding under different conditions, once every two weeks, until the fifteen weeks of testing ended. Specifically, transthoracic echocardiography was performed using VisualSonics Vevo 2100 system equipped with an MS400 transducer (Visual sonic). Left Ventricular Ejection Fraction (LVEF) and other contractile function indicators were obtained from short axis M-scans of ventricular mid-level, as indicated by the presence of papillary muscles, in conscious, gently constrained mice. A four-chamber view of the apex of the heart was obtained in anesthetized mice for diastolic function measurements at the mitral valve level using pulse wave and tissue doppler imaging. Anesthesia was induced by 2.5% isoflurane and was confirmed by lack of response to firm pressure on one of the hind paws. Isoflurane is reduced to 1.0-1.5% during echocardiographic acquisition (under temperature control conditions) and adjusted to maintain heart rate in the range of 500 beats per minute. The collected parameters include: heart rate, left ventricular end diastole diameter, left ventricular end systole diameter, end diastole ventricular septum wall thickness, left ventricular end diastole posterior wall, left ventricular fractional shortening, LVEF, velocity of doppler flow peak early diastole through the mitral valve, peak doppler flow velocity late diastole through the mitral valve, isovolumetric time of diastole, tissue doppler peak of heart muscle relaxation velocity at the mitral annulus at early diastole and early filling deceleration times. At the end of the procedure, all mice recovered from anesthesia without any abnormalities. All parameters were measured at least 3 times and the average value was given. Ultrasonic testing includes systolic function and diastolic function testing.

Example 1: preparation of Jun overexpressing transgenic mice.

1.1 Summary of the invention

Myh6-cre ^ERT2 (southern model organism, NM-KI-200125) was hybridized with Jun-Rosa26 ^LSL/LSL, a mouse with cardiomyocyte-specific cre tool, to obtain Myh6-cre ^ERT2/Jun-Rosa26^LSL/-, which induced Jun-cardiomyocyte-specific overexpression by tamoxifen. Myh6-cre ^ERT2/Jun-Rosa26^LSL/- mice may be referred to herein simply as Jun-OE mice.

The cardiomyocyte-specific cre tool mouse Myh6-cre ^ERT2 strain, full name C57BL/6Smoc-Myf6 ^em1 ^{(CreERT2-pA)Smoc}, was inserted into the mouse Myf6 gene at the start codon. Myf6 (myogenic factor) muscle cause 6 is a DNA binding protein involved in muscle development. Myf6-CreERT2 was crossed with a mouse strain containing a loxP site flanking sequence, and induction of Cre-mediated recombination resulted in deletion of flanking sequences in offspring Myf 6-positive cells.

A schematic diagram of a mouse construction strategy of a Jun-Rosa26 ^LSL/LSL over-expressed mouse is shown in figure 1, and a CRISPR/Cas9 technology is adopted, and a CAG-LSL-Jun-IRES-EGFP-WPRE-pA expression frame is inserted into a Rosa26 gene locus at fixed points in a homologous recombination mode. The brief procedure is as follows: cas9 mRNA and gRNA are obtained by means of in vitro transcription; a homologous recombinant vector (donor vector) was constructed by the method of In-Fusion cloning, and the vector contained a 3.3 kb 5 'homology arm, CAG-LSL-Jun-IRES-EGFP-WPRE-pA and a 3.3 kb 3' homology arm. Cas9 mRNA, gRNA and donor vector were microinjected into fertilized eggs of C57BL/6J mice to obtain F0 mice. And (3) performing PCR amplification and sequencing to identify positive F0 mice and mating the positive F0 mice with C57BL/6J mice to obtain 8 positive F1 mice. The F1 generation mouse is Jun-Rosa26 ^LSL/LSL which is a Jun over-expressed mouse.

In Myh6-Cre ^ERT2 hybridized with Jun-Rosa26 ^LSL/LSL to obtain Myh6-Cre ^ERT2/Jun-Rosa26^LSL/- mice, which are a conditional over-expression mouse model in which tamoxifen induces specific expression of Cre recombinase Cre ^ERT in myocardial cells, which recognizes two LoxPs in LSL and cleaves the terminator in between, allowing Myh6 positive cells to express Jun continuously.

