MXPA96004953A - Protein that links heparine, for the treatment desepsis and processes for its preparation - Google Patents

Abstract

The present invention relates to a pharmaceutical composition for the prevention or treatment of diseases or conditions associated with the induction of the cytokine cascade by lipopolysaccharide (LPS), the composition comprising a protein that binds heparin (HBP) which, in glycosylated form , has an apparent molecular weight of 28 kD (determined by SDS-PAGE under reducing conditions), the protein has been produced in the azurophil granules of polymorphonuclear leukocytes, together with a pharmaceutically acceptable carrier or diluent. The heparin-binding protein is produced in host cells that contain DNA encoding HBP extended in its N-terminal part or encoding HBP preceded by, and fused to a DNA sequence encoding another protein. A process is also described in which the culture medium contains a sulfata polysaccharide

Description

PROTEIN THAT LINKS HEPARINE, FOR THE TREATMENT OF SEPSIS AND PROCESSES FOR ITS PREPARATION FIELD OF THE INVENTION The present invention relates to a pharmaceutical composition comprising a protein that binds heparin, and the use thereof for the treatment of diseases or conditions caused by bacterial endotoxin.

BACKGROUND OF THE INVENTION Septic shock resulting in a systemic response to serious infection has increased its incidence in the last 50 years and is currently the most common cause of death in intensive care units in the United States.

U.S. The reasons for this increase and the high frequency of presentation of septic shock is considered to be the increased use of invasive devices such as intravascular catheters, the increased use of cytotoxic drugs and immunosuppressants, the greater longevity in patients susceptible to developing sepsis and an increase in in infections caused by organisms resistant to antibiotics. REF: 23310 X The disorders associated with sepsis are bacteremia (also known as septicemia) characterized by positive blood cultures; sepsis characterized by a systemic response to infection in the form of tachypnea, tachycardia, hyperthermia or hypothermia; sepsis syndrome in which there is clinical evidence of sepsis and signs of impaired organ perfusion in the form of an abnormally increased lactate concentration, oliguria, or an acutely altered metal state; septic shock early in which there is clinical evidence of sepsis syndrome as well as hypotension that lasts less than an hour and that is sensitive to conventional therapy; and refractory septic shock in which there is clinical evidence of sepsis syndrome and hypotension that lasts for more than an hour despite the conventional therapy. Known mediators of sepsis interact in a complex manner to form the cascade of sepsis, or cytokine, initiated at a site of infection or damage (eg, the abdominal cavity). The initiator of the waterfall of cytokine (in gram-negative bacteremias which are a common cause of sepsis) is an endotoxin (also known as lipopolysaccharide, abbreviated as LPS) released by bacteria at the site of infection or inflammation where it induces the release of tumor necrosis a (TNFa), interleukin-1, interleukin-6, interleukin-8 and platelet activating factor (PAF) of macrophages and other cells. After the release of TNFa, interleukin-1 and PAF, arachidonic acid is metabolized to form leukotrienes, thromboxane A2 and prostaglandins. Interleukin-1 and interleukin-6 activate T cells to produce interferon- ?, interleukin-2, interleukin-4 and granulocyte-monocyte colony-stimulating factor. Neutrophil leukocytes can be activated directly by most of these mediators. Therefore, neutrophil-induced damage occurs during degranulation by the release of oxygen free radicals and liposomal enzymes during aggregation at the site of infection or inflammation. Although they are potentially capable of activating the cytokine cascade, the presence of endotoxin and other mediators of sepsis in infectious or inflammatory foci do not, by themselves, need to produce sepsis, insofar as the cytokine cascade has certain inherent protections against the uncontrolled activation of the cytokine cascade. Therefore, prostaglandin can inhibit the release of cytokines from macrophages, and macrophages may be able to suppress T cells. Clinical symptoms of sepsis appear to occur when too many toxins or other mediators have been released, or when mediators able to interfere with the cytokine cascade are not present, when the immune system is attenuated. For a more detailed description of the progress of septic disorders and the mediators involved in it, see R.C. Bone, "The Pathogenesis of Sepsis", "Ann. Int. Med. JJ, 1991, pp. 457-469. The high mortality and continuous morbidity attributable to gram-negative sepsis has initiated intensive research in search of therapeutic agents. able to counteract the life-threatening effects of circulating bacterial LPS Numerous documents report a significant therapeutic effect of high-dose immunoglobulin administered intravenously, however, treatment requires IgG derived from plasma from examined donors to see if they present naturally high titers and antibodies against the LPS nucleus or from large accumulations of donors (>1000). The use of monoclonal antibodies against LPS has also been suggested for the treatment of bacteremia (for example in WO88 / 03211) which have shown little or no effect, probably because they do not inhibit the cytokine cascade induced by LPS. The covalent structure of two closely related peripheral neutrophil leukocyte proteins of human and porcine origin has been recently determined (see H. Flodgaard et al., Eur. J. Biochem. 122, 1991, pp. 535-547; J. Pohl et al., FEBS Lett 222, 1990, p 200 ff.). Both proteins show a similarity to neutrophil elastase, but due to selective mutations of active serine 195 and histidine 57 (chymotrypsin numbering (B.S. Hartley, "Homologies in Serine Proteinases ", Phil, Txal =., Roy, SQC, Series 257. 1970, p. 77 ff.)) Proteins lack protease activity. These proteins have been named as a protein that binds human heparin (hHBP) and protein binding heparin portion a (pHBP), respectively, due to their high affinity for heparin; Schafer et al. (W.M. Schafer et al., Infect, Immun, 53. 1986, p.651 ff.) Have mentioned the protein cationic antimicrobial protein (CAP37) due to its antimicrobial activity. It has also been shown that the protein is chemotactic for monocytes in the range of 1.3 x 10"9 M-10 -8 M (HA Pereira et al., J. Clin. Invest. 85, 1990, p.1468 ff.), which agrees with the results that are evident from Flodgaard et al., O £. CJt. - In addition, it has been shown that HBP mediates the detachment and contraction of endothelial cells and fibroblasts when added to such cells when they grow in culture. of monolayer HBP also stimulates the survival of monocytes and the secretion of thrombospondin (E. 0stergaard and H. Flodgaard, J. Leucocv and Binl., 1992, p 316 ff.) From the azurophil granules, a protein with first 20 N-terminal amino acid residues identical to those of hHBP and CAP 37, called azurocidin, have also been isolated (JE Gabay et al., Proc. Nati. Acad. Sci. USA 86. 1989, p.5610 ff CG ilde et al., -T. Biol. Chem., 1990, p.2038 ff.) And these antimicrobial properties have been reported (D. Campanelli et al., J, Clin. Invst, £, 1990, p. 904 ff.). The presence of hHBP in neutrophil leukocytes and the fact that 89% of CAP37 (which is identical to hHBP) is released when the leukocytes are phagocyting Staph. Aureus (H.A. Pereira et al., or. cit.) indicate that a hHBP function may be involved in the inflammatory process since the protein is apparently released from activated neutrophils. Pereira et al., Op. cit .. suggests a function of CAP37 which is in the site of inflammation where it can specifically attract monocytes and therefore be one of the factors responsible for the inflow of monocytes in the second sequence or wave of inflammation. 0stergaard and Flodgaard, op. cit .. suggest that, in addition to being important for recruiting monocytes, HBP can also play a key role in the neutrophil mechanism as well as extravasation of monocytes.

