CN1181783A

CN1181783A - Medical composition

Info

Publication number: CN1181783A
Application number: CN96193359A
Authority: CN
Inventors: H·弗洛德伽德; P·B·拉斯姆森
Original assignee: Novo Nordisk AS
Current assignee: Loyco Tech A/S
Priority date: 1995-03-09
Filing date: 1996-03-11
Publication date: 1998-05-13
Anticipated expiration: 2016-03-11
Also published as: AU4784896A; CA2214799A1; CN1099462C; WO1996028544A1; AU716791B2; JPH11501636A; NO974123D0; EP0871721A1; NO974123L

Abstract

The present invention relates to a pharmaceutical composition for the prevention or treatment of diseases or conditions involving stress injury to cells, the composition comprising (a) a lipid-containing substance having a lipid portion which is structurally identical with or analogous to a ceramide, conjugated to (b) a protein capable of binding said lipid-containing substance in such a way that, when the conjugate is contacted with living cells, the lipid-containing substance activates a ceramide-activated protein phosphatase resulting in down-regulation of cellular metabolism, and (c) a pharmaceutically acceptable diluent or carrier.

Description

Medicinal compositions

A kind of albumen-lipid conjugates is made up of heparin-binding protein (HBP) and the similar thing of a kind of ceramide, and this conjugate medicinal aspect the disease treatment that relates to cellular stress damage.

By the septic shock due to severe infections, for example, infect with the cytokine cascade activated or the Gram-negative microbemia of inflamed sites (as the abdominal cavity) in the past the sickness rate in 50 years increasing always, and, be the modal cause of death of being paid close attention in the U.S. at present.The reason of above-mentioned increase and septic shock is considered to such as the extensive application of the widespread use of blood vessel interpolation pipe, cytotoxicity and immunosuppressive drug, easily to suffer from pyemic patient's life-time dilatation and the increase of the infection that caused by the antibiotics resistance biology.

The disease relevant with Sepsis has microbemia (being known as septicemia again) to it is characterized by the positive blood culture; Being the Sepsis of feature to the systemic reaction that infects, its manifestation for be short of breath, tachycardia, high temperature, low temperature; Septic syndrome wherein, has pyemic clinical symptom and altered organ perfusion's sign, and it shows as the mental status of the increasing unusually of lactic acid content, oliguresis or acute change; The early sepsis shock that wherein has the syndromic clinical evidence of septicemia, and continue to respond less than 1 hour ypotension with to routine treatment; And the intractable septic shock, wherein, have the syndromic clinical symptom of septic, although and take the conventional treatment ypotension also to continue more than 1 hour.

High mortality that continues that is caused by gram negative sepsis and sickness rate have promoted the further investigation to the therapeutical agent of the lethal effect that can resist circulation bacterium LPS.Numerous reported in literature the remarkable therapeutic action of taking immunoglobulin (Ig) of heavy dose of intravenously.But, this treatment need come from screening a large amount of anti-core LPS antibody of natural existence donor blood plasma or come from the IgG of jumpbogroup donor (＞1000).The monoclonal antibody (for example WO 88/03211) that is proposed to be used in the bacteremic anti-LPS of treatment shows less effect or does not have effect, may be because its cytokine cascade that can not suppress to be brought out by LPS reacts.In addition, have less sepsis patient to show circulation endotoxemia and microbemia, therefore, the antibody of the circulation LPS that can neutralize is not suitable for the pyemic position of appearance.

Universals that produce in high vertebrates because of secular oxygenizement are mild oxidation stress reactions.Under normal circumstances, the effective defence system of being made up of the arsenic foreign material of the complexity of antioxidant can guarantee that this bioenergy handles oxyradical by keeping balance between oxyradical and the antioxidant.But, infecting or the injury, killing a large amount of aggressive oxidation base (oxyradical) of the foreign pathogens that causes the intrusion infected by phagocytic cell (activated neutrophil, scavenger cell and monocyte) secretion.At these positions, the generation of oxyradical is considerably beyond the resistance of oxidation of peripheral cell, and these cells are dead impaired or dead because of necrosis or program that oxyradical causes.

Infecting or damaged portion, trigger cell factor cascade reaction, this reaction activates neutrophil again.The initial son (in gram negative bacterium) of cytokine cascade reaction is (to be known as lipopolysaccharides again at the intracellular toxin that infects or inflamed sites is disengaged, be called for short LPS), at these positions, it can induce scavenger cell and other cell to disengage tumor necrosis factor alpha (TNF α), il-1, interleukin-6, interleukin-8 and white platelet incitant (PAF).After disengaging TNF α, il-1 and PAF, arachidonic acid is generated leukotrienes, thromboxane A by metabolism ₂And prostaglandin(PG).Il-1 and interleukin-6 can activate the T-cell and produce interferon-, interleukin-2, interleukin-4 and granulocyte-monocyte G CFS.Most of above-mentioned amboceptors can directly activate neutrophil.Therefore, during threshing the damage that neutrophil brings out can take place, this damage is that the release because of oxyradical and lysosomal enzyme causes, or betide infect or the congregation of inflamed sites during.

Although the molecule mechanism of the beginning of the cytokine cascade reaction of decision LPS mediation still imperfectly understands, recently cells involved factor TNF α, vitD ₃With the report of the signal transduction of INF-γ these phenomenons are enlightened to some extent.

Confirmed cytokine vitD ₃Can promote the generation of ceramide in the HL-60 cell in conjunction with the neutral sphingomyelinase enzyme by stimulating film with INF-γ, this kind of enzyme can be hydrolyzed into the film sphingophospholipid ceramide and phosphorylcholine (referring to T.Okazaki etc., J.Biol.Chem.265,1990, pp.15823-15831).Confirmed that ceramide is the second messenger, it can activate again conversely belong to X Ser/Thr Pro protein kinase family ceramide activated protein kinase (referring to S.Mathias etc., Proc.Natl.Acad.Sci.USA 88,1991, pp.10009-10013).Confirm that also ceramide can activate ceramide activated Ser/Thr phosphoprotein phosphatase (referring to R.T.Dobrowski and Y.A.Haunun, J.Biol.Chem.267,1992, pp 5048-5051).Confirmed that above-mentioned initial action can cause further signal transmission in complex body, and as relatively poor understanding mode, related to the activation of map kinase cascade reaction, transcribing of the factor of stimulation such as c-Myc and c-Fos activates NF-KB and stimulation and causes PLA ₂Form arachidonic acid derivatives.