1.2 Target and related sequences

Insertion site gene name (Ensembl): gt (ROSA) 26Sor (ENSMUSG 00000086429), abbreviated as: rosa26, web site link ：http://asia.ensembl.org/Mus_musculus/Gene/Summarydb=core;g=ENSMUSG00000086429;r=6:113067428-113077333;

Insertion site chromosomal location (Ensembl): chromosome 6: 113,076,031;

gRNA is SEQ ID NO. 1;

The 5' homology arm sequence is SEQ ID NO. 2;

the sequence of CAG-LSL-Jun-IRES-EGFP-WPRE-pA is SEQ ID NO 3;

The LSL sequence is SEQ ID NO. 4;

the Jun sequence is SEQ ID NO. 5;

The 3' homology arm sequence is SEQ ID NO. 6.

1.3 F0 and F1 mice acquisition and genotyping

The fertilized eggs after injection are transplanted into pseudopregnant female mice, and the mice born for about 20 days are F0 generation mice. The F0 generation positive mice are mated with wild C57BL/6J mice, F1 generation mice are obtained by breeding, and genotyping is carried out by PCR identification and sequencing, and the identification strategy is shown in figure 2.

The primers, reaction systems and reaction conditions for the PCR identification of the 5 'homology arms are shown in tables 3-1 to 3-3, respectively, and the primers, reaction systems and reaction conditions for the PCR identification of the 3' homology arms are shown in tables 4-1 to 4-3, respectively. The results of PCR identification electrophoresis of 5 'and 3' homology arms of F1 mice are shown in FIG. 3. The PCR identified positive mice as: 9. 11, 15, 16, 19, 20, 21, 22; the sequencing results prove that the samples are positive.

Table 3-1: primers identified by 5' homology arm PCR.

Table 3-2: reaction system for 5' homology arm PCR identification.

* PrimeStar GXL （TaKaRa，Code No：R050A）。

Table 3-3: reaction conditions identified by 5' homology arm PCR.

Table 4-1: primers identified by 3' homology arm PCR.

Table 4-2:3' homology arm PCR identification reaction system.

* PrimeStar GXL （TaKaRa，Code No：R050A）。

Table 4-3: reaction conditions identified by 3' homology arm PCR.

1.4 Subsequent breeding

Myh6-cre ^ERT2/Jun-Rosa26^LSL/- mice were obtained by hybridization of cardiomyocyte-specific cre tool mice Myh6-cre ^ERT2 with Jun-Rosa26 ^LSL/LSL, which were overexpressed. In the subsequent mouse mating propagation process, the genotype of the mouse can be identified by a short-fragment PCR method. PCR identification conditions and primers are shown in Table 5. Exemplary results are shown in fig. 4, wild type: only (P1, P2) amplified 994bp band, (P3, P4) no band; heterozygotes: (P1, P2) amplified 994bp band, and (P3, P4) also amplified 939bp band; homozygote: the (P1, P2) is free of bands, and the (P3, P4) can amplify a small band 939bp.

Table 5: PCR identification conditions and primers.

Example 2: jun expression efficiency detection.

The Jun expression of Myh6-cre ^ERT2/Jun-Rosa26^LSL/- mice obtained in example 1 was examined. We found that mice died around 6 days of tamoxifen induction (fig. 5, a). First, we examined the overexpression efficiency of mice, on the fifth day of tamoxifen administration, cardiomyocytes were isolated from mice, and RNA was extracted and assayed for Jun expression level (primer F: CAGTCCAGCAATGGGCACATCA (SEQ ID NO: 15), primer R: GGAAGCGTGTTCTGGCTATGCA (SEQ ID NO: 16)) by real-time quantitative Polymerase Chain Reaction (PCR), and found that the expression level of cardiomyocyte Jun in Myh6-cre ^ERT2/Jun-Rosa26^LSL/- mice was up-regulated approximately ten times as much as that in the control group (FIG. 5, B). Next, we also demonstrated that Jun was expressed more highly in Myh6-cre ^ERT2/Jun-Rosa26^LSL/- mouse heart slices at the protein level by immunofluorescent staining (fig. 5, c), while we stained Myh6-cre ^ERT2/Jun-Rosa26^LSL/- mouse lung tissue slices and heart slices with Tag, GFP, indeed only heart slices detected GFP expression, in order to further rule out if Myh6-cre ^ERT2 mouse cre was sufficiently specific, to rule out the possibility that Jun was highly expressed in other tissues (fig. 5, d), from which we concluded that Myh6-cre ^ERT2/Jun-Rosa26^LSL/ could achieve Jun cardiomyocyte specific overexpression.