The structure of HBP appears in WO 89/08666 and in G. Flodgaard et al., Op. cit. HBP is otherwise referred to as CAP 37 (see WO 91/00907) and azurocidin (see C.G. Wilde et al., J. Biol. Chem. 265. 1990, p.2038).

BRIEF DESCRIPTION OF THE INVENTION It has not been previously suggested that HBP can be used in the treatment of diseases or conditions caused by the presence of bacterial endotoxin in sites of infection or damage. Accordingly, the present invention relates to a pharmaceutical composition for the prevention or treatment of diseases or conditions associated with induction of the cytokine cascade by lipopolysaccharides (LPS), the composition comprising a heparin-binding protein (HBP) which, in glycosylated form, has an apparent molecular weight of 28 kD (determined by SDS-PAGE under reducing conditions), the protein is produced in the azurophil granules of polymorphonuclear leukocytes, together with a pharmaceutically acceptable carrier or diluent. It has been found that HBP binds to LPS, see H.A. Pereira et al., Proc. Nati ? cad. Sci. USA 2 £, 1993, pp. 4733-4737, where this ability is associated with the antibacterial effect of the protein. It has been reported that the bactericidal effect of HBP is reduced to pH 7 (ie, physiological pH). In addition, the septic conditions are not caused by the gram negative bacteria as such, but by the endotoxin released by dead bacterial cells that activate the CD14 receptor in monocytes, thereby inducing the cytokine cascade. Therefore, it seems that the antibacterial effect of BPH is not important for the treatment of septic conditions. In this context, it should be noted that the binding of LPS itself is not indicative of an ability to neutralize the inducing effects of the cytokine cascade of endotoxin, as is evident from the fact that the antibodies raised against LPS have little or no effect in this regard, see E.Th. Rietschel and M. Schlaak, Immun. Infect. 21, 1993, pp. 25-36. Although previous published efforts to combat septic conditions have concentrated on neutralizing endotoxin in circulation in patients with sepsis (eg, as suggested in WO 93/19087, in which it is suggested that CAP37 (ie HBP) for the treatment of endotoxemia by binding in order to provide LPS release from circulation), most of these efforts have been in vain, for example, because patients with sepsis generally have high concentrations of circulating endotoxin. However, HBP can be effective in local inflammatory or infectious sites after the septic phenomena have manifested themselves, that is, in post-endotoxemic phenomena. The current assumption has been made that HBP can exert its beneficial effect not only by specific binding and with high affinity to lipid A (the toxic portion of LPS) by inhibiting the continuous induction of the cytokine cascade, but also by monocytes protective apoptosis resulting from stress damage caused by the release of oxygen free radicals and phagocyte cytokines (eg, neutrophils, monocytes, macrophages) as part of the body's defense mechanisms against damage and infections. Monocytes migrate to sites of infection damage when they phagocytose infectious microorganisms and harmful substances such as endotoxin. HBP can also stimulate the phagocytic effect of monocytes. The ability of HBP to mobilize monocytes may appear to be dependent on their ability to bind LPS in a way that has not been clarified. Furthermore, it has been surprisingly established that HPB binds irreversibly to LPS at a temperature of 37-45 ° C (ie normal to a hyperthermic body temperature). This, in addition, may have an effect on the neutralization of LPS by HBP. In another aspect, the invention relates to a method for the prevention or treatment of diseases or conditions associated with the induction of the cytokine cascade by LPS, the method comprising administering to a patient in need of such treatment, an effective amount of a protein that binds heparin (HBP) which, in glycosylated form, has an apparent molecular weight of 28 kD (determined by SDS-PAGE under reducing conditions), the protein is produced in azurophil granules of polymorphonuclear leukocytes. In a further aspect, the invention relates to the use of a protein that binds heparin (HBP) which, in glycosylated form, has an apparent molecular weight of 28 kD (determined by SDS-PAGE under reducing conditions), the protein is produced in the azurophil granules of polymorphonuclear leukocytes, to manufacture a medicament for the prevention or treatment of diseases or conditions associated with the induction of the cytokine cascade by LPS.

DESCRIPTION DETAT.T The BPH can suitably be mammalian, in particular of human or porcine origin. In particular, HBP is human HBP with the amino acid sequence shown in the sequence listing as SEC. FROM IDENT. DO NOT. : 1, or the HBP portion with the amino acid sequence shown in the sequence listing as SEC. FROM IDENT. NO: 2, or a functional analog or peptide fragment thereof capable of binding to the A portion of LPS lipids. Examples of such functional analogs include derivatives of the native protein that are obtained by adding one or more amino acid residues to the C or N-terminal part of the native protein, replacing one or more amino acid residues at one or both ends of the protein. the native protein, the deletion of one or more amino acid residues at one or both ends of the native protein or at one or more sites within the amino acid sequence, or the insertion of one or more amino acid residues at one or more sites in the native amino acid sequence. The term is specifically designed to include peptide fragments of HBP, in particular fragments with a similar capacity compared to native HBP to reduce the LPS-induced cytokine cascade of human mononuclear cells. An example of such fragment capable of binding LPS protein A lipid is a peptide fragment comprising amino acid residues 20-53, in particular amino acid residues 26-42 of SEQ. FROM IDENT. NO: 1 or amino acid residues 20-53 of SEC. FROM IDENT. NO: 2. A DNA sequence encoding HBP can be prepared synthetically by established standard methods, for example, the phosphoamidite method described by S.L. Beaucage and M.H. Caruthers, Tetrahedron Letters 22. 1981, pp. 1859-1869, or the method described by Matthes et al., EMBO Journal 3. 1984, p. 801-805. According to the phosphoamidite method, the oligonucleotides are synthesized, for example, in an automatic DNA synthesizer, purified, annealed, ligated and cloned into suitable vectors. The DNA sequence may also be of genomic or cDNA origin, for example, obtained by preparing a genomic or cDNA library and examining for searches of DNA sequences that code for all or part of HBP by hybridization using synthetic oligonucleotide zones according to standard techniques (see Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Ed., Cold Spring Harbor, 1989). The DNA sequence can also be prepared by polymerase chain reaction using specific primers, for example, as described in U.S. Patent No. 4,683,202 or in R.K. Saiki et al., Science 211, 1988, pp. 487-491.

