CN118147182A - Optimized cellulase-xylanase fusion enzyme and preparation method thereof - Google Patents

Abstract

The invention relates to an optimized cellulase-xylanase fusion enzyme and a preparation method thereof. The fusion enzyme adopts N-end fusion, is superior to C-end fusion in activity, optimizes the strategy of connecting peptide, properly improves the length of connecting peptide, selects to improve the proper connecting peptide length so as to reduce the steric hindrance between the centers of the double-function enzyme activity, thereby improving the enzyme activity, and the activity of the fusion enzyme DZ1A-E4-XYN after optimizing the connecting peptide length is improved by 21 percent compared with that of the double-function fusion enzyme xylanase before optimizing, and the cellulase activity is improved by 14 percent and is superior to that of DZ 1A-E5-XYN.

Description

Optimized cellulase-xylanase fusion enzyme and preparation method thereof

Technical Field

The invention relates to the field of fusion enzymes, in particular to an optimized cellulase-xylanase fusion enzyme and a preparation method thereof.

Background

The rapid population growth has led to a high demand for energy worldwide today, which creates a large amount of chemical pollution in the environment. Therefore, industries around the world are looking for environmental protection techniques to meet product needs without polluting the environment and economical use. Fossil fuels are currently used for many different purposes, such as the production of chemicals and energy products. Most chemicals in the world today are produced from fossil fuels. Because of the vast energy demands now that have made such natural sources of energy ever decreasing rapidly, there is a need for an energy source substance that can replace fossil energy and chemical sources. Lignocellulose is now considered as a potential and renewable carbon source for the production of biofuels and value added chemicals. Development of sustainable energy is critical to alleviating energy crisis and environmental pollution problems. The fusion enzyme is widely applied to various fields, and the cellulase and xylanase are the most important glycoside hydrolase for degrading cellulose and hemicellulose in the hydrolysis process of lignocellulose biomass enzyme, are one of important means for solving the shortage of energy sources to realize sustainable development of the energy sources, and are widely applied to a plurality of industrial fields along with the wide research of the cellulase and xylanase in recent years. Considering the need for synergy of multiple enzymes, expression of multiple enzymes in a single cell may increase degradation efficiency and reduce production process flow and thus production costs.

Gene fusion is an important tool in systems and synthetic biology and has been widely used in the production of synthetic bifunctional enzymes. During cellulose hydrolysis, gene fusion has been used to study the function and effectiveness of various CBMs, as well as to create enzymes with multiple activities. It is known that the hydrolysis of lignocellulose requires the synergistic action of several or more enzymes to function, but the process of this synergistic action still faces some necessary problems, the most important of which is the problem of the excessive production costs of the enzymes. It is currently estimated that the cost of using cellulases in the plant is around 10-40% of the total production cost of biorefinery today. In the CBP, i.e. the combined biological processing technology, the production and processing mode integrating cellulose saccharification, fermentation and enzyme production in the same industrial step becomes an excellent solution for realizing the efficient utilization of cellulose without enzyme production and purification steps. Two strategies can be currently adopted to realize the combined biological processing technology. One is a "recombinant cellulose degradation strategy" that imparts the ability to biodegrade cellulose by means of genetic recombination to enable the production of high yields of biofuel. The other is a 'native cellulose degradation strategy', i.e. cellulose can be efficiently hydrolyzed by microorganisms, thereby improving biofuel production by altering the way the microorganisms metabolize. However, the former strategy has received much attention due to the complexity of the latter metabolic pathway, and thus the degradation ability of various cellulases administered to engineering bacteria has become a favored research direction. And the conventional method based on the high-throughput screening determination of establishing site-directed mutagenesis and random mutagenesis is very difficult to quickly obtain the multifunctional enzyme mutant with the required properties, so that the fusion expression strategy is selected in the process of constructing the multifunctional cellulase based on comprehensive consideration of production cost and experimental operability.

Disclosure of Invention

Aiming at the defects, the invention provides an optimized cellulase-xylanase fusion enzyme and a preparation method thereof.

The scheme of the invention comprises the following specific contents:

The optimized cellulase-xylanase fusion enzyme is prepared through constructing single gene with cellulase function and xylanase function, connecting with rigid connecting peptide EAAAK and expressing in colibacillus.

