CN118147149A

CN118147149A - Method for knocking out genes of mice and miR-455 gene knocked out mouse model constructed by same

Info

Publication number: CN118147149A
Application number: CN202410458345.5A
Authority: CN
Inventors: 谢利豹; 武会娟; 季鹏远; 丁晓婷; 王玮; 范柠粼
Original assignee: Beijing Laboratory Animal Research Center Co ltd
Current assignee: Beijing Laboratory Animal Research Center Co ltd
Priority date: 2024-04-16
Filing date: 2024-04-16
Publication date: 2024-06-07

Abstract

The application provides a gRNA for targeting a mouse miR-455 gene, a method for knocking out the gene of the mouse and a construction method of a miR-455 gene knockout mouse model. Wherein the method comprises disrupting the mouse miR-455 gene using gene editing technology. The application designs the gRNA of the miR-455 gene with specific targeting, and uses the Cas9 protein to knock out the miR-455 gene to obtain a gene knockout mouse model, thereby providing assistance for researching the effect of miR-455 in diseases such as osteoporosis and Alzheimer disease.

Description

Method for knocking out genes of mice and miR-455 gene knocked out mouse model constructed by same

Technical Field

The application belongs to the technical field of genetic engineering, and particularly relates to a method for knocking out a mouse gene and a miR-455 gene knockout mouse model constructed by the method.

Background

Mirnas are a class of non-coding RNAs encoded by endogenous genes, the mature body of which is about 22nt in length. The miRNA has the functions of inhibiting the expression of the translation regulatory gene of a target gene after transcription, and further indirectly realizing the regulation of the physiological and pathological states. Studies have shown that mirnas are closely related to the occurrence of a variety of diseases including cancer. mirnas are involved in cellular senescence and regulation of senescence, and mirnas may affect the senescence process by targeting specific genes. Furthermore, the deregulation of mirnas may also be associated with certain aging-related diseases, such as arteriosclerosis, neuroinflammation, osteoarthritis, sarcopenia, chronic inflammation, etc. Inflammatory cells present in the tumor microenvironment produce a range of inflammatory factors that promote tumorigenesis and cancer cell metastasis by reducing genomic stability, promoting cancer cell proliferation and angiogenesis, and thus many diseases are indicative of aging, and research of the effects of mirnas on aging-related diseases lays a foundation for aging research. Research on miRNA knockout is helpful for revealing pathogenesis of diseases, and new treatment strategies and drug targets are found, so that new ideas and methods for disease diagnosis and treatment are provided. In addition, the generation and action mechanism of miRNA can be known, and the role of miRNA in gene expression regulation is further explored.

MiR-455 is a widely conserved miRNA family member that is expressed in most animal phylum, including mammals and primates. miR-455-5p can inhibit prostate cancer progression by targeting chemokine receptor 5 (CCR 5); targeting FMS-like tyrosine kinase 3 (FLT 3) reduces brain ischemia reperfusion injury. The gene knockout of miR-455-5p can promote the migration and invasion of oral cancer cells, and induce epithelial mesenchymal transition; attenuating isoprenaline-induced cardiac remodeling. miR-455-3p can reduce apoptosis and reduce chondrocyte degeneration by modulating the phosphatidylinositol 3 kinase (PI 3K)/protein kinase B (AKT) pathway; modulation of histone deacetylase 2 (HDAC 2) protein levels inhibits Kelch-like ECH associated protein 1 (Keap 1), activates the nuclear factor E2 associated factor 2 (Nrf 2)/Antioxidant Response Element (ARE) signaling pathway, thereby inhibiting oxidative stress and promoting bone cell growth. In addition, miR-455-3p can reduce Amyloid Precursor Protein (APP) and amyloid beta (Abeta) levels, and reduce mitochondrial biogenesis defects, mitochondrial dynamics damage and synaptic defects, thereby having a protective effect on Alzheimer's disease toxicity. The gene knockout of miR-455 causes diseases such as cartilage, heart and brain related to aging to occur, so that the service life of a mouse is shortened, and the overexpression of the miR-455 can protect osteoarthritis, cause cardiac remodeling, relieve cerebral ischemia reperfusion injury and osteoporosis oxidative stress injury, and further prolong the service life of the mouse. In a word, miR-455 is a promising target for prolonging aging and treating aging-related diseases, but specific action mechanisms and potential treatment effects of the miR-455 still need to be further researched and verified, so that the preparation of miR-455 knockout mice has important significance for research on miR-455 functions and specific mechanisms, and lays a foundation for research on treatment of related diseases.

Disclosure of Invention

The application aims to provide a method for knocking out a gene of a mouse and a constructed miR-455 gene knockout mouse model.

In particular, the application relates to the following aspects:

1. A gRNA for targeting a mouse miR-455 gene, wherein the gRNA comprises a nucleotide sequence that is partially complementary to the mouse miR-455 gene and flanking 100 nucleotide regions.

2. The gRNA according to item 1, wherein the nucleotide sequence of the gRNA is shown as SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO. 3 or SEQ ID NO. 4.