Example 3: and detecting the change of the contraction function.

Myh6-cre ^ERT2/Jun-Rosa26^LSL/- mice developed acute death within six days of tamoxifen induction (fig. 6, a), we first hypothesized that mice developed acute heart failure, and therefore we examined changes in the contractile function of mice. We found that the systolic function assessment index Ejection Fraction (EF) and short axis shortening (FS) did not change significantly, although a slight decrease occurred on day five, but not lethality (fig. 6, b-D), except that we found that the structural parameters of the mice, including left ventricular weight (fig. 6,E), end diastole heart volume (fig. 6, f) and end systole heart volume (fig. 6, g) did not change significantly. These results suggest that our mice develop heart failure that is non-contractile and that acute death of the mice may occur, clinically, in diastolic heart failure and explosive myocarditis.

Example 4: and detecting morphological changes.

Next, we will further determine the cause of death in mice, we draw the heart of mice, HE stain suggesting that heart tissue is not infiltrated with a large number of immune cells, thus excluding the possibility of developing explosive myocarditis in mice. Secondly, we found that the mouse atrium of Jun-OE became larger and severe congestion occurred (fig. 7, a), and cardiac ultrasound results also suggested that the mouse left atrium of Jun-OE became significantly larger (fig. 7, c), the mice were further dissected, we found that Jun-OE mice developed severe lung congestion five days before death after tamoxifen induction (fig. 7,D), and the wet dry weight of the lung was calculated, and found that the wet dry weight ratio of the lung was significantly increased (fig. 7, b), as expected, further demonstrated that mice died due to heart failure, and that the lung tissue sections were HE and EVG staining again demonstrated severe lung congestion after adult mouse cardiomyocyte Jun overexpression (fig. 7, e).

Example 5: and detecting diastolic function change.

Experiments prove that after the myocardial cells Jun of the adult mice are over-expressed, the contraction function and structural parameters are not obviously changed, death caused by explosive myocarditis is also eliminated, atrial enlargement congestion occurs, serious pulmonary congestion occurs, and comprehensively considered, the heart failure of the mice with diastolic dysfunction, namely heart failure with reserved ejection fraction, is guessed, so that the diastolic function evaluation indexes (E/E' and E/A) of the mice are detected. As we predicted, myh6-cre ^ERT2/Jun-Rosa26^LSL/- mice did not significantly change on the third day after tamoxifen induction, but on the fourth through fifth days, the mice had significantly abnormal diastolic function, i.e. the E/a value and the E/E' value were significantly increased on the fourth day, and the fifth day was exacerbated (fig. 8, a-C). Thus, we can conclude that heart failure with acute ejection fraction retention in mice resulted in death of mice after overexpression of cardiomyocyte Jun in adult mice.

Example 6: and (5) monitoring electrocardiogram change.

Based on the experimental data in the above examples, it was confirmed that heart failure with ejection fraction retention occurred after the overexpression of adult mouse cardiomyocyte JUN. At the same time, we found that the phenotype of this model was consistent with clinical features of heart failure with retention of ejection fraction with atrial fibrillation, including atrial enlargement, pulmonary congestion, high mortality, etc., and therefore we dynamically monitored changes in electrocardiogram of Jun overexpressing mice in real time and tried clinical drug trials for heart failure patients with retention of ejection fraction with atrial fibrillation. Based on monitoring of real-time dynamic electrocardiography we found that atrial fibrillation occurred after the fourth day after mouse Jun overexpression, specific symptoms including arrhythmia and P-wave disappearance (fig. 9).

Overexpression of Jun by adult cardiomyocytes produced HFpEF with atrial fibrillation phenotype with significant change in diastolic function, phenotype conforming to clinical end-stage characteristics, and no differences in female and male mice.

Example 7: comparison of HFpEF model generated by Jun overexpression with clinical patients.