Subsequently the DNA sequence is inserted into the recombinant expression vector which can be any vector that can be conveniently subjected to recombinant DNA methods. The choice of vector often depends on the host cell into which it is to be introduced. Therefore, the vector can be a self-replicating vector for example, a vector which exists in an extrachromosomal entity, the replication of which is independent of chromosomal replication, for example, a plasmid. Alternatively, the vector can be one which, when introduced into a host cell, is integrated into the genome of the host cell and replicated together with the chromosome or chromosomes within which it has been integrated. In the vector, the DNA sequence encoding HBP must be operably linked to a suitable promoter sequence. The promoter can be any DNA sequence which allows transcriptional activity in the host cell of choice and can be derived from genes encoding proteins either homologous or heterologous to the host cell. Examples of suitable promoters for directing the transcription of DNA encoding HBP in mammalian cells are the SV 40 promoter (Subramani et al., Mol. Cell Biol. 1. 1981, pp. 854-864), the MT-1 promoter (metallothionein gene) (Palmiter et al., Science 222., 1983, pp. 809-814) or the adenovirus major late promoter 2. A suitable promoter for use in intact cells is the polyhedrin promoter (Vasuvedan et al., FEBS Lett 311. 1992, pp. 7-11). Promoters suitable for use in yeast host cells include promoters of yeast glycolytic genes (Hitzeman et al., J. Bi. Chem. 255, 1980, pp. 12073-12080; Alber and Kawasaki J. Mol. Appl. Gen. 1, 1982, pp. 419-434) or alcohol dehydrogenase genes (Young et al., In Genetic Ensineering of Microorganisms for Chemicals (Hollaender et al., Eds.), Plenum Press, New York, 1982), or the promoters TPI1 (North American patent number 4,599,311) or ADH2-4C (Russell et al., Nature 3jQ, 1983, pp. 652-654). Suitable promoters for use in filamentous fungal host cells are, for example, the ADH3 promoter (McKnight et al., The EMBO J., 1985, pp. 2093-2099) or the tpiA promoter. The DNA sequence encoding HBP can also be operably linked to a suitable terminator, such as the human growth hormone terminator (Palmiter et al., Op.cit.) Or (for fungal hosts), the promoters TPI1 (Alber and Kawasaki op.cit.) or AJ2H (McKnight et al., op.cit.). The vector may additionally comprise elements such as polyadenylation signals (e.g. from SV 40 or adenoviruses in the Elb region), transcriptional enhancer sequences (e.g., the SV 40 enhancer) and translational enhancer sequences (e.g. those that code for VA adenovirus RNAs). The recombinant expression vector can be additionally constituted by a DNA sequence that allows the vector to replicate in the host cell in question. An example of such a sequence (when the host cell is a mammalian cell) is the SV 40 origin of replication. The vector may also comprise a selectable marker, for example, a gene, the product of which complements a defect in the host cell, such as the gene encoding dihydrofolate reductase (DHFR) or one which provides resistance to a drug, by example to neomycin or hygromycin. The methods used to ligate the DNA sequences encoding HBP, the promoter and the terminator, respectively, and to insert them into suitable vectors containing the information necessary for replication, are well known to those skilled in the art (see, for example, example, Sambrook et al., op.cit.). The host cell into which the expression vector is introduced can be any cell which is capable of introducing HBP and preferably is a eukaryotic cell, such as invertebrate cells (insect) or vertebrate cells, for example Xenopus oocytes. laevi ao mammalian cells, in particular insect and mammalian cells. Examples of suitable mammalian cell lines are COS cell lines (for example ATCC CRL 1650), BHK (for example ATCC CRL 1632, ATCC CCL 10) or CHO (for example ATCC CCL 61). Methods for transfecting mammalian cells and expressing DNA sequences introduced into cells are described, for example, in Kaufman and Sharp, J, Mol, BJQl. 151, 1982, pp. 601-621; Souther and Berg, J, Mol. Appl. Genet 1, 1982, pp. 327-341; Loyter et al. , Proc. Nati Acad. Sci. USA 79. 1982, pp. 422-426; Wigler er al., Cell 14., 1978, p. 725; Corsaro and Pearson, Somatic Cell Gene 2, 1981, p. 603, Graham and van der Eb, Virology 52, 1973, p. 456; and Neumann et al., EMBO J. 1, 1982, pp. 841-845. Alternatively, fungal cells (including yeast cells) can be used as host cells. Examples of suitable lavage cells include cells of Saccharomyces spp. or Schizoaaeeharomyeea spp., in particular strains of Saccharomyces cerevisiae. Examples of other fungal cells are filamentous fungal cells, for example, Aspergillus spp. or Neurospora spp., in particular strains of Aspersillus Qryzae or Aspersillus nigej. The use of Aspergillus spp. For protein expression is described, for example, in EP 238 023. The medium used to grow the cells can be any conventional means suitable for growing mammalian cells, such as serum containing media or free of serum containing the appropriate supplements, or a suitable medium for the growth of insect, yeast or fungal cells. Suitable means are available from commercial suppliers or can be prepared according to published recipes (eg, in the catalogs of the American Type Culture Collection). The HBP produced by the cell can then be recovered from the culture medium by any conventional method which includes separating the host cells from the medium by centrifugation or filtration, precipitating the proteinaceous components of the supernatant or the filtrate by means of a salt, for example, sulphate. of ammonium, purification by a variety of chromatographic procedures, for example, ion exchange chromatography, affinity chromatography or the like. It has been surprisingly found that particularly good yields of HBP are obtained when HBP is expressed as pro-HBP. Accordingly, in a specific embodiment, the present invention relates to a process for producing HBP, in which host cells containing the DNA sequence encoding mature HBP are preceded by an N-terminal extension and are cultured in a medium of suitable culture under conditions that allow the expression of HBP, and the resulting BPH is recovered from the culture medium as an enlarged HBP in its N-terminal part. The N-terminal extension can be a sequence from about 5 to about 25 amino acid residues, in particular from about 8 to about 15 amino acid residues. The nature of amino acid residues in the N-terminal sequence is not considered critical. The N-terminal extension may suitably be the HBP propeptide with the amino acid sequence Gly-Ser-Ser-Pro-Leu-Asp. In order to facilitate the production of mature HBP, it is generally preferred that the DNA sequence encoding broad HBP in its N-terminal part includes a DNA sequence encoding the cleavage site by protease located between the DNA sequence that encodes for the extension of the N-terminal part, and the DNA sequence that codes for mature HBP. Examples of suitable protease cleavage sites are an enterokinase cleavage site with the sequence of amino acids (Asp) 4-Lys or a cleavage site of Factor Xa with the amino acid sequence Ile-Glu-Gly-Arg.