Lipoprotein in circulation conjugated protein (LBP) can and mediate combining of LPS and specific C D14 acceptor in conjunction with LPS.In the LPS signal transduction research that the nearest CD14 acceptor by on the HL-60 cell causes, confirmed that LPS can stimulate its cellular response, for example, start the cytokine cascade reaction by the acid amides activated protein kinase that excites nerve.Structural analysis confirms, the terminal part of partial reduction of the lipid A part of LPS with ceramide highly close (referring to C.K.Joseph etc., J.Biol.Chem.269,1994, pp.17606-17610).Therefore, look it is to produce its activity by the ceramide approach that enters cell by LPS.

Be surprised to find already, LPS with LBP outside other albumen can be when puting together to be different from second messenger's function of the alternate manner analog neuron acid amides that activates ceramide activated protein kinase.

Therefore, the present invention relates to a kind of medicinal compositions that is used to prevent or treat the stress damage that relates to cell, said composition comprises

What (a) have a lipid part contains the fat material, and it is structurally same or similar with ceramide,

Its put together in

(b) a kind of can be as follows in conjunction with the described albumen that contains the fat material, when this conjugate contact viable cell, contain fat substance activating ceramide activated phosphoprotein phosphatase, cause the downward modulation of cellular metabolism, and

(c) a kind of diluent or carrier that can be medicinal.

On the other hand, the present invention relates to a kind of prevention or treatment and relate to the disease of stress damage of cell or the method for symptom, this method comprises that patient to this treatment of needs takes significant quantity

Its put together in

(b) a kind of can be as follows in conjunction with the described albumen that contains the fat material, when this conjugate contact viable cell, contain fat substance activating ceramide activated phosphoprotein phosphatase, cause the downward modulation of cellular metabolism.

Again on the one hand, the present invention relates to

Its put together in

(b) a kind of can be as follows in conjunction with the described albumen that contains the fat material: when this conjugate contact viable cell, contain fat substance activating ceramide activated phosphoprotein phosphatase, cause the downward modulation of cellular metabolism to be used to produce being used to preventing or treat the purposes of the medicine of the disease of the stress damage that relates to cell or symptom.

In a kind of preferred embodiment, in the composition of the present invention as with contain the heparin-binding protein (HBP) that albumen that the fat material puts together contains the glycosylation form, its apparent molecular weight is 28kD (measuring by SDS-PAGE under reductive condition), and this albumen is to produce in the azurophil granule of polymorphonuclear leukocyte.

The covalent structure of having measured isolating heparin-binding protein in the periphery neutrophil of people and pig recently is (referring to H.Flodgaard etc., Eur.J.Biochem.197,1991, pp.535-547; J.Pohl etc., FEBS Lett.272,1990, p.200ff).People and pig albumen and neutrophilia elastoser have high similarity, but because the selection of active ser 195 and Histidine 57 sudden change (chymotrypsin numbering (B.S.Harrtley, " Homologies in SerineProteinases ", Phil.Trans.Roy.Soc.Series.257,1970, p.77ff.), this hypoproteinosis protease activity.This albumen is called as people's heparin-binding protein (hHBP) and pork liver element conjugated protein (pHBP) respectively, because of it has high-affinity to heparin; Schafer etc. (W.M.Schafer etc., Infect.Immun.53,1986, ff. P.651) are called cationic antimicrobial proteins (CAP37) according to its antimicrobial acivity with this albumen, and this albumen also shows 1.3 * 10 ^-9M-10 ^-8In the M scope to monocytic chemotactic (H.A.Pereira etc., J.Clin.Invest.85,1990, p.1468.ff) consistent with the result of Flodgaard etc., see below.

In addition, confirmed that HBP can mediate endotheliocyte and fibroblastic desorption and contraction, when it is added in this cell that grows in the monolayer culture thing.HBP can also stimulate monocytic survival and thrombospondin secretion (E. φ stergaard and H.Flodgaard, J.LeukocyteBiol.51,1992, p316ff).

From azurophil granule, also be separated to the albumen of a kind of azurocidin of being called as, its preceding 20 N terminal amino acid residues and hHBP and CAP37 identical (J.E.Gabay etc., Proc.Natl.Acad.Sci.USA 86,1989, p5610ff; CG.Wilde etc., J.Biol.Chem.265,1990, p.2038ff.), and reported its antimicrobial property (D.Campanelli etc., J.Clin.Invest, 85,1990, p.904ff.).

The existence of h HBP and these fact (H.A.Pereira etc. of CAP 37 (identical) of when this leukocytes phagocytic streptococcus aureus, disengaging 89% in the neutrophil with h HBP, see below) show, one of effect of h HBP relates to inflammatory process, because this albumen obviously disengages from the activatory neutrophil(e) cell.Pereira etc. (seeing below) propose, and one of effect of CAP 37 is that it can adsorb monocyte specifically in inflamed sites, is to determine second to take turns one of factor of monocytic inflow in the inflammation therefore.φ stergaard and Flodgaard (seeing below) propose, and HBP also plays an important role in neutrophil and monocytic exosmosing except important to monocytic collection.

Because neutrophil is first cell of invading inflammation or infection site; it secretes HBP at this position; by the cell desorption of HBP mediation and the homotypic aggregation of following cellular metabolism to reduce, may be the protection mechanism of the another kind opposing cell injury between inflammation or period of infection.The one, infect beginning, the stroma cell of surviving because of the effect of HBP from response to oxidative stress can reenter at any time and invade inflamed sites, and the formation healing process, this process is adsorbed on by a series of complexity, by HBP that the monocyte of inflamed sites and scavenger cell excretory somatomedin and effect of cytokines cause.

The structure of HBP sees in the document of (seeing below) such as WO89/08666 and H.Flodgaard.HBP be known as again CAP 37 (seeing WO91/00907) and azurocidin (see C.G.Wilde etc., J.Biol.Chem.265,1990, p.2038).

With contain the HBP that fat material (may be LPS or ceramide) puts together and be considered at present to reduce cellular metabolism.As if the LPS that puts together with HBP can not put together with LPS acceptor CD14, but can put together with cell surface owing to the Suleparoid binding motif of HBP.The most recent measurements of the rapid absorption of the HBP that neutrophil is produced from monocyte supports the HBP-ligands specific on the monocyte to be different from (Heinzelmann, M. etc., Criticalcare, 1996 (the waiting to deliver)) from CD14 equally.LPS is admitted to cytolemma and contacts with the signal conduction organ of cell subsequently, finally activates ceramide activated phosphoprotein phosphatase.The activation of Phosphoric acid esterase can cause the downward modulation of cellular metabolism conversely again.The interpolation external source ceramide of having reported makes its become water soluble and this hypothesis of the permeable support of film, and the molecular energy of caproyl adding Swiss 3T3 cell causes the metamorphosis such as contraction, desorption and homotypic aggregation, but can preserve cell activity.Ceramide is the crucial instrumentality of antiproliferative and apoptosis approach seemingly, and as albumen transportation and excretory inhibitor, these phenomenons all activation with the TNF α that is undertaken by 75kD TNF α acceptor-inductive ceramide activated phosphoprotein phosphatase are relevant (referring to Y.A.Hannun, J.Biol.Clem.269,1994, pp.3125-3128).It shows, as the analogue of ceramide, and the LPS acid amides activated phosphoprotein phosphatase that after puting together, can excite nerve similarly with HBP.