Furthermore, an N-terminal fusion mode is adopted during fusion.

Further, the length of the rigid linker peptide EAAAK is four times the length.

The optimized cellulase-xylanase fusion enzyme is prepared by the method.

Furthermore, the reaction temperature of the fusion enzyme is 40-70 ℃ under the condition of taking sodium carboxymethyl cellulose as a substrate.

Furthermore, the reaction temperature of the fusion enzyme is 60 ℃ by taking sodium carboxymethyl cellulose as a substrate.

Further, the reaction pH of the fusion enzyme was 6.0.

In order to solve the technical problems, the invention adopts the following technical scheme:

The fusion enzyme adopts N-end fusion, is superior to C-end fusion in activity, optimizes the strategy of connecting peptide, properly improves the length of connecting peptide, selects to improve the proper length of connecting peptide, further reduces the steric hindrance between the centers of the double-function enzyme activity, improves the xylanase activity of the fusion enzyme DZ1A-E4-XYN after optimizing the length of connecting peptide by 21 percent compared with the double-function fusion enzyme xylanase before optimizing, improves the cellulase activity by 14 percent, is superior to DZ1A-E5-XYN activity, and indicates that the length of connecting peptide is not longer and better.

The invention will now be described in detail with reference to the drawings and examples.

Drawings

FIG. 1 is a predicted structure of a connecting peptide optimized fusion enzyme, wherein FIG. a is DZ1A-E3-XYN, b is DZ1A-E4-XYN, and c is DZ1A-E5-XYN;

FIG. 2 is a diagram showing SDS-PAGE protein detection of a bifunctional fusion enzyme after optimization of a connecting peptide, wherein M is a protein molecular standard; a#: DZ1A-E4-XYN b#: DZ1A-E5-XYN;

FIG. 3 is a graph showing the relationship between the enzyme activity and the reaction temperature of the bifunctional fusion enzyme after the optimization of the connecting peptide under different substrates, wherein the graph a is a CMC-Na substrate b is a xylan substrate;

FIG. 4 is a graph showing the relationship between enzyme activity and pH of a bifunctional fusion enzyme after optimization of a linker peptide for different substrates, wherein FIG. a is a graph showing CMC-Na substrate b, and xylan substrate;

FIG. 5 is a graph of the thermostability of several cellulase-xylanase chimeric enzymes at CMC-Na substrates, wherein graph a is 50 ℃, b is 60 ℃, c is 70 ℃;

FIG. 6 is a graph of the thermostability of several cellulase-xylanase chimeric enzymes at a xylan substrate, wherein graph a is 50 ℃, b is 60 ℃, c is 70 ℃;

FIG. 7 is a graph of pH stability of several cellulase-xylanase chimeric enzymes with CMC-Na substrate, wherein FIG. a is pH5.0, b is pH6.0, c is pH7.0, d is pH8.0;

FIG. 8 is a graph of the pH stability of several cellulase-xylanase chimeric enzymes at xylan substrate, wherein graph a is pH5.0, b is pH6.0, c is pH7.0, and d is pH8.0.

Detailed Description

The principles and features of the present invention are described below with reference to the drawings, the examples are illustrated for the purpose of illustrating the invention and are not to be construed as limiting the scope of the invention.

1. Materials and methods

1.1 Strains, plasmids, reagents

Clone strain ESCHERICHIA COLI DH a and expression strain ESCHERICHIA COLI BL (DE 3) were both purchased from wuhan white biotechnology limited. pET23a-dz1a, pET23a-xyn plasmids were stored by laboratory, seamless cloning kit and DNA Polymerase Phanta Max Super-FIDELITY DNA Polymerase from Nanjinouzan Biotech Co. SteadyPure plasmid extraction kit was purchased from Ai Kerui organism. The Luria-Bertani (LB) medium Amp, IPTG, PMSF was configured with reference to the Takara Products Catalog (Dalianbao bioengineering Co., ltd.) operating manual. Fagus xylan was purchased from Sigma-Aldrich, all chemicals were purchased from national pharmaceutical systems chemical Co. DNA polymerase Green Taq Mix, purchased from Nanjinouzan Biotechnology Inc. Analytically pure reagents such as peptone, yeast extract, agar powder, xylose, glucose, sodium chloride, magnesium sulfate, hydrochloric acid, citric acid, sodium hydroxide, etc. were purchased from national pharmaceutical group chemical reagent company. Bacterial-preserving liquid: 50% double distilled water and 50% glycerin, sterilizing at 115 ℃ for 30 minutes, and preserving at 4 ℃ for a long time. Primer synthesis and sequencing services are provided by the Wohanoaceae biotechnology company.