After recovery from the culture medium, the BPH enlarged in its N-terminal part advantageously can be detached with a suitable protease to produce HBP mature (and active). Examples of suitable enzymes are enterokinase and factor Xa. Suitable host cells for producing HBP are favorably insect cells, for example Lepidoptera or Drosophila cells. In this case, the cells can suitably be transfected with a baculovirus vector, for example, as described in U.S. Patent No. 4,745,051 or WO 92/01801. Additionally, it has been found advantageous to produce HBP in the presence of heparin or another sulfated polysaccharide in order to avoid the binding of HBP to lipopolysaccharides present in the culture medium. Accordingly, in a specific embodiment, the present invention relates to a process for producing HBP, wherein the host cells containing the DNA sequence encoding HBP are cultured in a suitable culture medium containing the sulfated polysaccharide under conditions that allow the expression of HBP, and the resulting HBP is recovered from the culture medium. BPH will bind to the sulfated polysaccharide present in the culture medium and subsequently be released from the polysaccharide under suitable conditions, for example, by eluting HBP with a salt such as sodium chloride. Preferably, the sulfated polysaccharide is heparin, although other sulfated polysaccharides such as heparan sulfate, dextran sulfate, dermatan sulfate, pentosan polysulfate or protamine sulfate can also be used. Preferably, the sulfated polysaccharide is immobilized in an inert carrier to facilitate separation of HBP bound to the polysaccharide from the culture medium. For example, the inert carrier can be agarose (for example Sepharose). In this embodiment, too, the DNA sequence encoding mature HBP can be preceded by a N-terminal extension as described above. In a further embodiment, the present invention relates to a process for producing HBP, wherein the host cells containing the DNA sequence encoding mature HBP are preceded by, and fused to, a DNA sequence encoding another protein and they are grown in a suitable culture medium under conditions that allow the expression of a fusion protein of HBP and the other protein, and the resulting fusion protein is recovered from the culture medium. The other fusion protein can be, for example, the light chain of factor VIII, (the DNA sequence encoding the FVIII light chain can, for example, be obtained as described in EP 232 112. In this embodiment, also, it may be an advantage to introduce a DNA sequence encoding a protease cleavage site, as described above, located between the N terminal extension and the mature HBP In the pharmaceutical composition, the HBP can be formulated by any of the established methods of formulating pharmaceutical compositions, for example, as described in Reminaton's Pharmaceutical Sciences, 1985. The composition will usually be in a form suitable for local or systemic injection or for infusion and can, as such, be formulated with water sterile or an isotonic saline solution or glucose solution.The compositions can be sterilized by conventional sterilization techniques which are n well known in the art. The resulting aqueous solutions can be packaged for use or can be filtered under aseptic conditions and can be lyophilized, the lyophilized preparation can be combined with sterile aqueous solution before administration. The composition may contain pharmaceutically acable auxiliary substances as required to approximate physiological conditions, such as buffering agents, tonicity adjusting agents and the like., for example sodium acetate, sodium lactate, sodium chloride, potassium chloride, calcium chloride, etc. The concentration of HBP can vary widely, that is, from less than about 0.5%, such as from 1%, to 15-20% by weight. A unit dosage of the composition can usually contain from about 10 mg to about 1 g of HBP. The pharmaceutical composition of the invention is contemplated to be advantageous for use in therapeutic applications such as the treatment of sepsis, septic shock, disseminated intravascular coagulation or Meningococcal meningitis. As indicated above, the present composition may be particularly useful for local application at sites of inflammation or infection (eg, in the abdominal cavity), since it is vital to protect monocytes that migrate to such sites and ensure that they are capable of internalizing endotoxin and infectious bacteria. A daily dosage of HBP of 0.1-100 mg / kg of body weight is, to date, considered adequate, based on the severity of the condition to be treated and the patient's condition. Additionally, the composition of the invention may be comprised of an antimicrobial agent to treat the causative bacterial infection. Examples of suitable antimicrobial agents are beta-lactam antibiotics (for example penicillin), aminoglycosides, tetracyclines, bacitracin, polymyxin, sulfonamides, nitrofurans, nalidixic acid, and the like. For systemic application, the composition may also contain heparin or another sulfated glycosaminoglycan such as an anticoagulant agent since it has been found surprisingly that heparin does not inhibit the ability of HBP to bind to LPS. In addition to acting as an anticoagulant, the presence of heparin may also help a longer plasma half-life of HBP insofar as it prevents HBP from binding to glycosaminoglycans in the vascular endothelium.

BRIEF DESCRIPTION OF THE DRAWINGS The present invention is further illustrated in the following examples with reference to the accompanying drawings, in which: Figure 1 shows the DNA sequence derived from the amino acid sequence of the 901 bp EcoRI-Xbal fragment of plasmid pKFN-1783 , which codes for hHBP; Figure 2 shows the DNA sequence and the amino acid sequence derived from a 772 bp BamHI-HindlII fragment inserted in the plasmid pSX221, which codes for hHBP; Figure 3 is a graph showing the concentrations of cytokine in blood mononuclear cells treated with 10 ug / ml of HSA or with varying concentrations of HBP in the presence of 10 ng / ml of LPS; and Figure 4 is a graph showing the concentrations of cytokine in blood mononuclear cells treated with 10 μg / ml of HSA or with varying concentrations of HBP in the presence of 100 ng / ml of LPS.

Example 1 Production of protein that binds to human heparin from yeast strain FN-775 General Methods Conventional DNA techniques are carried out as described (Sambrook, J., Fritch, EF, and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd edn., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY). Synthetic oligonucleotides are prepared in an automated DNA synthesizer (380B, Applied Biosystems) by utilizing commercially available reagents. DNA sequence determinations are carried out by the dideoxy chain termination technique (Sanger, F., Micklen, S., and Coulson, AR, Proc. Nati, Acad. Sci. USA 24. (1977) 5463 -5467). Polymerase chain reactions (PCR) are carried out in a thermal DNA cycler (DNA Thermal Cycler (Perkin Elmer Cetus)). The analysis of the amino acid sequence of the N-terminal part is obtained by automated Edman degradation by using a gaseous phase sequencer from Applied Biosystems 477A. The inverse phase on-line CLAP analysis is carried out for the detection and quantification of the PTH amino acids released from each cycle of the sequencer. 1 μl (10 € pfu) of a human bone marrow cDNA library (Clontech, Palo Alto, CA, U.S.A.) is used as a template in a PCR reaction containing 100 pmol of each of the ÑOR-3176 primers (GTTGGAATTCAT (A / T / C) CA (A / G) AA (T / C) CA (A / G) GGN (A / C) G) and NOR-3174 (CA (T / C) TG (A / G) TC (T / C) TCNGGNGT), where N is a mixture of the four nucleotides. Part 5 'of the forward primer NOR-3176 contains an EcoRI site, and part 3' corresponds to amino acid residues numbers 18-23, and a reverse primer NOR-2174 corresponds to amino acid residues number 149-154 in the sequence of amino acids of hHBP [Flodgaard, H., 0stergaard, E., Bayne, S., Svendsen, A., Thomsen, J., Engels, M., and Wollmer, A. (1991) Eur. J. Biochem. 197, 535-547]. The PCR reaction is carried out in a volume of 100 μl by using a commercial kit (GeneAmp, Perkin Elmer Cetus) and the following cycle: 94 ° for 1 minute, 50 ° for 2 minutes, and 72 ° for 3 minutes. After 35 cycles, a final cycle is carried out in which the 72 ° stage is maintained for 10 minutes. The PCR product, a 420 bp fragment is isolated by 1% agarose gel electrophoresis. Similar initiators are used NOR-3173 (ACNCCNGA (A / G) GA (T / C) CA (A / G) TG and NOR-3175 (GGTTTATAGATTATCCCGG (A / G) TT (A / G) TTNA (A / G) NACNCC) with the same cDNA template as described above, in a PCR reaction The forward primer NOR-3173 is complementary to NOR-2174 and the reverse primer NOR-3175 corresponds to amino acid residues 215-221 in the amino acid sequence of HBP followed by a stop codon and an Xbal site The PCR reaction is carried out as described above and the product, a 232 bp fragment is isolated by agarose gel electrophoresis. two PCR fragments described above are joined by PCR by extension of superposition [Horton, R. M., Hunt, H. D., Ho, S. N. Pullen, J. K., and Pease, L. R. (1989) Gene 77, 61-68] by using NOR-3176 and NOR-3175 as end primers. The resulting 635 bp fragment is isolated and then digested with EcoRI and Xbal, which provides a 621 bp fragment, which is ligated to the 2.8 kb EcoRI-Xbal fragment from the pTZ19R plasmid (Mead, DA, Szczesna-Skorupa, E. and Kemper, B., Prot. Engin. 1 (1986) 67-74). The ligation mixture is used to transform a competent strain of E ^. QOll. (r ~, m +), selected for its resistance to ampicillin. The establishment of the DNA sequence shows that the plasmid pKFN-1726 from one of the resulting colonies encoding the expected amino acid sequence of hHBP18.221. Plasmid pKFN-1726 is digested with PstI and Xbal and the 329 bp fragment is isolated and used as described below. The N-terminal part of BPH is isolated as a 379 bp fragment by PCR using the same cDNA template as described above and the primers MHJ-206 (GCTGAGAGATTGGAGAAGAGAATCGTTGGCGGCCGGAAGGCGAG) and MHJ-200 (CGGCTTCCACCGTGGCGTTCTG). The 3 'part of MHJ-206 is identical to the part that codes for the N-terminal section of the human HBP gene, and the 5' part of MHJ-206 is identical to the C-terminal part of the hybrid yeast leader gene described above [Thim, L., Norris, K., Norris, F., Nielsen, PF, Bj rn, SE, Christensen, and Petersen, J. (1993) FEBS Lett. 318, 345-352]. The frame fusion of the hybrid leader gene and the 379 bp PCR fragment encoding the N-terminal part of HBP is obtained by overlapping extension PCR [Horton, RM, Hunt, HD, Ho, SN, Pullen, JK, and Pease, LR (1989) Gene 77, 61-68]. The product is digested with EcoRI and PstI, and isolated as a 572 bp fragment. The EcoRI-PstI 572 bp fragment and the 329 bp Pstl-Xbal fragment described above are ligated to the 2.8 kb EcoRI-Xbal fragment from the pTZ19R plasmid (Mead, DA, Szczesna-Skorupa, E. and Kemper, B., Prot, Engin. 1 (1986) 67-74). The ligation mixture is used to transform a competent strain of E. coli (r ~, m +) selected for its resistance to ampicillin. Plasmid pKFN-1780 from one of the resulting colonies is selected for later use. Plasmid pKFN-1780 is digested with EcoRI and Xbal.