Therefore; conjugate by preparation HBP and LPS (or similarly containing the fat material); can provide a kind of can be used for the regulating essential cytokine activated defence (causing) of cell and the equilibrated medicinal compositions between endotheliocyte, smooth muscle cell and the fibroblastic protection (acid amides activated phosphoprotein phosphatase causes by exciting nerve), by cell proliferation and active the carrying out that suppresses inflamed sites by stimulating monocyte ceramide activated protein kinase.May need this equilibrated adjustment in the harm of cytophylaxis organ during greater than benefit.HBP/LPS causes the dormancy phenotype of these cells to the direct effect of endotheliocyte, inoblast and the smooth muscle cell of inflamed sites, is subjected to stress damage and keeps it to be in the state that repair process is carried out in beginning at any time that infects at any time in case can prevent it.

HBP is to come from Mammals, and particularly people or pig are advisable.Particularly, this HBP is the people HBP with aminoacid sequence shown in the sequence 1 in the sequence table, or has the pig HBP of aminoacid sequence shown in the sequence 2 in the sequence table, or it can be in conjunction with lipid A sense analogue or the peptide fragment partly of LPS.The example of this sense analogue comprises the derivative of described native protein, this derivative can obtain like this: at the C-of native protein or N-is terminal or simultaneously at C-and terminal one or several amino-acid residue that adds of N-, replace one or several amino acid in the one or both ends of this native protein, in the one or both ends of this native protein or one or several site in its aminoacid sequence lack one or several amino-acid residue, or insert one or several amino-acid residue on one or several site in natural acid sequence.

Can prepare HBP with the method that is disclosed among the Danish Patent Application No.1452/94.More particularly, can be with the standard method of setting up by the synthetic dna sequence dna for preparing coding HBP, (Tetrahedronletters 22 as the phosphoramidite method by S.L.Beaucage and M.H.Cauthers disclosure, 1981, pp 1859-1869), or the method that discloses by Matthes (EMBOJournal 3,1984, pp.801-805).According to the phosphoramidite method synthetic oligonucleotide, for example synthetic on an automatic dna synthesizer, purifying, annealing, connect and be cloned on the suitable carriers.

Described dna sequence dna also can be genomic or cDNA, for example, can use standard technique (referring to Sambrook etc., Molecular Cloning:A Laboratory Manual, 2nd Ed., Cold Spring Harbor, 1989) obtain described DNA: preparation genome or cDNA library also pass through to use the synthetic oligonucleotide probe hybridization to screen the dna sequence dna of coding all or part HBP.Described dna sequence dna also can be by the polymerase chain reaction with the preparation of special primer, for example, as at US 4,683, in 202 or by R.K.Saiki etc. at Science 239,1988, described in the pp.487-491.

Then this dna sequence dna is inserted in a kind of recombinant expression vector, described carrier can be any carrier that can carry out recombinant DNA method easily.The selection of carrier usually depends on that carrier will import host cell wherein.Therefore, described carrier can be a kind of carrier of self-replicating, and promptly as the carrier of extrachromosomal element existence, it duplicates and is independent of THE REPLICATION OF CHROMOSOME, for example plasmid.In addition, described carrier can be such, is integrated into when it is imported into host cell on the host genome and with its karyomit(e) of integrating and duplicates.

In described carrier, the dna sequence dna of coding HBP should be operably connected to suitable promoter sequence.Described promotor can be any dna sequence dna, and it has transcriptional activity in selected host cell, and can come from coding and host cell homology or allogenic proteic gene.The suitable promotor that is used for instructing the DNA of coding HBP to transcribe at mammalian cell is SV40 promotor (Subramani etc., Mol.Cell.Biol.1,1981, pp.854-864), MT-1 (metallothionein gene) promotor (Palmiter etc., Science 222,1983, pp.809-814) or adenovirus 2 major late promoters.The promotor that is applicable to insect cell be the polyhedrin promotor (Vasuvedan etc., FEBS lett.311,1992, pp.7-11).The promotor that is applicable to yeast host cell comprises from Yeast sugar separates gene (Hitzeman etc., J.Biol.Chem.255,1980, pp.12073-12080; Alber and Kawasaki, J.Mol.Appl.Gen.1,1982, pp419-434) or alcohol dehydrogenase gene (Young etc., Genetic Engineering of Micro-organisms for chemicals (Hollaender etc. work), Plenum Press, New York, 1982) promotor, or TPI1 (US 4,599,311) or ADH2-4C (Russell etc., Nature 304,1983, pp.652-654) promotor.The example that is applicable to the suitable promotor of filamentous fungal host cell have the ADH3 promotor (McKnight etc., The EMBO J.4,1985, pp.2093-2099) or the tpiA promotor.

The dna sequence dna of coding HBP also can be operably connected on the suitable terminator, as human growth hormone terminator (Palmiter etc., see below) or (being used for fungal host) TPI1 (Alber and Kawasaki see below) or ADH3 (Mcknight etc. see below) promotor.Described carrier also can comprise such as polyadenylation signal (for example, from SV40 or adenovirus 5Elb fragment), transcribe enhancement sequences (as the SV40 enhanser) and the translation enhancement sequences (for example sequence of encoding adenovirus VA RNAs) the factor.

Described recombinant expression vector also can comprise the dna sequence dna that described carrier is duplicated in relevant host cell.An example (when this host cell is mammalian cell) of this sequence is the replication orgin of SV40.Described carrier can also comprise a selective marker, for example, a gene, its product can remedy a kind of defective of host cell, as the gene of the Tetrahydrofolate dehydrogenase of encoding (DHFR) maybe can give the gene of drug resistance, as anti-Xin Meisu, Totomycin or methotrexate.

Be used for connecting respectively the method for dna sequence dna, promotor and terminator of HBP of encoding, and be inserted into and contain the suitable carrier that duplicates required information and be well known to those skilled in the art (, seeing below) referring to Sambrook etc.