1.2 Cloning of xylanase and its fusion enzyme Gene

The method comprises the steps of taking pET23a-xyn and pET23a-dz1a as templates, designing primers, taking primer sequences as a table, amplifying a vector pET23a fragment and xyn and dz1a fragments by PCR, connecting xyn with the pET23a vector through a seamless cloning technology, transferring into E.coli DH5 alpha competent cells, coating ampicillin-resistant LB solid medium plates (LA), carrying out colony PCR verification after overnight culture at 37 ℃, and selecting positive transformants for sequencing verification. The correctly sequenced transformants were inoculated into LB liquid medium containing ampicillin resistance for cloning and culturing, and plasmids for transformation were obtained.

TABLE 1 primer sequences for constructing fusion genes

Primer name	Primer sequence (5 '. Fwdarw.3')
		DX-F	gaaggagatatacatgcatcatcaccatcaccataataaatggca
DX-R	caccagtcatgctagccatcagccgctgaccgtgatgt
		Fan-f	tgatggctagcatgactggtggacagca
Fan-r	atggtgatggtgatgatgcatgtatatctccttcttaa
		E3-F	aggaggctgctgctaaggaggctgcagctaagcagcaggacggtaagc
E3-R	cttagcagcagcctccttagctgcagcctcttttcccatcgtctcgcg
		E4-F	gctgcagcctccttagcagcagcctccttagctgcagcctcttttcccatcgtctc
E4-R	ctaaggaggctgcagctaaggaggctgctgctaagcagcaggacggtaagcggcaggac
		E5-F	aaggaggctgcagctaaggaggctgctgctaaggaggctgctgctaagcagcaggacgg
G3-F	ggtgggtcgggtggcggtggctcgcagcaggacggtaagcggcaggac
		G3-R	accgccacccgacccaccaccgcccgagccaccgccaccttttcccatcgtctcgcg
XD-F	tacatgcatcatcaccatcaccatcagcaggacggtaagcggcag
		XD-R	agtcatgctagccatcattttcccatcgtctcgcgagaaatag
XED-F	ggaggctgctgctaaggaggctgctgctaagaataaatggcatattaac
		XED-R	ccttagcagcagcctccttagctgcagcctcgccgctgaccgtgatg
XGD-F	ggtgggtcgggtggcggtggctcgaataaatggcatattaacaaat
		XGD-R	ccgccacccgacccaccaccgcccgagccaccgccaccgccgctgaccgtgatg

1.3 Expression and purification of cellulase and xylanase bifunctional fusion enzymes

After the endoglucanase xylanase bifunctional fusion enzyme gene expression vector is transformed into E.coli BL21 (DE 3) expression vector host competence, the transformed competence is coated on a LA solid culture medium flat plate, and placed in a 37 ℃ incubator for overnight culture, then engineering strains E.coli pET23a-dgx, E.coli pET23a-dex, E.coli pET23a-xgd and E.coli pET23 a-feed are selected, respectively transferred into 1L conical flasks containing 300mL of LA liquid culture medium and cultured in a shaking table at 37 ℃, and when the OD value reaches to OD600 = 0.6-0.8, IPTG with the final concentration of 0.4mM is added, and the mixture is placed in 18 ℃ for induction expression. After the induction is carried out for 6 to 8 hours, the bacterial liquid is collected into a 50mL centrifuge tube, a freeze centrifuge at 12000rpm is used for collecting bacterial bodies and bacterial liquid, PBS phosphate buffer solution with Ph7.0 is used for carrying out resuspension and cleaning of bacterial bodies to wash out residual liquid culture medium, a proper amount of PBS phosphate buffer solution is continuously used for carrying out resuspension after the collection by centrifugation, the bacterial bodies subjected to ice bath resuspension are used for breaking cell walls of escherichia coli bacterial bodies, expressed proteins in cells are released by using an ultrasonic breaker, the ultrasonic breaker uses a No. 3 probe with 200W power for 1.5S, the rest time is 3S, the power is 35%, the total ultrasonic time is 30 minutes, and the single breaking volume is 25mL. After the completion of the disruption, the liquid became clear and transparent, and the disrupted cells and the supernatant were collected by freeze centrifugation in a refrigerated centrifuge at 12000rpm at 4 ℃.