The resulting 901 bp fragment is ligated to the 9.5 kb Ncol-Xbal fragment from pMT636, and the 1.4 kb NcoI-EcoRI fragment from pMT636. The plasmid pMT636 is described in the application for international patent number WO 89/01968.

The fragment pMT636 is a shuttle vector or activator of £ _coli - £. cerevisiae containing the RPI gene Schizosaccharomyces pojaba (POT) (Russell, PR, G = n = .J2. (1985) 125-130), the triosaphosphate isomerase promoter of S ^ cerevisiae and the terminator TPIP and TPIT (Albert, T ., and Kawasaki, GJ Mol. Appl. Gen. 1 (1982), 419-434). The ligation mixture is used to transform a competent strain of E ^. coli (r ", m +) selected for its resistance to ampicillin The establishment of the DNA sequence shows that the plasmids of the resulting colonies contain the correct DNA sequence for human HBP fused correctly with the signal-leader gene of synthetic yeast A plasmid pKFN-1783 is selected for later use The cassette (box or sequence) of expression of plasmid pKFN-1783 contains the following sequence: IPTp - signal-leader - HBP - TPIT The DNA sequence of the EcoRI-Xbal fragment of 901 bp from pKFN-1783 is shown in Figure 1. Transformation of wash: S. cerevisiae strain MT663 (E2-7B XE11-36 a / a,? Tpi /? Tpi, pep 4-3 / pep 4-3) in YPGaL (Bacto 1% wash extract, Bacto 2% peptone, 2% galactose, 1% lactate) up to OD, at 600 nm of 0.6. 100 ml of culture are collected by centrifugation, washed with 10 ml of water, se. they are centrifuged again and resuspended in 10 ml of a solution containing 1.2 M sorbitol, 25 mM Na2EDTA, pH = 8.0 and 6.7 mg / ml dithiothreitol. The suspension is incubated at 30 ° C for 15 minutes, centrifuged and the cells are resuspended in 10 ml of a solution containing 1.2 M sorbitol, 10 mM Na 2 EDTA, 0.1 M sodium citrate, pH = 5.8, and 2 mg of Novozym. * 234. The suspension is incubated at 30 ° C for 30 minutes, the cells are harvested by centrifugation, washed in 10 ml of 1.2 M sorbitol and 10 ml of CAS (1.2 M sorbitol, 10 mM CaCl 2, 10 mM Tris HCl ( Tris Tris (hydroxymethyl) aminomethane) pH = 7.5) and resuspended in 2 ml of CAS. For transformation, 0.1 ml of cells resuspended in CAS are mixed with approximately 1 μg of plasmid pKFN-1783 and left at room temperature for 15 minutes. 1 ml of (20% polyethylene glycol 4000, 20 mM CaCl 2, 10 mM CaCl 2, 10 mM Tris HCl, pH = 7.5) is added and the mixture is allowed to stand for an additional 30 minutes at room temperature. The mixture is centrifuged and the pellet resuspended in 0.1 ml of SOS (1.2 M sorbitol, 33% v / v YPD, 6.7 mM CaCl2, 14 μg / ml leucine) and incubated at 30 ° C for 2 hours. Subsequently, the suspension is centrifuged and the pellet is resuspended in 0.5 ml of 1.2 M sorbitol. Subsequently, 6 ml of superior agar is added (the SC medium of Sherman et al., (Methods in Yeast Genet.i na. Harbor Laboratory (1982)) containing 1.2 M sorbitol plus 2.5% agar) at 52 ° C, and the suspension is poured over the top of plates containing the same solidified agar, of medium containing sorbitol. The transformant colonies are taken after 3 days at 30 ° C, refilled and used to start liquid cultures. One such transformant, KFN-1775, is selected for further characterization. Fermentation: The yeast strain KFN-1775 is grown in YPD medium (1% wash extract, 2% peptone (from Difco Laboratories), and 3% glucose). A 1 liter culture of the strain is stirred at 30 ° C until an optical density, at 650 nm, of 24. After centrifugation, the supernatant is isolated. HBP is purified from the supernatant substantially as described in WO 89/08666. Analysis of the amino acid sequence of residues 1-20 shows identity with the N-terminal sequence and with SEC. FROM IDENT. N0: 1 Example 2 In order to express HBP (as a proforma) in insect cells using the baculovirus system, the following PCR primers are manufactured.

MHJ 2087: 5 '-AAA AAG GAT CCA CCA TGA CCC GGC TGA CAG TCC TGG CCC TGC TGG CTG GTC TGC TGG CGT CCT CGA GGG CCG GCT CCA GCC CCC TTT TGG ACA TCG TTG GCG GCC GGA AGG C-3' MHJ 2089: 5 '-AAA AAA GCT TCC TAG GCT CGC GCC GGT CCC GGA TTG TTT AAA ACG CCA TC -3' MHJ 2087 codes for a BamHI site, the initiation codon and the prepo portion of the human cDNA (Morgan, JG et al (1991), J. Immun., 147 (3210-3214)) followed by the first 20 nucleotides from the start of the mature part of the gene in pKFN1780.

MHJ 2089 is complementary to the last 8 codons of the part encoding the HBP gene in pKFN1780 plus two additional codons, according to the cDNA sequence mentioned above. This ends in a HindIII site.