The host cell that has wherein imported expression vector can be any cell that can produce HBP, be preferably eukaryotic cell, as invertebrates (insect) cell or vertebrate cells, Xenopus laevis (Xenopus laevis) ovocyte or mammalian cell, particularly insect and mammalian cell for example.Suitable mammal cell line has COS (ATCC CRL 1650), BHK (ATCCCRL 1632, ATCC CCL10) or CHO (ATCC CCL61) clone.The method of transfection mammalian cell and the dna sequence dna that expression imports in host cell is disclosed in the following document, for example, and Kaufman and Sharp, J.Mol.Biol.159,1982, pp.601-621; Southern and Berg, J.Mol, Appl.Genet, 1,1982, pp 327-341; Loyter etc., Proc.Natl.Acad.Sci.USA 79,1982, pp 422-426; Wigler etc., Cell 14,1978, p.725; Corsaro and Pearson, Somatic Cell Genetics, 7,1981, p.603, and Graham and van der E6, Virology 52,1973, p.456; With Neumann etc., EMBO J.1.1982, pp.841-845.

Perhaps, can be with fungal cell's (comprising yeast cell) as host cell.The example of suitable yeast cell comprises yeast or fission yeast bacterium, particularly yeast saccharomyces cerevisiae (Saccharomycescerevisiae) bacterial strain.Other fungal cell's example has filamentous fungus, as the cell of aspergillus tubigensis or Neurospora, particularly aspergillus oryzae (Aspergillus oryzae) or aspergillus niger (Aspergillus niger) bacterial strain.In EP 238 023, disclosed aspergillus tubigensis has been used for protein expression.

The substratum that is used for culturing cell can be anyly to be suitable for the conventional substratum of mammalian cell of growing, as contain appropriate addn serum or serum free medium arranged, or be suitable for growing insect, yeast or fungal cell's suitable culture medium.Suitable medium can be bought from suppliers, or according to disclosed formulation (for example, being disclosed in the products catalogue of ATCC).

From substratum, reclaim HBP with ordinary method then by cells produce, this method comprises by centrifugal or filtration separates host cell from substratum, use salt precipitation supernatant liquor such as ammonium sulfate or the protein composition in the filtrate, carry out purifying by various chromatography methods, as ion exchange chromatography, affinity chromatography etc.

In a kind of preferred embodiment of the present invention, the described fat material that contains is LPS.The LPS that is suitable for being contained in the composition of the present invention can obtain in the cell walls of gram negative bacterium.Perhaps, contain the lipid A part that the fat material can be LPS.Lipid A is suitable for preparing by synthetic lipid X, and lipid X is the precursor of lipid A.The synthetic I.Macher that is disclosed in of lipid X, Carbohydrate Res.162,1987, pp 79-84 and K.Ikeda etc., Chem.Pharm.Bull.35,1987, among the pp.1383-1387.Lipid A is synthetic in that reaction UDP-lipid X under the condition that comes from colibacillary lipid A synthetic enzyme raw product is arranged, as P.L.Stuetz etc. described in " Cellular andMolecular Aspects of endotoxin reactions ", A.Nowotny, J.I.Spitzer and E.J.Ziegler work, 1990, pp.129-145.In addition, containing the fat material can be ceramide.Ceramide belongs to sphingolipid, for the chemical foreign peoples of the compound that contains biomolecules, as phosphoric acid ceramide and galactosylceramide.Preferred ceramide has following structure

Wherein

R ¹Be straight or branched, saturated or unsaturated C _14-30Alkyl, its alpha-position can be replaced by hydroxyl, or in the ω position by saturated or unsaturated C _16-30Fatty acid esterification;

R ^{2 '}Be hydrogen atom or phosphate;

R ³Be C _15-26Alkyl, it is saturated or unsaturated on alpha-position or replaces alpha-position by hydroxyl, and optionally by one or several C _1-14Alkyl replaces, perhaps R ³Be aryl, be preferably phenyl, it can be by hydroxyl, the halogen that comprises F, Cl and Br or methyl substituted;

R ⁴Be hydrogen or hydroxyl.Preferred ceramide has following structure

Wherein, R ¹Be C ₁₄Alkyl, R ²Be hydrogen or hydroxyl or phosphate, R ³Be C ₁₅-alkyl or phenyl, and R ⁴Be hydrogen or hydroxyl.Preferred ceramide is N-hexanoyl sphingosine (C ₆-ceramide).

Can replace carbon 2 (R with the lipid acid of various chain lengths ¹) synthetic various ceramides, as P.VanVeldhoven etc. at Anal.Biochem.183,1989, described in the pp.177-189, he utilize D-red-the acid anhydrides acidylate of sphingosine and the lipid acid of wanting.C3 (R ³, R ⁴) displacement is disclosed in J.Biol.Chem.267 by A.Bielawska etc., 1992, among the pp.18493-18497, and be disclosed in J.Biol.Chem.268 by Bielawska, 1993, among the pp26226-26232.

In medicinal compositions, described conjugate can be with the method preparation of any preparation medicinal compositions of having established, for example in Remington ' s Pharmaceutical Sciences, the method disclosed in 1985.Described composition can be the form be suitable for the injection of part or system or inculcate usually, and can or wait with sterilized water and ooze salts solution or glucose solution prepares.Can be with disinfection technology well-known in the art to described compositions for disinfection.The resulting aqueous solution can packaged use or aseptic condition filter down and freeze-drying, before using, should mix with aseptic aqueous solution by freeze dried preparation.Said composition can contain near the needed auxiliary substance that can be medicinal of physiological condition, adjusts agent etc. as buffer reagent, osmotic pressure, as sodium acetate, and Sodium.alpha.-hydroxypropionate, sodium-chlor, Repone K, calcium chloride etc.The concentration of HBP can in very large range fluctuate, and promptly not enough weight percent is about 0.5%, as 1%, to 15-20%.The unitary dose of said composition contains the HBP of the about 1g of 10mg-that has an appointment usually.

Estimate that composition of the present invention helps therapeutic purpose, as treat inflammation, virus infection, ischemia reperfusion syndrome, bacterial endotoxin mass formed by blood stasis, Sepsis, septic shock, disseminated inravascular coagulation or by activated mononuclear cytositimulation patient's immune system.Therefore, look the severity of being controlled disease and patient's situation, consumption every day of conjugate is advisable for the 1-100mg/kg body weight.

The following examples will the invention will be further described, and these embodiment are not used to limit the scope of the invention.