And (3) purifying the centrifuged thallus supernatant which is expressed protein crude enzyme liquid by using Ni-NTA resin, firstly balancing a nickel column, washing the nickel column by using buffer solution, hanging the protein crude enzyme liquid on the column, washing the column by using PBS (phosphate buffer solution) containing 10mM imidazole, observing the absorbance at 280nm, washing the column by using 300mM high-concentration imidazole after the absorbance is stable, collecting eluent, and washing the nickel column. The samples were subjected to SDS-PAGE for detection, and the target proteins were expressed intracellularly and extracellularly without target proteins. The predicted protein sizes of the four bifunctional fusion enzymes are 71.3kDa.

2 Fusion enzyme ligation peptide optimization

2.1 Fusion enzyme ligase optimization

At present, in the process of constructing the fusion enzyme, the connecting peptide is considered to be inserted between two enzymes to properly separate domains of the two enzymes, so that mutual interference of domains of the fusion enzyme between single enzymes in the catalysis and folding processes is avoided, and the fusion enzyme is successfully expressed. The selection of the appropriate linker peptide is therefore crucial in constructing the fusion protein. The rigid connecting peptide and the flexible connecting peptide are the most frequent connecting peptide used nowadays, the construction of different fusion enzymes corresponds to different connecting peptides so as to meet different requirements, the rigid connecting peptide can better ensure that two domains between the fusion enzymes keep a better structure, three bifunctional fusion enzymes which are successfully expressed in the experiment are used as the connecting peptides of domains between the single enzymes of the fusion enzymes, namely, the rigid connecting peptide (EAAAK) 3 and the flexible connecting peptide (GGGGS) 3, the fusion enzymes are not shown to have better properties through experimental exploration, but DZ1A-E3-XYN connected with the rigid connecting peptide (EAAAK) 3 in different connection modes of the two connecting peptides shows better than the bifunctional fusion enzymes connected with other connection modes in terms of enzyme activity, similar to the discussion in the literature, the length of the connecting peptides can lead to the change of the functional domains of the fusion enzymes, thereby leading to the change of steric hindrance and further affecting the performance of the activity between the fusion enzymes, and therefore, the rigid connecting peptide (EAK) 4 (EAK) with different lengths is selected as the expected fusion enzyme, and the expected fusion enzyme can be improved. The predicted structure of the connecting peptide optimized fusion enzyme is shown in FIG. 1.

2.2 Expression and purification of enzymes

In the experiment, DZ1A-E3-XYN is taken as a template, rigid connecting peptides (EAAAK) 4 and (EAAAK) 5 with different lengths are selected as fusion enzyme connecting peptide optimizing objects, and the DZ1A-E4-XYN and the DZ1A-E5-XYN are constructed through target genes and are subjected to heterologous expression, so that the soluble recombinant protein is obtained. The theoretical molecular weight of the protein encoded by the fusion gene after optimization of the two connecting peptides is 71.3kDa, and as shown in figure 2, the band size of the fusion target protein after optimization of the DZ1A-E3-XYN and the two connecting peptides accords with expectations. Lane a in the figure: DZ1A-E4-XYN lane b: DZ1A-E5-XYN.

2.3 Optimization of specific enzymatic Activity of bifunctional chimeric enzymes after connecting peptides

The xylanase XYN, the endoglucanase DZ1A and the enzyme solutions of the three expressed fusion enzymes are diluted by proper times, the specific enzyme activities of the bifunctional enzymes are measured by taking 1% beech xylan as a substrate and 1% sodium carboxymethyl cellulose as a substrate, then the enzyme activities are measured according to a DNS method, the enzyme activities are calculated according to an enzyme activity formula, the protein concentrations of the xylanase XYN, the endoglucanase DZ1A and the three expressed bifunctional fusion enzymes are measured according to a protein concentration measuring step, and then the enzyme activities of the xylanase XYN, the endoglucanase DZ1A and the three expressed bifunctional fusion enzymes are calculated, and the xylanase activity of the fusion enzyme DZ1A-E4-XYN after optimizing the length of the connecting peptide is improved by 21% and the cellulase activity is improved by 14% compared with that of the fusion enzyme xylanase before optimizing.