PCR is carried out using the two primers and pKFN1780, as a template, following the scheme: 3 cycles 95 ° C 60 sec, 50 ° C 120 sec, 72 ° C 120 sec 12 cycles 95 ° C 30 sec, 65 ° C 60 sec, 72 ° C 90 sec The PCR product, a 760 bp fragment, is isolated by electrophoresis on a 1% agarose gel, cut with BamHI and HindIII, and inserted into pSX221 cut with the same two enzymes. (pSX221 is a derivative of pUC19 (Yannisch-Perron, C. et al. (1985) GENE 33, 103-119) The clone DNA is verified by sequence determination and the BamHI-HindIII fragment (shown in Figure 2) it is cut, isolated and inserted into pBlueBacIII (Invitrogen Corporation) for expression in insect cells.The resulting plasmid is designated pSX556.In order to generate a recombinant baculovirus expressing HBP, the MAXBAC equipment from Invitrogen Corp. is used. (San Diego, CA) and all manipulations are performed according to the included baculovirus expression system manual (version 1.5.5.) Briefly, 1 μg og of linearized AcMNPV DNA and 3 μg of pSX556 are co-transfected in SF9 insect cells (2 x 106 cells in 60 mm vessels) The resulting culture supernatant is collected after 7 days Fresh monolayers of SF9 cells in 100 mm dishes are infected with virus supernatant at various dilutions and subsequently they are coated with agar bear at 1.5% containing complete TNM-FH medium with 150 μg / ml X-gal. After 8 days, 6 putative recombinant plaques are identified by their blue collar and are used to infect a 6-well plate containing SF9 cells. After 5 days, the corresponding virus DNA is purified and subjected to PCR reaction with forward and reverse primers flanking the recombination site in the viral DNA. After evaluation of the agarose gel PCR products, the most corresponding pure recombinant virus is subjected to another plaque purification sequence to ensure that the final recombinant virus concentrate is free of wild-type virus. The production of recombinant HBP is carried out in insect cells (SF9 and SF21) adapted for growth in serum-free SF900-II medium (Gibco BRL / Life-Technologies). Usually, rotatable cultures of 51 in a 10 1 fermentor, both types with a cell density of 1 x 106 / ml, are infected with an MOI of 1 and the medium is harvested 3 days after infection. The purification of HBP is carried out as described in WO 89/08666.

Example 3 HBP without pro region: An oligonucleotide linker (see below) is manufactured covering the first 99 bp of the sequence shown in Figure 2 (from BamHI to Eag I) which excludes the part covering the pro region (from 73 to 87, with italics) and is replaced by original BamHI-Eag I in pSX556, which results in pSX559. It is expected that this construction will produce HBP matures when expressed in the baculovirus system. The binder consists of four oligonucleotides aligned in pairs to provide the following two duplexes: MHJ2568 / LWN5746: 5 '-GATCCACCATGACCCGGCTGACAGTCCTGGCCC-3' 3 '-GTGGTACTGGGCCGACTGTCAGGACCGGGACGACC-P-5' LWN5745 / MHJ2566: 5'-P-TGCTGGCTGGTCTGCTGGCGTCCTCGAGGGCCATCGTTGGC-3 '3' -GACCAGACGACCGCAGGAGCTCCCGGTAGCAACCGCCGG-5 'Example 4 Expression of the HBP derivative with a bovine enterokinase cleavage site placed in = the appropriate and mature HBP The insect cells infected with the baculovirus vector encoding HBP (mature signal-propeptide-HBP) are not capable of releasing the propeptide. Insect cells infected with HBP encoding the virus without propeptide (signal sequence fused directly to the mature HBP sequence) produce the mature form, but in very small amounts. In order to increase the yield of mature HBP, a baculovirus vector encoding an HBP derivative with a bovine enterokinase cleavage site (Asp4-Lys) inserted between the propeptide and mature HBP is generated, which makes it possible to obtain HBP. mature by in vitro processing of the extended form produced of HBP: A coding signal for the mature cDNA fragment -Gly-Ser-Pro-Leu-Leu-Asp-Asp3-Lys-HBP is generated by PCR with Pfu polymerase and the activators or primers PBRa 241 (CCGGGGATCCGATGACCCGGCCCTGGCCCTGCTGGCTGGTCTGCTGGCGTCCTCGAGGGCCGGCTCCAGCCCCCTTTTGGACGACGACGACAAGATCGTTGGCGGC) and PBRa 246 (CCGGGGATCCAACTAGGCTGGCCCCGGTCCCGG). The PCR product is digested with BamHI and cloned into the transfer vector pVL1393 (Invitrogen, San Diego, CA). The generation of the recombinant baculovirus and the protein production is carried out as described in Example 2 (however, in this case it is assumed that the recombinant plaques are identified by their negative occlusion phenotype). In order to produce the extended form in its N-terminal part of HBP, 4 x 10 8 SF9 cells growing in SF900II-free medium are pelleted by centrifugation.

(Gi and resuspend in a sample of the accumulated virus which provides an MOI (multiplicity of infection) of 1. The cells with virus are transferred to a 0.5 1 war rotating flask (# 1965-00500) and added medium Fresh SF900II up to a final volume of 400 ml.

Finally, 1.5 g of heparin-Sepharose is added to the culture (CL-6B Pharmacia), which has been autoclaved in 25 ml of sterile 0.9% NaCl. The culture is incubated at 27 ° C for 3 days. To isolate the heparin-Sepharose spheres from the insect cell culture, the 400 ml of the fermentation medium is divided into aliquots in 8 50 ml tubes, and centrifuged in a Sorvall Instruments TECHNOSPIN R centrifuge at 300 rpm for 3 minutes. The supernatants are removed with the cells and the sedimented heparin-Sepharose spheres are separated from the rest of the contaminating cells by resuspension in 30 ml of sterile NaCl added to each tube, followed by centrifugation at 300 rpm. The whole procedure is repeated twice. The spheres are finally washed in 20 ml of sterile 0.5 M NaCl added to each tube. Subsequently the spheres are collected in a 50 ml tube, in a small volume of sterile 0.5 M NaCl (20-30 ml) and transferred to a sterile glass filter funnel. The spheres are allowed to drain, and the rHBP is finally eluted from the spheres with 30 ml of sterile 3 M NaCl. The HBP is purified from the eluent of 3 M NaCl according to the method described in WO 89/08666. Two hundred micrograms of purified HBP containing the pro sequence and the enterokinase cleavage site between the pro sequence and the mature protein are dissolved in 50 mM sodium acetate buffer containing 25 mM CaCl2, pH 5.1. Four hundred units of enterokinase are added from Biozyme Laboratories Limited GB Lot 18x2 Code EK3, in a volume of 1.2 microliters and the mixture is incubated for 1 hour at 37 ° C. HBP is finally purified from the incubation mixture by reverse phase CLAP, according to the method described in WO 89/08666. An aliquot of purified HBP (1 nmol) is subjected to sequence determination by N terminal, which shows that the main sequence represents correct mature HBP starting with a lie, indicating that the break was successful.