Example 1

Two sudden change HBP (Cys ^26,42)

LPS binding site both sides on the HBP are 2 halfcystine Cys ²⁶And Cys ⁴²Can not by PCR mutagenesis two halfcystines be changed over Serine in conjunction with the HBP derivative of LPS in order to prepare: in first round mutagenesis, be template, change Cys this moment with transfer organization pVL 1392-HBP ⁴²(CCGCGGCCAGCAGCTTCCAAAGCCAGAACCCCGGGG/PBRa246 (CCGGGGATCCAACTAGGCTGGCCCCGGTCCCGG) prepares two overlapping fragmentses that contain described sudden change separately adopting Pfu polysaccharase and two couples of primer PBRa 247 (CCGGGGATCCGATGACCCGGCTGACAGTCCTGG)/PBRa259 (CCCCGGGGTTCTGGCTTTGGAAGCTGCTGGCCGCGG) and PBRa260.Each fragment with 1/10 adds in the new PCR reaction of adopting primer PBRa246 and PBRa 247.Digest resulting full length DNA fragment with Bam HI, and be connected on the pVL 1393 along correct direction.Confirmed said mutation by order-checking, and with above-mentioned transfer organization called after pVL 1393-HBP-Cys ⁴²Equally in order to change pVL 1393-HBP-Cys ⁴²On Cys ²⁶, in the PCR of above-mentioned new round mutagenesis, use two overlapping primer PBRa 261 (GGCAGGCACTTCTCCGGAGGTGCCCTGATC) and PBRa262 (GATCAGGGCACCTCCGGAGAAGTGCCTGCC) with PBRa 246 and PBRa 247 respectively.Once more with the full length DNA fragment cloning that produced to the BamHI site of pVL 1393, and by order-checking (pVL1393-HBP-Cys ^26,42) confirm described sudden change.With linearizing AcRP 23.LacZ baculovirus DNA (Pharmingen, San Diego) and pVL 1393-HBP-Cys ^26,42Cotransfection SF9 insect cell is isolated pair recombinant baculovirus of sudden change HBP derivatives of encoding.

In order to prepare the HBP of this pair of mutant form, to being grown in 3 * 10 in Grace ' the s substratum (Gibco) that is supplemented with 10%FCS ⁸The SF9 cell carries out centrifugal, and resuspending is in the sample from virus stocks, and to make MOI (infection multiplicity) be 1.This cell transfer with virus is arrived 0.5l Bellco turn flask (#1965-00500) lining, and add new Grace ' the s substratum that has replenished 2%FCS, making final volume is 300ml.The last 1.5g Heparin Sepharose that in this culture, is added in the aseptic 0.9%NaCl mesohigh sterilization of 25ml (CL-6B, Pharmacia).This culture was cultivated 3 days down at 27 ℃.

In order from insect cell culture, to separate Heparin Sepharose pearl, with the speed of 300rpm in the 50ml pipe on a Sorvall Instruments TECHNOSPLN R whizzer with centrifugal 3 minutes of the volume of 400ml.Sucking-off contains the supernatant liquor of cell, and it is different to separate Heparin Sepharose as follows from the contamination of cells of remnants: among the 30ml 0.9%NaCl of resuspending in adding each centrifuge tube, and, centrifugal under 300rpm then.Repeat above whole process 2 times.In each centrifuge tube, add the aseptic 0.5M NaCl of 20ml at last and wash described pearl.Then this pearl is collected in the centrifuge tube of a 50ml, in a small amount of aseptic NaCl of 0.5M (20-30ml), and transfers in the aseptic glass filter funnel.Drain this pearl, and with the final wash-out HBP mutant from this pearl of the aseptic 3M NaCl of 30ml.According to the method purifying HBP mutant from the 3M elutant that is disclosed among the WO 89/08666.

With the LPS binding ability of the method check HBP mutant material that discloses below, do not find the LPS combination.

Analyze the LPS binding ability.

In the aseptic 0.9%NaCl of 155 μ l, carry out the combination experiment, wherein contain bovine serum albumin (Sigma St.Louis Mo) 1mg/ml, 4.5pm[ ³H] lipopolysaccharides, available from e. coli k12 LCD 25 Lot #5102A, specific activity is 1.45 * 10 ⁶Dpm/ μ g, List BiologicalLaboratories, Inc., CA, the HBP mutant of USA and following consumption: 0pmol (contrast), 35pmol, 18pmol and 3.6pmol.This mixture was cultivated 20 minutes under 37 ℃ with water-bath.It is in each sample of 10 μ l that the anti-HBP antibody of 10 μ g rabbit polyclonals is added volume, at room temperature cultivates 60 minutes.At last in being each sample of 50 μ l, volume adds 8mg Protein ASepharose (Pharmacia Sweden).At room temperature cultivated 10 minutes, under 2000 * g, made the anti-HBP antibody of Protein A Sepharose/ complex body precipitation then in centrifugal 5 minutes, by going up the radioactivity of measuring in the supernatant liquor counting available from 100 μ l supernatant samples of each sample at BetaScintillation Counter (Packcard Instrument).According to the mole of supposition to molar reactive, the combination that the counting that is kept by supernatant liquor calculates lipopolysaccharides.

Measure HBP mutant material mediation inoblast and the cell desorption of endotheliocyte and the ability of homotypic aggregation according to the method that discloses by φ stergaard and Flodgaard (seeing below).

Do not observe influence, the conjugate of having supported HBP and LPS is for regulating the necessary viewpoint of described effect.

Example 2

Reorganization wild-type and chimeric HBP

In insect cell (SF.9/BRL) with baculovirus expression system production recombinant human wild-type HBP.Method purifying HBP by above-mentioned (1).

For to inferring that the LPS binding site carries out perturbation and the overall folded that do not change this molecule on the HBP, make up the chimeric form of HBP.The ring that comprises aa26-42 (HBP numbering) at the proteolytic enzyme of class chymotrypsin protein enzyme is alterable height (2).Once the someone provided the effect site among the HBP to be positioned at this ring, and this ring also comprises LPS binding site (2).Pereira etc. (2) have confirmed in this ring except the importance of conservative halfcystine bridge, the RH motif among the sequence QGRHF before first C of this ring to LPS in conjunction with also very important.

In order to prepare a kind of molecule of the LPS of shortage bonding force, and don't influence the overall structure of this molecule, import the ring that contains less polare Aminosaeren at same position by another kind of serine protease.The kallikrein sequence YSSPQ of pig satisfies this requirement.As if in addition, this encircles with the packing of this molecule rest part very identical, be by molecular simulation deduction and next with Portage Quanta program.Therefore, the chimeric form of HBP is at Cys ²⁶There are 5 amino acid QGRHF to be replaced by YSSPQ before.

Endotheliocyte is cultivated

Separate and cultivator huve cell (HUVEC) with improved (4) aforesaid methods (3).Briefly, umbilical cord is collected in no Ca ²⁺And Mg ²⁺PBS in and store down at 4 ℃ up to cellular segregation.Described umbilical cord used in 24 hours.With no Ca ²⁺And Mg ²⁺PBS described vein is carried out rinsing, the collagenase that is diluted among the PBS with the final concentration with 70U/ml is cultivated down at 37 ℃ then.Carry out centrifugal to the cell that disengages, be suspended in the substratum 199, add foetal calf serum (8%), bovine serum (8%), heparin (16U/ml), endothelial cell growth supplement (25 μ g/ml) and microbiotic (penicillin 83U/ml, Streptomycin sulphate 83 μ g/ml and amphotericin B 83 μ g/ml) in this substratum, and be inoculated into the 83-cm that uses by 2% gelatin precoating of PBS preparation ²In the flask.Cultivate after 3-7 days, (0.05%: 0.5mM) pair cell carries out desorption, and is inoculated in 48 orifice plates with trypsinase-EDTA.In some experiments, once went down to posterity before in seeding cells into 48 orifice plates.Before expressing the cobblestone form, use this cell then.