Table 2 xylanase specific enzyme activity (U/mg) against DZ1A-E3-XYN and bifunctional fusion enzyme protein

2.4 Optimization of the optimal reaction temperature of the bifunctional chimeric enzyme after the connecting peptide

Setting a temperature gradient between 30 ℃ and 90 ℃, respectively measuring the activity of the bifunctional fusion enzyme at different reaction temperatures under the same pH and the same reaction time, and exploring the optimal reaction temperature of the four bifunctional fusion enzymes. As shown in FIG. 3-a, the temperature of the fusion enzyme is suitably in the range of 40-70℃as measured by using sodium carboxymethylcellulose as a substrate, wherein the optimal reaction temperature is 60 ℃. When the temperature is higher than the temperature, the enzyme activity is rapidly reduced, when the reaction temperature is higher than 90 ℃, the endoglucanase activity of the fusion enzyme almost loses the capacity of degrading sodium carboxymethyl cellulose, and when the reaction temperature is lower, the enzyme activity can only keep about 40% of the optimal temperature.

As shown in figure 3-b, the xylanase activities of several fusion enzymes with xylan as a substrate are optimized, the optimal temperatures of the connecting peptide fusion enzymes DZ1A-E4-XYN, DZ1A-E5-XYN and the control bifunctional fusion enzymes DZ1A-E3-XYN are 60 ℃, the fusion enzymes at low temperature all show stronger relative enzyme activities, the residual enzyme activities start to drop rapidly after the temperature reaches 70 ℃, 20% of the relative enzyme activities can still be kept at 80 ℃, and the xylanase activities of the fusion enzymes are almost completely lost when the temperature reaches 90 ℃.

2.5 Optimal reaction pH of bifunctional chimeric enzyme after optimization of connecting peptide

Firstly, dissolving a substrate sodium carboxymethyl cellulose in phosphate buffer solutions of PBS with different pH values, setting a pH gradient between pH values of 3.0 and 9.0, and measuring cellulase activities of several bifunctional fusion enzymes under the same reaction time, wherein the temperatures of the several bifunctional fusion enzymes are measured at the optimal reaction temperatures, so that the optimal reaction pH of the several fusion enzymes is explored. As shown in FIG. 4, the optimum reaction pH of the fusion enzymes is about neutral, the optimum reaction pH of the fusion enzymes after the two optimized connecting peptides is 6.0, the relative enzyme activities of the two bifunctional fusion enzymes are rapidly reduced after the pH is 7.0, and the two bifunctional fusion enzymes are more suitable for reaction in the neutral environment, and the relative enzyme activities of the two fusion enzymes are at a very low level when the pH is lower than 4.0.

Xylan is dissolved in PBS phosphate buffer solutions with different pH values, a pH gradient is set between pH3.0 and 10.0, xylanase activities of several bifunctional fusion enzymes are measured under the same reaction time, and the temperatures of the several bifunctional fusion enzymes are measured at the optimal reaction temperatures, so that the optimal reaction pH of the several fusion enzymes is explored. As shown in FIG. 4, the optimum reaction pH of the several fusion enzymes is between weak alkaline and neutral, the optimum reaction pH of the three bifunctional enzymes is 6.0, the residual enzyme activity of the several bifunctional fusion enzymes is rapidly reduced after pH7.0, which indicates that the several bifunctional fusion enzymes are more suitable for reaction in neutral alkaline environment, the enzyme activity of the several fusion enzymes is at a lower level when the pH is lower than 4.0, and the residual enzyme activity of the fusion enzymes after optimization of the two connecting peptides is rapidly increased after pH 4.0.