Example 5 Expression of HBP derivatives with a factor Xa cleavage site placed between the propeptide and mature HBP An alternative strategy for the generation of mature HBP is the use of factor Xa for an in vitro breakdown of the material produced. The recognition / breaking site of factor Xa is Ile-Glu-Gly-Arg. By T.J. Gardella et al. (J. Biol. Chem., 26, 15854-15859, 1990) it has been reported that the placement of three small amino acids (Gly-Gly-Ser) in the N-terminal part relative to the factor Xa recognition site possibly minimizes the effects of steric hindrance and therefore the efficiency of rupture factor Xa can be increased. In order to generate cDNA fragments that encode the mature signal-propeptide-Ile-Glu-Gly-Arg-HBP and mature signal-propeptide-Gly-Gly-Ser-Ile-Glu-Gly-Arg-HBP, respectively, pbra the two primers 249 (CCGGGGATCCGATGACCCGGCTGACAGTCCTGGCCCTGCTGGCTGGTCTGCTGGCG TCCTCGAGGGCCGGCTCCAGCCCCCTTTTGGACATCGAGGGTAGGATCGTTGGCGGC) and pbra 250 (CCGGGGATCCGATGACCCGGCTGACAGTCCTGGCCCTGCTGGCTGGTCTGCTGGCG TCCTCGAGGGCCGGCTCCAGCCCCCTTTTGGACGGTGGTTCCATCGAGGGTAGGATC GTTGGCGGC) are synthesized. Together with the initiator PBRa 246 (Example 4) these two primers are used in PCR reactions with Pfu polymerase. The two fragments are digested with BamHI and inserted into pVL1393. The generation of recombinant baculovirus and the production of proteins is carried out as described in Example 4.

Example 6 Peripheral blood mononuclear cells (BMNC) are prepared from healthy adult blood donors (blood bank, Rigshospitalet) by centrifugation of the white blood cell layer on Lymphoprep ™ 1 (Nycomed, Oslo, Norway). In some experiments, BMNC were pre-incubated with PTX for 1 h before the addition of lipopolysaccharide (LPS) (E. coli 055: B5, Difco Laboratories, Detroit, MI), final concentration of 1 μg / ml, or PHA (Difco) , a final concentration of 20 μg / ml, or derivative of purified tuberculin protein (PPD) (State Serum Institute, Copenhagen, Denmark), final concentration of 25 μg / ml. Incubations are carried out in RPMI-1640 (BRL-Gibco, Roskilde, Denmark) containing 3% normal human serum (NHS), inactivated by heat at 56 ° C for 30 minutes and supplemented with 0.8 mM glutamine, and penicillin / streptomycin (BRL-Gibco, Denmark) 20 IE / ml of each. After incubation, the cells are harvested and the supernatants are frozen immediately at -20 ° C; the cell pellets are rapidly frozen in liquid nitrogen and maintained at -80 ° C for no more than a week before the RNA is extracted. The concentrations of IL-la, IL-lβ, IL-2, IL-6, IFN ?, TFa and TNFβ are measured by double-interposed ELISA using polyclonal rabbit monospecific antibodies for purified recombinant cytokines (MB Hansen et al. ., Immunol.

Lett. 30r 1991, p. 156). Immuno-Maxisorp plates are coated (Nunc, Roskilde, Denmark) with affinity purified IgG for protein A. Sites in which there was no binding were blocked with 5% human serum albumin in phosphate buffered saline (PBS). The mixtures were diluted in PBS supplemented with 2% normal rabbit serum (Dako, Glostrup, Denmark), 10 mM EDTA, aprotinin 2,000 KIE / ml and 5 mM DL dithiothreitol. The assays were calibrated with international standards of the respective cytokines (National Institute for Biological Standards and Controls, Potters Bar, Hertfordshire, United Kingdom). Biotinylated polyclonal rabbit antibodies were used as detection antibodies together with streptavidin-peroxidase (Kirkegaard and Perry La., Gaithersburg, MD). The development was carried out with 1,2-phenylenediamine dihydrochloride and measured at 492 nm. The interassay coefficient of variation for the concentration range is between 8 pg / ml and 1 ng / ml, which is less than 15%. The sensitivity limit of these ELISA tests is 8-10 pg / ml. The BMNC were heated and treated with human serum albumin in amounts of 10 μg / ml and 100 μg / ml, as well as HBP in amounts of 0.2 μg / ml, 2 μg / ml and 20 μg / ml in the presence of 10 and 100 ng / ml of LPS, respectively. The results are shown in the attached figures 3 and 4. It is evident from the figures that the release of cytokines from BMNC is significantly reduced in the presence of HBP.

LIST OF SEQUENCES (1) GENERAL INFORMATION: (i) APPLICANT (A) NAME: Novo Nordisk A / S (B) STREET: Novo Alie (C) CITY: Bagsvaerd (E) COUNTRY: Denmark (F) POSTAL CODE: (ZIP): 2880 (G) TELEPHONE: +45 4444 8888 (H) TELEFAX: +45 4449 3256 (I) TELEX: 37304 (ii) TITLE OF THE INVENTION: Protein that binds heparin for the treatment of sepsis (iii) SEQUENCE NUMBER: 2 (iv) COMPUTER LEGIBLE FORM: (A) TYPE OF MEDIA: Flexible disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS / MS-DOS (D) SOFTWARE: Patentln Relay # 1.0, Version # 1.25 (EPO) (2) INFORMATION FOR SEC. FROM IDENT. NO: 1: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 221 amino acids (B) TYPE: amino acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (vi) ORIGINAL SOURCE: (A) ORGANIZATION: human (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 1: He Val Gly Gly Arg Lys Ala Arg Pro Arg Gln Phe Pro Phe Leu Ala 1 5 10 15 Ser He Gln Asn Gln Gly Arg His Phe Cys Gly Gly Ala Leu He His 20 25 30 Wing Arg Phe Val Met Thr Wing Wing Ser Cys Phe Gln Ser Gln Asn Pro 35 40 45 Gly Val Ser Thr Val Val Leu Gly Ala Tyr Asp Leu Arg Arg Arg Glu 50 55 60 Arg Gln Ser Arg Gln Thr Phe Ser Be Ser Ser Met Ser Glu Asn Gly 65 70 75 80 Tyr Asp Pro GJLn Gln Asn Leu Asn Asp Leu Met Leu Leu GJLn Leu Asp 85 90 95 Arg Glu Wing Asx Leu Thr Ser Asx Val Thr He Leu Pro Leu Pro Leu 100 105 110 Gln Asx Wing Thr Val Glu Wing Gly Thr Arg Cys Gln Val Wing Gly Trp 115 120 125 Gly Ser GJLn Arg Ser Gly Gly Arg Leu Ser Arg Phe Pro Arg Phe Val 130 135 140 Asx Val Thr Val Thr Pro Glu Asp GJLn Cys Arg Pro Asn Asn Val Cys 145 150 155 160 Thr Gly Val Leu Thr Arg Arg Gly Gly He Cys Asn Gly Asp Gly Gly 165 170 175 Thr Pro Leu Val Cys Glu Gly Leu Wing His Gly Val Wing Ser Phe Ser 180 185 190 Leu Gly Pro Cys Gly Arg Gly Pro Asp Phe Ph Thr Arg Val Ala Leu 195 200 205 Phe Arg Asp Trp He Asp Gly Val Leu Asn Asn Pro Gly 210 215 220 (2) INFORMATION FOR SEC. FROM IDENT. NO: 2: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 219 amino acids (B) TYPE: amino acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (vi) ORIGINAL SOURCE: (A) ORGANIZATION: swine (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 2: He Val Gly Gly Arg Arg Wing GJLn Pro GJLn Glu Phe Pro Phe Leu Wing 1 5 10 15 Ser He Gln Lys Gln Gly Arg Pro Phe Cys Wing Gly Wing Leu Val His 20 25 30 Pro Arg Phe Val Leu Thr Wing Wing Ser Cys Phe Arg Gly Lys Asn Ser Gly Ser Wing Ser Val Val Leu Gly Wing Tyr Asp Leu Arg GJLn Gln Glu 50 55 60 GJLn Being Arg Gln Thr Phe Being He Arg Being He Being Gln Asn Gly Tyr 65 70 75 80 Asp Pro Arg GJLn Asn Leu Asn Asp Val Leu Leu Leu Gln Leu Asp Arg 85 90 95 Glu Wing Arg Leu Thr Pro Ser Val Wing Leu Val Pro Leu Pro Pro GJLn 100 105 110 Asx Wing Thr Val Glu Wing Gly Thr Asn Cys Gln Val Wing Gly Trp Gly 115 120 125 Thr Gln Arg Leu Arg Arg Leu Phe Ser Arg Phe Pro Arg Val Leu Asx 130 135 140 Val Thr Val Thr Ser Asn Pro Cys Leu Pro Arg Asp Met Cys He Gly 145 150 155 160 Val Phe Ser Arg Arg Gly Arg He Ser Gln Gly Asp Arg Gly Thr Pro 165 170 175 Leu Val Cys Asn Gly Leu Wing Gln Gly Val Wing Being Phe Leu Arg Arg 180 185 190 Arg Phe Arg Arg Being Ser Gly Phe Phe Thr Arg Val Wing Leu Ph Arg 195 200 205 Asn Trp He Asp Ser Val Leu Asn Asn Pro Pro 210 215 It is noted that in relation to this date, the best method known to the applicant to carry out the aforementioned invention, is the conventional one for the manufacture of the objects to which it refers. Having described the invention as above, property is claimed as contained in the following:

Claims (24)

- -

1. The use of a heparin-binding protein (HBP) characterized in that, in glycosylated form, it has an apparent molecular weight of 28 kD (determined by SDS-PAGE under reducing conditions), the protein is produced in the azurophil granules of polymorphonuclear leukocytes, to manufacture a medicament for the prevention or treatment of sepsis, gram-negative sepsis, septic shock or disseminated intravascular coagulation.

2. The use according to claim 1, characterized in that the medicament is useful for local application in sites of inflammation or infection.

3. The use according to any of claims 1 or 2, characterized in that the protein which? - unites heparin is human HBP.

4. The use according to any of the preceding claims, characterized in that HBP has the amino acid sequence shown in the Sequence Listing as SEQ. FROM IDENT. N0: 1, or an analog or peptide fragment thereof capable of binding to the lipid portion A 25 of LPS.

5. The use according to any of the preceding claims, characterized in that the peptide fragment capable of binding to the lipid A portion of LPS is a peptide fragment comprising at least amino acid residues 20-53, in particular amino acid residues 26- 42 of the SEC. FROM IDENT. N0: 1

6. The use according to any of the preceding claims, characterized in that the protein that binds heparin is porcine HBP.

7. The use according to any of the preceding claims, characterized in that the HBP has the amino acid sequence that is shown in the sequence listing as SEC. FROM IDENT. NO: 2 or an analog or peptide fragment thereof capable of binding the lipid A portion of LPS.

8. The use according to any of the preceding claims, characterized in that the peptide fragment capable of binding to the lipid A portion of LPS is a peptide fragment comprising at least amino acid residues 20-53 of SEQ. FROM IDENT. NO: 2

9. The use according to any of the preceding claims, characterized in that the medicament contains HBP in an amount from about 10 mg to about 1 g per form. 5 of unit dosage.

10. A method for the prevention or treatment of diseases or conditions associated with sepsis, gram-negative sepsis, septic shock or coagulation -10 disseminated intravascular, the method is characterized in that it comprises administering to a patient in need of such treatment, an effective amount of a protein that binds heparin (HBP) which, in glycosylated form, has an apparent molecular weight of 28 kD (determined by SDS-PAGE 15 under reducing conditions), the protein is produced by the azurophil granules of polymorphonuclear leukocytes.

* 11. The method according to claim 10, characterized in that the protein that binds 20 heparin is human HBP.

12. The method according to claim 12, characterized in that HBP has the amino acid sequence that is shown in the list of 25 sequence as SEC. FROM IDENT. NO: 1, or an analog or peptide fragment thereof capable of binding to the lipid moiety

A of LPS .:

The method according to claim 13, characterized in that the peptide fragment capable of binding to the lipid A portion of LPS is a fragment comprising at least amino acid residues 20-53, in particular amino acid residues 26-42 of SEC. FROM IDENT. NO: 1. JT-J) 14. The method according to claim 10, characterized in that the protein that binds heparin is porcine HBP.

15. The method according to claim 14, characterized in that the HBP has the amino acid sequence that is shown in the list of '- sequence as SEC. FROM IDENT. NO: 2, or an analog or peptide fragment thereof capable of binding to the lipid moiety 20 A of LPS.

16. The method according to claim 15, characterized in that the peptide fragment that binds to the lipid A portion of LPS is a Peptide fragment comprising at least two amino acid residues 20-53 of SEQ. FROM IDENT. NO: 2 -

17. The method according to claim 10, characterized in that the effective amount of HBP is in the range of 0.1-100 mg / kg of body weight, preferably 0.5-50 mg / kg of body weight, more preferably 1- 25 mg / kg of body weight.

18. The method according to any of claims 10-17, characterized in that HBP is used for local application at the site of inflammation or infection.

19. A process for producing HBP, characterized in that host cells containing a DNA sequence encoding HBP are cultured in a suitable medium containing a sulfated polysaccharide, under conditions that allow the expression of HBP, and the resulting HBP is recovered from the medium of culture.

20. The process according to claim 19, characterized in that the sulfated polysaccharide is heparin.

21. The process according to claim 19, characterized in that the sulphated polysaccharide is immobilized in an inert carrier.

22. The process according to claim 21, characterized in that the inert carrier is agarose.

23. The process according to claim 19, characterized in that the host cells contain a DNA sequence coding for mature HBP preceded by an extension in the N-terminal part. * - 10

24. The process according to claim 23, characterized in that the DNA sequence coding for HBP amplified in its N-terminal part includes a DNA sequence that codes for a protease cleavage site that is located between the sequence of * 5 DNA encoding the N-terminal extension and the DNA sequence encoding mature HBP. twenty A pharmaceutical composition is provided for the prevention or treatment of diseases or conditions associated with the induction of the cytokine cascade by lipopolysaccharide (LPS), the composition comprising a heparin-binding protein (HBP) which, in glycosylated form, has a Apparent molecular weight of 28 kD (determined by SDS-PAGE under reducing conditions), the protein has been produced in the azurophil granules of polymorphonuclear leukocytes, together with a pharmaceutically acceptable carrier or diluent. The heparin-binding protein is produced in host cells that contain DNA encoding HBP extended in its N-terminal part or encoding HBP preceded by, and fused to a DNA sequence encoding another protein. A process is also described in which the culture medium contains a sulfated polysaccharide.