3. A method of gene knockout in a mouse, wherein the method comprises:

the mouse miR-455 gene is disrupted by gene editing techniques.

4. The method of item 3, wherein the gene editing technique is a zinc finger nuclease-based gene editing technique, a TALEN gene editing technique, or a CRISPR/Cas9 gene editing technique.

5. The method of item 4, wherein the gene editing technique is a CRISPR/Cas9 gene editing technique.

6. The method of item 3, wherein the gRNA used to target the mouse miR-455 gene is selected from one or more of the group consisting of a first gRNA shown in SEQ ID NO:1, a second gRNA shown in SEQ ID NO:2, a third gRNA shown in SEQ ID NO:3, and a fourth gRNA shown in SEQ ID NO: 4.

7. The method of item 6, wherein the gRNAs used to target the mouse miR-455 gene are a first gRNA shown in SEQ ID NO. 1 and a third gRNA shown in SEQ ID NO. 3, a first gRNA shown in SEQ ID NO. 1 and a fourth gRNA shown in SEQ ID NO. 4, a second gRNA shown in SEQ ID NO. 2 and a third gRNA shown in SEQ ID NO. 3, or a second gRNA shown in SEQ ID NO. 2 and a fourth gRNA shown in SEQ ID NO. 4.

8. The method of any one of items 3-7, wherein the method comprises the steps of:

Preparing a gene editing fluid comprising Cas9 and a gRNA for targeting the mouse miR-455 gene;

delivering the gene editing fluid into a fertilized ovum of a mouse;

culturing the delivered fertilized eggs until the two cells are transplanted into pseudopregnant mice to obtain miR-455 gene knockout mice.

9. The method of item 8, wherein the gRNA for targeting the mouse miR-455 gene is the gRNA of the miR-455 gene that was obtained after screening confirmation of knockout efficiency using mouse cells.

10. The method of item 9, wherein screening for knockout efficiency using mouse cells comprises the steps of:

Constructing the designed gRNA into a PX459 vector for delivery to a mouse cell;

Puromycin is screened to obtain gRNA with high knockout efficiency as the gRNA of miR-455 gene obtained after screening and confirmation.

11. The method of item 10, wherein the delivery is liposome transfection.

12. The method of item 10, wherein the mouse cell is a B16 cell.

13. The method of item 8, wherein the preparing a gene editing fluid comprising Cas9 and a gRNA for targeting the mouse miR-455 gene comprises the steps of:

Synthesizing a gRNA mixed solution for targeting the mouse miR-455 gene;

mixing the gRNA cocktail and the Cas9 to obtain a gene editing fluid.

14. The method of claim 13, wherein synthesizing a gRNA cocktail for targeting the mouse miR-455 gene comprises:

mixing the first gRNA and the fourth gRNA according to the molar ratio of (1-2).

15. The method according to item 13, wherein the molar ratio of Cas9 to gRNA mixture in the gene editing fluid is (2-3): 2-5.

16. The method of item 8, wherein the delivery is electrotransfection.

17. A method of constructing a mouse model for miR-455 gene knockout, wherein the method comprises:

the mouse miR-455 gene is disrupted by gene editing techniques.

18. The method of item 17, wherein the gene editing technique is a zinc finger nuclease-based gene editing technique, a TALEN gene editing technique, or a CRISPR/Cas9 gene editing technique.

19. The method of item 18, wherein the gene editing technique is a CRISPR/Cas9 gene editing technique.

20. The method of item 17, wherein the gRNA used to target the mouse miR-455 gene is selected from one or more of the group consisting of a first gRNA shown in SEQ ID NO:1, a second gRNA shown in SEQ ID NO:2, a third gRNA shown in SEQ ID NO:3, and a fourth gRNA shown in SEQ ID NO: 4.

21. The method of item 20, wherein the gRNAs used to target the mouse miR-455 gene are a first gRNA shown in SEQ ID NO.1 and a third gRNA shown in SEQ ID NO.3, a first gRNA shown in SEQ ID NO.1 and a fourth gRNA shown in SEQ ID NO.4, a second gRNA shown in SEQ ID NO. 2 and a third gRNA shown in SEQ ID NO.3, or a second gRNA shown in SEQ ID NO. 2 and a fourth gRNA shown in SEQ ID NO. 4.

22. The method according to any one of claims 17-21, wherein the method comprises the steps of:

delivering the gene editing fluid into a fertilized ovum of a mouse;

23. The method of claim 22, wherein the gRNA used to target the mouse miR-455 gene is the gRNA of the miR-455 gene that was obtained after screening confirmation of knockout efficiency using mouse cells.

24. The method of item 23, wherein screening for knockout efficiency using mouse cells comprises the steps of:

25. The method of item 24, wherein the delivery is liposome transfection.

26. The method of claim 24, wherein the mouse cell is a B16 cell.

27. The method of claim 22, wherein the preparing a gene editing fluid comprising Cas9 and a gRNA for targeting the mouse miR-455 gene comprises the steps of:

Synthesizing a gRNA mixed solution for targeting the mouse miR-455 gene;

mixing the gRNA cocktail and the Cas9 to obtain a gene editing fluid.