2.6 Thermostability of the bifunctional chimeric enzyme after optimization of the connecting peptide

Sodium carboxymethyl cellulose is dissolved in phosphate buffer solution of PBS with optimal pH of each enzyme, and is incubated at 50 ℃, 60 ℃ and 70 ℃, residual enzyme activity of endo-cellulase is measured by sampling at intervals of 0min, 5min, 15min, 30min and 60min, stability of fusion enzyme after optimization of two connecting peptides at three different temperatures is further explored, experimental results are shown in figure 5, the stability of the fusion enzyme at 50 ℃ and 60 ℃ is better, the residual enzyme activity can be maintained for more than 90% after one hour of incubation, the residual enzyme activity of three double-function fusion enzymes at 70 ℃ is rapidly reduced after the incubation, and the residual enzyme activity is completely lost after 15 min. The temperature stability of endoglucanase activity was shown to be good at temperatures below 60 ℃.

Xylan is dissolved in PBS phosphate buffer with optimal pH for each enzyme, and incubated at 50 ℃, 60 ℃ and 70 ℃, and samples are taken at intervals of 0min, 5min, 15min, 30min and 60min to determine the residual enzyme activity of the xylanase, so that the stability of fusion enzymes optimized by two connecting peptides at three different temperatures is explored. As shown in FIG. 6, the stability of the fusion enzyme at 50℃was similar to that of the single enzyme, and the residual enzyme activity remained at 90% or more after 30min of incubation. The residual enzyme activities of fusion enzymes after 60-minute incubation at 60 ℃ and optimized by connecting peptide show a gradually decreasing trend, when the reaction temperature reaches 70 ℃, the residual enzyme activities of single xylanase and three bifunctional fusion enzymes after incubation are rapidly reduced, and the residual enzyme activities of the fusion enzymes are completely lost after 5 minutes.

2.7 PH stability of bifunctional chimeric enzymes after optimization of the connecting peptide

The three bifunctional fusion enzymes and endoglucanases are respectively placed in phosphate buffers with pH values of 5.0, 6.0, 7.0 and 8.0 at the temperature of 4 ℃ for treatment, and the residual enzyme activity is measured by sampling every one hour, so that the pH stability of the three bifunctional fusion enzymes and the endoglucanases is explored. The two fusion enzymes after the optimization of the connecting peptide react with the rigid connecting peptide fusion enzyme at the optimal temperature of 60 ℃, untreated enzyme liquid is used as an experimental control group, the experimental result is shown in figure 7, the residual enzyme activities of the fusion enzymes after the optimization of the connecting peptide can still be kept above 90% after the fusion enzymes are incubated in buffer solutions with pH of 5.0, 6.0 and 7.0 for 4 hours, which indicates that the enzymes are stable in a pH phosphate buffer solution environment with neutral metaacid, and the residual enzyme activities of the fusion enzymes after the optimization of the connecting peptide and DZ1A-E3-XYN before the optimization of the connecting peptide can still be kept at about 90% after the fusion enzymes are incubated in phosphate buffer solution with pH of 8.0 for 4 hours, and the residual enzyme activities of the DZ1A-E5-XYN after the optimization of the connecting peptide can only be kept at about 80%, which indicates that the stability of the DZ1A-E5-XYN is weaker than that of the two fusion enzymes of DZ1A-E3-XYN and DZ 1-XYN 4-XYN.

The two bifunctional fusion enzymes after the optimization of the connecting peptide and the fusion enzyme of the control group are placed in phosphate buffer solutions with the pH of 5.0, 6.0, 7.0 and 8.0 at the temperature of 4 ℃ for treatment, and samples are taken every one hour to determine the activity of residual enzymes, so that the pH stability of the fusion enzymes is explored. The two bifunctional fusion enzymes after the optimization of the connecting peptide react with the fusion enzyme of the control group at the optimal temperature of 60 ℃, untreated enzyme liquid is used as an experimental control group, the experimental result is shown in figure 8, the residual enzyme activity of the two bifunctional fusion enzymes after the optimization of the connecting peptide and the fusion enzyme of the control group can still be kept above 90% after the two bifunctional fusion enzymes and the fusion enzyme of the control group are incubated for 4 hours in buffer solutions with pH of 5.0, 6.0 and 7.0, which indicates that the enzymes are stable in the pH phosphate buffer solution environment with neutral bias acid, and the residual enzyme activity of the DZ1A-E3-XYN fusion enzyme of the control group and the DZ1A-E4-XYN fusion enzyme after the optimization of the connecting peptide is kept above 95% after the incubation for 4 hours, which is obviously higher than the residual enzyme activity of DZ 1A-E5-YN.