Protein phosphorylation in intact cell

The HUVECs that is paved with that will grow in 48 orifice plates with no phosphoric acid buffer washs twice, and this damping fluid is by glucose (5.56mM), NaCl (117.2mM), CaCl ₂(1.8mM), MgCl ₂(0.81mM), KCl (5.36mM), NaHCO ₃(17.9mM) and HEPES (10mM) form, pH7.4, then in the no phosphoric acid buffer of the heat inactivation serum that has replenished 10% people 37 ℃ down with 25 μ Ci ³²PO ₄Cultivated together 30 minutes.This reagent is added among the HUVECs, and cultivated again 30 minutes.In 10% methyl-sulphoxide, dilute okadaic acid, and use with the okadaic acid final concentration of 1 μ M in 0.16% methyl-sulphoxide.Ceramide is dissolved in ethanol: in the dodecane (98: 2 v/v) (13), the final concentration of ethanol and dodecane is respectively 0.98% and 0.02%.In all were cultivated, the final concentration of people's heat inactivation serum was 10%.When experiment finished, the no phosphoric acid buffer washing HUVECs twice with iced washed 1 time with iced PBS.In described hole, add and contain the electrophoresis sample buffer (190 μ l) (14) of 5%SDS, and at room temperature on shaking table, the HUVEC cracking is spent the night.

³²PO ₄The proteic separation and the analysis of-mark

Reduce with beta-mercaptoethanol (5%) ³²PO ₄The albumen of-mark, and by 4-16%SDS polyacrylamide gel electrophoresis (SDS-PAGE) separation (5).With the coomassie orchid running gel is dyeed, dry and to x-ray film or Fuji's development board to explosure.(Japom) radioalbumin that manifests of the 18-90Mr scope on the gel of last subtend Fuji showing board exposure carries out quantitative analysis for Fuji Photo Film Co.Ltd, Tokyo at a BioImaging Analyzer Bas 2000.Radioactivity provides with the per-cent form of contrast.Calculate radioactive mean change of selected protein band (albumen that the 3-7 kind is different).

The LPS of chimeric HBP is in conjunction with activity

The previous avidity (6) of wild-type HBP that confirmed to LPS.The improvement that utilizes previously the method that is disclosed by (7) such as Tobias combines mosaic type and wild-type HBP and the LPS that is fixed on the titer plate.In brief, with the amount of 4 μ g/ hole LPS titer plate is applied under 37 ℃ and spend the night, described LPS is dissolved among 50mM boric acid (pH 9.0) and the 20mM EDTA.HBP is with in combining of the hole that was not coated with is also included within, to measure non-specific combination.With distillation, deionized water titer plate is thoroughly washed, dry under 37 ℃, with 5mg/ml utmost point low endotoxin bovine serum albumin sealing 30 minutes, described albumin was made in no thermal source PBS then.In the test damping fluid described plate is washed 4 times then, described damping fluid is made up of no thermal source 50mM Tris (pH7.4), 500mM NaCl, 1mg/ml utmost point low endotoxin bovine serum albumin and 0.05%Tween-20.Respectively in the test damping fluid to wild-type reorganization [ ¹²⁵I] HBP and mosaic type [ ¹²⁵I] HBP dilutes, and making its specific activity is 5322 and 5445cpm/ng HBP, and the concentration to indicate, adds in the hand-hole with the cumulative volume of every hole 100 μ l.Cultivated 1 hour down at 37 ℃, in the test damping fluid, plate is washed 3 times then, in each hole, add 100 μ l 20%SDS, at room temperature shook then 10 minutes.In γ-counter (Packard Instrument), measure the radioactivity of SDS solution.HBP is different with wild-type, only has a spot of chimeric HBP to combine (Fig. 1) with fixed LPS.

Statistical analysis

The significance of difference between the determination experiment group.By the Kruskal-Wallis One-way ANOVA data are tested, then with the multistage comparison of Mann-Whitney U-check carrying out, or single with Mann-Whitney U-check.The result with arithmetical mean+/-the SD. form provides.P-value＜0.05 is significant from statistics.

Mosaic type HBP lacks the LPS bonding force

Before we confirmed, and wild-type HBP can be in conjunction with LPS (6).In order to study combining to the importance of protein phosphatase effect how of LPS and HBP to HBP, make up a kind of can not be in conjunction with the mosaic type LPS (Fig. 1) of LPS.HBP is opposite with wild-type, and mosaic type HBP can not reduce protein phosphorylation effect (Fig. 2) in the endotheliocyte, shows that a complete LPS is certain in essential to the influence of protein phosphorylation effect in conjunction with the territory among the HBP.By the decline of the caused protein phosphorylation effect of wild-type HBP (50 μ g/ml) obviously be different from mosaic type HBP (50 μ g/ml) and contrast (n=4, p=0.0209).Above-mentioned experiment is to carry out under the condition that okadaic acid (1 μ M) arranged, and has obtained similar results (result does not deliver) under the condition of no okadaic acid.

Fig. 1. mosaic type HBP not with combined with lipopolysaccharide.Right ¹²⁵1 hour of carrying out of the wild-type of I-mark and mosaic type HBP and LPS on being fixed in titer plate combines to be studied, and experiment is carried out twice.Be incorporated on the LPS wild-type HBP dose-dependently, and only find that a small amount of mosaic type HBP combines with LPS.Provide among the figure be in the experiment two multiple in conjunction with mean value.

Fig. 2. the mosaic type HBP that lacks combined with lipopolysaccharide power can not reduce the protein phosphorylation effect.Endotheliocyte is used ³²PO ₄Mark 30 minutes, single then with okadaic acid (1 μ M) or with okadaic acid with indicate that the wild-type HBP of concentration or mosaic type HBP cultivated 30 minutes again.Separate radioalbumin by 4-16%SDS-PAGE, and analyze with a Phospho-Imager.Provided the mean value ± SD of 4 experiments.The result shows that HBP is different with wild-type, and mosaic type HBP can not reduce protein phosphorylation effect (Fig. 6 B).After Kruskal-Wallis check, carry out Mann-Whitney U-check, wild-type HBP (50 μ g/ml) obviously be different from mosaic type HBP (50 μ g/ml) and contrast (n=4, P=0.0209).