And (3) combining the RNA sequencing results of the myocardial cell Jun-OE mouse sample and the corresponding control sample with the RNA sequencing results （Hahn VS, et al. Myocardial Gene Expression Signatures in Human Heart Failure With Preserved Ejection Fraction. Circulation. 2021;143(2):120-134.）, of the HFpEF patient biopsy right chamber published in the literature and the RNA sequencing results of the normal human sample to perform sample similarity cluster analysis. The results showed that the Jun overexpressed samples and human HFpEF samples were well pooled, while the control and human normal samples of the mouse samples were well pooled (fig. 10, ab), demonstrating that the HFpEF characteristics produced by the Jun overexpression of mouse cardiomyocytes were very similar at the transcriptome level to the transcriptome characteristics of the clinical HFpEF patients. Meanwhile, in the human HFpEF sample, jun is also highly expressed, and the expression trend of AP1 family in mouse Jun over-expression is consistent with the expression trend of human HFpEF (FIG. 10, C), all the evidences suggest that Jun participates in the occurrence and development of HFpEF diseases, and the result of mouse myocardial cell Jun over-expression not only accords with clinical HFpEF characteristics in heart physiological and pathological characteristics, but also accords with clinical HFpEF characteristics in transcriptome molecular characteristics.

Although specific embodiments of the invention have been described in detail, those skilled in the art will appreciate that: many modifications and variations of details may be made to adapt to a particular situation and the invention is intended to be within the scope of the invention. The full scope of the invention is given by the appended claims together with any equivalents thereof.

Claims

1. A method of preparing a non-human animal model of heart failure with preserved ejection fraction, the method comprising overexpressing a Jun gene in the non-human animal.

2. The method of claim 1, wherein the method comprises introducing into the non-human animal an exogenous expression cassette comprising a Jun coding sequence.

3. The method of claim 2, wherein the exogenous expression cassette is present on a viral vector.

4. The method of claim 3, wherein the viral vector is a lentiviral vector, an adenovirus vector, an adeno-associated virus vector, a poxvirus vector, or a herpes simplex virus vector.

5. The method of claim 1, wherein the Jun gene is overexpressed in heart tissue of the non-human animal.

6. The method of claim 5, wherein the over-expressing Jun gene in heart tissue is achieved by Cre-LoxP recombination system, comprising the steps of:

(2) Crossing the first non-human animal and the second non-human animal to obtain offspring, selecting offspring comprising both the first genetic modification and the second genetic modification.

7. The method of claim 6, wherein the Cre recombinase is an inducible Cre recombinase, the method further comprising: the progeny inducer is administered to induce heart-specific overexpression of the Jun gene.

8. The method of claim 7, wherein the inducible Cre recombinase is estrogen inducible and the inducer is tamoxifen or 4-OHT.

9. The method of claim 6, wherein the safe harbor locus is the Rosa26 locus, the H11 locus, the TIGRE locus, or the Col1a1 locus.

10. The method of claim 6, wherein the heart-specific gene is Myh6 gene.

11. The method of any one of claims 1-10, wherein the non-human animal is a rodent.

12. The method of any one of claims 1-10, wherein the non-human animal is a mouse.

13. Use of a non-human animal model prepared according to the method of any one of claims 1-12 for screening for a medicament for preventing and/or treating heart failure with preserved ejection fraction or for studying heart failure with preserved ejection fraction.

14. A vector comprising an expression cassette comprising a LoxP-Stop-LoxP (LSL) sequence and a Jun coding sequence.

15. The vector of claim 14, wherein the Jun gene is located downstream of the LSL sequence.

16. The vector of claim 14, wherein the expression cassette further comprises an operably linked promoter.

17. The vector of claim 14, wherein the expression cassette further comprises a reporter gene linked to the Jun gene.

18. The vector of claim 14, wherein the expression cassette is flanked by 5 'and 3' homology arms.

19. A kit comprising the vector of any one of claims 14-18.

20. The kit of claim 19, wherein the kit further comprises a second vector comprising an expression cassette comprising a Cre recombinase coding sequence.

21. The kit of claim 20, wherein the expression cassette is flanked by 5 'and 3' homology arms.

22. The kit of claim 20, wherein the Cre recombinase is an inducible Cre recombinase.

23. Use of the vector of any one of claims 14-18 or the kit of any one of claims 19-22 for the preparation of a non-human animal model of heart failure with preserved ejection fraction.