Conclusion 3

The fusion enzyme is widely applied to various fields, a fusion strategy is used for constructing a single gene with cellulase function and xylanase function, endoglucanase DZ1A from thermophilic anaerobic bacillus GH5 family and xylanase XYN from streptomyces GH11 family are used for sequentially connecting DZ1A-XYN and XYN-DZ1A by using flexible connecting peptide and rigid connecting peptide, and DZ1A-E3-XYN, DZ1A-G3-XYN and XYN-E3-DZ1A are successfully expressed in escherichia coli. The influence of different flexible and rigid connecting peptides and the order of connection on the enzymatic properties of DZ1A and XYN, respectively, was investigated. The specific activities of DZ1A and DZ1A-E3-XYN, DZ1A-G3-XYN, XYN-E3-DZ1A were 691.131U/mg,182.5245U/mg,133.950U/mg,173.967U/mg, XYN and DZ1A-E3-XYN, DZ1A-G3-XYN, XYN-E3-DZ1A were 1027.154U/mg,134.869U/mg,106.186U/mg,114.588U/mg, respectively, measured at 60℃under pH 6.0. Compared with DZ1A, the specific activity of DZ1A-E3-XYN is reduced by 73.6%. The optimum reaction pH of DZ1A-E3-XYN was 6 for CMC-Na and xylan substrates, and the optimum reaction temperature was 60℃for CMC-Na substrates, which was reduced by 10℃compared to the wild type. DZ1A-E3-XYN showed higher temperature stability at CMC-Na substrate than DZ1A. Incubating at 60 ℃ for 1h under a xylan substrate, wherein the DZ1A-E3-XYN residual enzyme activity is 51% and XYN is only 27%; the pH value is in the range of 5-8, and DZ1A-E3-XYN can maintain more than 90% of enzyme activity after 4h incubation at 4 ℃ under two substrates. In order to improve the specific enzyme activity of the bifunctional fusion enzyme, the length of the DZ1A-E3-XYN connecting peptide is optimized, and the two bifunctional proteins DZ1A-E4-XYN and DZ1A-E5-XYN are expressed by increasing the length of the connecting peptide. Compared with the bifunctional fusion enzyme DZ1A-E3-XYN xylanase before optimization, the optimal reaction condition of the fusion enzyme DZ1A-E4-XYN xylanase after optimizing the length of the connecting peptide is not changed, the specific activity is improved by 21%, and the cellulase activity is improved by 14%. Optimizing the length of the connecting peptide improves the enzyme activity to a certain extent, and expands new consideration directions in the aspects of enzyme molecular transformation and enzyme performance improvement.

The foregoing is illustrative of the best mode of carrying out the invention, and is not presented in any detail as is known to those of ordinary skill in the art. The protection scope of the invention is defined by the claims, and any equivalent transformation based on the technical teaching of the invention is also within the protection scope of the invention.

Claims (7)

1. The preparation method of the optimized cellulase-xylanase fusion enzyme is characterized by constructing a single gene with a cellulase function and a xylanase function, connecting the single gene by using a rigid connecting peptide EAAAK, and expressing the optimized cellulase-xylanase fusion enzyme in escherichia coli.

2. The method for preparing the optimized cellulase-xylanase fusion enzyme according to claim 1, wherein the fusion is carried out by adopting an N-terminal fusion mode.

3. The method for preparing the optimized cellulase-xylanase fusion enzyme according to claim 1, wherein the length of the rigid linking peptide EAAAK is four times the length.

4. An optimised cellulase-xylanase fusion enzyme, characterised in that it is obtainable by a process according to any one of claims 1 to 3.

5. The optimized cellulase-xylanase fusion enzyme according to claim 4, wherein the reaction temperature of the fusion enzyme is in the range of 40 ℃ to 70 ℃ with sodium carboxymethyl cellulose as a substrate.

6. The optimized cellulase-xylanase fusion enzyme according to claim 4, wherein the reaction temperature of the fusion enzyme is 60 ℃ with sodium carboxymethylcellulose as substrate.

7. The optimized cellulase-xylanase fusion enzyme according to claim 4, wherein the reaction pH of the fusion enzyme is 6.0.