Reference

1.Flodgaard, H., Ostergaard, E., Bayne, S., Syendsen, A., Thomsen, J., Engels, M. and Wollmer, A. (1991) Eur.J.Biochem.197,535-547

2.Pereira, H.A., Erdem, I., Pohl, J. and Spitznagel, J.K. (1993) Proc.Natl.Acad.Sci.USA 90,4733-4737

3.Jaffe, E.A., Nachman, R.L., Becker, C.G. and Minick, C.R. (1973) J.Clin.Invest.52,2745-2756

4.Thornton, S.C., Mueller, S.N. and Levine, E.M. (1983) Science 222,623-625

5.Laemmli，U.K.(1970)Nature?227，680-685

6.Flodgaard, H and Goriche, C. (1994) J.Cell Biochem.Suppl 18 A, Abstr E505

7.Tobias, P.S., Soldau, K. and Ulevitch, R.J. (1989) J.Biol.Chem.264,10867-10871

( 1 ) ： ( i ) ： ( A ) ：Novo Nordisk A/S ( B ) ：Novo Alle ( C ) ：Bagsvaerd ( E ) ：Denmark ( F ) ：2880 ( G ) ：+45 4444 8888 ( H ) ：+45 4449 3256 ( I ) ：37304 ( ii ) ： ( iii ) ：2 ( iv ) ： ( A ) ： ( B ) ：IBM PC ( C ) ：PC-DOS/MS-DOS ( D ) ：PatentIn Release#1.0,Version#1.25 ( EPO ) ( 2 ) 1： ( i ) ： ( A ) ：221 ( B ) ： ( C ) ： ( D ) ： ( ii ) ： ( vi ) ： ( A ) ： ( xi ) ：1：Ile Val Gly Gly Arg Lys Ala Arg Pro Arg Gln Phe Pro Phe Leu Ala1 5 10 15Ser Ile Gln Asn Gln Gly Arg His Phe Cys Gly Gly Ala Leu Ile His

20 25 30Ala?Arg?Phe?Val?Met?Thr?Ala?Ala?Ser?Cys?Phe?Gln?Ser?Gln?Asn?Pro

35 40 45Gly?Val?Ser?Thr?Val?Val?Leu?Gly?Ala?Tyr?Asp?Leu?Arg?Arg?Arg?Glu 50 55 60Arg?Gln?Ser?Arg?Gln?Thr?Phe?Ser?Ile?Ser?Ser?Met?Ser?Glu?Asn?Gly65 70 75 80Tyr?Asp?Pro?Gln?Gln?Asn?Leu?Asn?Asp?Leu?Met?Leu?Leu?Gln?Leu?Asp

85 90 95Arg?Glu?Ala?Asx?Leu?Thr?Ser?Asx?Val?Thr?Ile?Leu?Pro?Leu?Pro?Leu

100 105 110Gln?Asx?Ala?Thr?Val?Glu?Ala?Gly?Thr?Arg?Cys?Gln?Val?Ala?Gly?Trp

115 120 125Gly?Ser?Gln?Arg?Ser?Gly?Gly?Arg?Leu?Ser?Arg?Phe?Pro?Arg?Phe?Val 130 135 140Asx?Val?Thr?Val?Thr?Pro?Glu?Asp?Gln?Cys?Arg?Pro?Asn?Asn?Val?Cys145 150 155 160Thr?Gly?Val?Leu?Thr?Arg?Arg?Gly?Gly?Ile?Cys?Asn?Gly?Asp?Gly?Gly

165 170 175Thr?Pro?Leu?Val?Cys?Glu?Gly?Leu?Ala?His?Gly?Val?Ala?Ser?Phe?Ser

180 185 190Leu?Gly?Pro?Cys?Gly?Arg?Gly?Pro?Asp?Phe?Phe?Thr?Arg?Val?Ala?Leu

195 200 205Phe Arg Asp Trp Ile Asp Gly Val Leu Asn Asn Pro Gly, 210 215 220 (2) sequences, 2 data: (i) sequence signature: (A) length: 219 amino acid (B) type: amino acid (C) chain: strand (D) topological structure: linear (ii) molecule type: albumen (vi) source: (A) biology: pig (xi) sequence description: sequence 2Ile Val Gly Gly Arg Arg Ala Gln Pro Gln Glu Phe Pro Phe Leu Ala1 5 10 15Ser Ile Gln Lys Gln Gly Arg Pro Phe Cys Ala Gly Ala Leu Val His

20 25 30Pro?Arg?Phe?Val?Leu?Thr?Ala?Ala?Ser?Cys?Phe?Arg?Gly?Lys?Asn?Ser

35 40 45Gly?Ser?Ala?Ser?Val?Val?Leu?Gly?Ala?Tyr?Asp?Leu?Arg?Gln?Gln?Glu 50 55 60Gln?Ser?Arg?Gln?Thr?Phe?Ser?Ile?Arg?Ser?Ile?Ser?Gln?Asn?Gly?Tyr65 70 75 80Asp?Pro?Arg?Gln?Asn?Leu?Asn?Asp?Val?Leu?Leu?Leu?Gln?Leu?Asp?Arg

85 90 95Glu?Ala?Arg?Leu?Thr?Pro?Ser?Val?Ala?Leu?Val?Pro?Leu?Pro?Pro?Gln

100 105 110Asx?Ala?Thr?Val?Glu?Ala?Gly?Thr?Asn?Cys?Gln?Val?Ala?Gly?Trp?Gly

115 120 125Thr?Gln?Arg?Leu?Arg?Arg?Leu?Phe?Ser?Arg?Phe?Pro?Arg?Val?Leu?Asx 130 135 140Val?Thr?Val?Thr?Ser?Asn?Pro?Cys?Leu?Pro?Arg?Asp?Met?Cys?Ile?Gly145 150 155 160Val?Phe?Ser?Arg?Arg?Gly?Arg?Ile?Ser?Gln?Gly?Asp?Arg?Gly?Thr?Pro

165 170 175Leu?Val?Cys?Asn?Gly?Leu?Ala?Gln?Gly?Val?Ala?Ser?Phe?Leu?Arg?Arg

180 185 190Arg?Phe?Arg?Arg?Ser?Ser?Gly?Phe?Phe?Thr?Arg?Val?Ala?Leu?Phe?Arg

195 200 205Asn?Trp?Ile?Asp?Ser?Val?Leu?Asn?Asn?Pro?Pro 210 215

Claims

1. medicinal compositions that is used to prevent or treat the disease or the symptom of the stress damage that relates to cell, said composition comprises

What (a) have a lipid part contains the fat material, same or similar with ceramide on its structure,

Its put together in

(b) a kind ofly can when this conjugate contacts with viable cell, contain fat substance activating ceramide activated phosphoprotein phosphatase, cause the downward modulation of cellular metabolism, know as follows in conjunction with the described albumen that contains the fat material

(c) a kind of diluent or carrier that can be medicinal.

2. composition as claimed in claim 1, wherein, described is a kind of heparin-binding protein (HBP) with containing the albumen that the fat material puts together, and it is the glycosylation form, apparent molecular weight is 28kD (measuring by SDS-PAGE under reductive condition), and this albumen results from the azurophil granule of polymorphonuclear leukocyte.

3. composition as claimed in claim 2, wherein, described heparin-binding protein is people HBP.

4. composition as claimed in claim 3, wherein, described HBP has the aminoacid sequence shown in the sequence 1 in the sequence table, or its can with contain fat material bonded analogue.

5. composition as claimed in claim 2, wherein, described heparin-binding protein is pig HBP.

6. composition as claimed in claim 5, wherein, described HBP have in the sequence table aminoacid sequence shown in the sequence 2 or its can with contain fat material bonded analogue.

7. composition as claimed in claim 1, wherein, the described fat material that contains is lipopolysaccharides (LPS).

8. composition as claimed in claim 1 wherein, describedly contains the lipid A part that the fat material is LPS.

9. composition as claimed in claim 1, wherein, the described fat material that contains is a ceramide.

10. composition as claimed in claim 9, wherein, the structure of described ceramide is as follows:

Wherein, R ¹Be the lipid acid that acid amides connects, chain length is 14 carbon atoms, R ²Be hydrogen or hydroxyl or phosphate, R ³Be C ₁₅-alkyl or phenyl, R ⁴Be hydrogen or hydroxyl.

11. composition as claimed in claim 9, wherein, the structure of described ceramide is as follows: Wherein

R ¹Be straight or branched, saturated or unsaturated C _14-30Alkyl, its alpha-position can be replaced by hydroxyl, or ω-position is by saturated or unsaturated C _16-30Fatty acid esterification;

R ^{2 '}Be hydrogen atom or phosphate;

R ³Be C _15-26Alkyl, its alpha-position is saturated or unsaturated, or replaces alpha-position by hydroxyl, and optionally by one or several C _1-14Alkyl replaces, perhaps R ³Be aryl, be preferably phenyl, it can be by hydroxyl, the halogen that comprises F, Cl and Br or methyl substituted;

And R ⁴Be hydrogen or hydroxyl.

12. prevention or treatment relate to the disease of cellular stress damage or the method for symptom, this method comprises that patient to this treatment of needs takes significant quantity

(a) a kind of have a lipid part contain the fat material, it is structurally same or similar with ceramide,

Its put together in

(b) a kind of can be as follows and the described fat material bonded albumen that contains, when this conjugate contacts with viable cell, contain fat substance activating ceramide activated phosphoprotein phosphatase, cause the downward modulation of cellular metabolism.

13. method as claim 12, wherein, described is heparin-binding protein (HBP) with containing the albumen that the fat material puts together, and it is the glycosylation form, apparent molecular weight is 28kD (measuring by SDS-PAGE under reductive condition), and this albumen results from the azurophil granule of polymorphonuclear leukocyte.

14. as the method for claim 13, wherein, described heparin-binding protein is people HBP.

15. as the method for claim 14, wherein, described HBP has the aminoacid sequence shown in the sequence 1 in the sequence table, or it can be in conjunction with the analogue that contains the fat material.

16. as the method for claim 13, wherein, described heparin-binding protein is pig HBP.

17. as the method for claim 16, wherein, described HBP has the aminoacid sequence shown in the sequence 2 in the sequence table, or its can with contain fat material bonded analogue.

18. as the method for claim 12, wherein, the described fat material that contains is lipopolysaccharides (LPS).

19., wherein, describedly contain the lipid A part that the fat material is LPS as the method for claim 12.

20. as the method for claim 12, wherein, the described fat material that contains is a ceramide.

21. as the method for claim 20, wherein, described ceramide has following structure:

Wherein, R ¹Be the lipid acid that a kind of acid amides connects, its chain length is 14 carbon atoms, R ²Be hydrogen or hydroxyl or phosphate, R ³Be C ₁₅-alkyl or phenyl, and R ⁴Be hydrogen or hydroxyl.

22. as each method among the claim 12-21, be used for prevention or treatment inflammation, virus infection, local asphyxia reindoctrinates syndrome, Sepsis, septic shock, disseminated inravascular coagulation, or is used to stimulate patient's immune system.

23. as each method among the claim 12-22, wherein, the significant quantity scope of described albumen/contain fat material conjugate is about 1mg～about 100mg/kg body weight.

24. will

Its put together in

(b) a kind of can be as follows in conjunction with the described albumen that contains the fat material: when this conjugate contact viable cell, the described fat substance activating ceramide activated phosphoprotein phosphatase that contains causes the downward modulation of cellular metabolism,

Be used to produce the purposes of medicine that is used to prevent or treats the disease of the stress damage that relates to cell.

25. purposes as claim 24, wherein, described is heparin-binding protein (HBP) with containing the albumen that the fat material puts together, and it is the glycosylation form, apparent molecular weight is 28kD (being recorded by SDS-PAGE under reductive condition), and this albumen results from the azurophil granule of polymorphonuclear leukocyte.

26. as the purposes of claim 25, wherein, described heparin-binding protein is people HBP.

27. as the purposes of claim 26, wherein, described HBP has aminoacid sequence shown in the sequence 1 in the sequence table, or it can be in conjunction with the analogue that contains the fat material.

28. as the purposes of claim 25, wherein, described heparin-binding protein is pig HBP.

29. as the purposes of claim 28, wherein, described HBP has the aminoacid sequence shown in the sequence 2 in the sequence table, or it can be in conjunction with the analogue that contains the fat material.

30. as the purposes of claim 24, wherein, the described fat material that contains is lipopolysaccharides (LPS).

31., wherein, describedly contain the lipid A part that the fat material is LPS as the purposes of claim 24.

32. as the purposes of claim 24, wherein, the described fat material that contains is a ceramide.

33. as the purposes of claim 32, wherein, described ceramide has following structure:

Wherein, R ¹Be the lipid acid that acid amides connects, its chain length is 14 carbon atoms, R ²Be hydrogen or hydroxyl or phosphate, R ³Be C ₁₅Alkyl or phenyl, and R ⁴Be hydrogen or hydroxyl.

34. as each purposes of claim 24-33, be used for prevention or treatment inflammation, virus infection, local asphyxia reindoctrinates syndrome, Sepsis, septic shock, disseminated inravascular coagulation, or is used to stimulate patient's immune system.