28. The method of claim 27, wherein synthesizing a gRNA cocktail for targeting the mouse miR-455 gene comprises:

Mixing the first gRNA and the fourth gRNA in the molar ratio of (1-2) to (1-2).

29. The method of item 27, wherein the molar ratio of Cas9 to gRNA cocktail in the gene editing fluid is (2-3): 2-5.

30. The method of item 22, wherein the delivery is electrotransfection.

31. A mouse model of miR-455 gene knockout, wherein the mouse model is constructed by the method of any one of claims 17-30.

The application designs four gRNAs of the miR-455 gene of a specific targeted mouse, and uses Cas9 protein to knock out the miR-455 gene to cause frame shift mutation, so as to achieve the aim of knocking out the gene of the mouse. The method for modifying the mouse gene is simple and feasible, has short period, and the mouse model constructed by the method can fully research the pathogenesis of miR-455 in diseases such as osteoporosis and Alzheimer's disease and provide service for further developing treatment modes aiming at the diseases.

Drawings

FIG. 1 shows the detection result of miR-455 gene target single nucleotide polymorphism, wherein M is D2000Maker, and bands are 100bp,250bp,500bp,750bp,1000bp and 2000bp respectively.

FIG. 2 shows the identification of the construction of the vector PX 459-gRNA.

FIG. 3 is an identification result of miR-455 knockout mouse melanoma cells.

FIG. 4 shows the identification result of miR-455 genotype of F0 mice.

FIG. 5 shows the identification result of miR-455 genotype of F1-generation mice.

Detailed Description

The application will be further illustrated with reference to the following examples, which are to be understood as merely further illustrating and explaining the application and are not to be construed as limiting the application.

Unless defined otherwise, technical and scientific terms used in this specification have the same meaning as commonly understood by one of ordinary skill in the art. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application, the materials and methods are described herein below. In case of conflict, the present specification, including definitions therein, will control and materials, methods, and examples, will control and be in no way limiting. The application is further illustrated below in connection with specific examples, which are not intended to limit the scope of the application.

Definition of the definition

The terms "polynucleotide", "nucleotide sequence", "nucleic acid" and "oligonucleotide" are used interchangeably herein. They refer to polymeric forms of nucleotides of any length (deoxyribonucleotides or ribonucleotides) or analogs thereof. Examples of polynucleotides include, but are not limited to, coding or non-coding regions of a gene or gene fragment, exons, introns, messenger RNAs (mrnas), transfer RNAs (trnas), ribosomal RNAs (rrnas), short interfering RNAs (sirnas), short hairpin RNAs (shrnas), small molecule RNAs (mirnas), ribozymes, cdnas, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, any sequence-isolated DNA, any sequence-isolated RNA, nucleic acid probes, and primers. One or more nucleotides in the polynucleotide may be further modified. The sequence of nucleotides may be interrupted by non-nucleotide components. The polynucleotide may also be modified after polymerization, for example by coupling with a labeling agent.

The term "CRISPR/Cas9" as used herein is an adaptive immune defense that bacteria and archaea develop during long-term evolution, useful against invasive viruses and foreign DNA. The CRISPR/Cas9 gene editing technology is a technology for carrying out specific DNA modification on a target gene. Gene editing technology based on CRISPR/Cas9 has shown great application prospect in a series of application fields of gene therapy, such as hematopathy, tumor and other genetic diseases. The technical result is applied to the genome precise modification of human cells, zebra fish, mice and bacteria.

The terms "gRNA," "guide RNA," and "CRISPR guide sequence" are used interchangeably throughout herein and refer to a nucleic acid comprising a sequence that determines the specificity of a CRISPR/Cas system Cas binding protein. The gRNA hybridizes (partially or fully complementary) to a target nucleic acid sequence in the host cell genome. The length of the gRNA or portion thereof that hybridizes to the target nucleic acid can be between 15-25 nucleotides, 18-22 nucleotides, or 19-21 nucleotides. In some embodiments, the length of the gRNA sequence that hybridizes to a target nucleic acid can be 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides. In some embodiments, the length of the gRNA sequence that hybridizes to the target nucleic acid is between 10-30 or 15-25 nucleotides.

The term "gRNA" as used herein generally refers to either single molecule guide RNAs or single stranded guide RNAs in an artificial CRISPR/Cas9 system, refers to RNAs that direct Cas proteins to specifically bind to target DNA sequences, and is an important component in a CRISPR gene knockout/knock-in system. The gRNA of the application comprises a guide sequence that targets a target sequence. In a preferred embodiment, the sgrnas of the present application further comprise a tracrRNA sequence and a crRNA sequence.

"Guide sequence" in the present application refers to a sequence of about 17-20bp specifying the targeting site, and is used interchangeably with "guide sequence" or "spacer". In the context of forming a CRISPR complex, a "target sequence" is a sequence to which a guide sequence is designed to have complementarity, wherein hybridization between the target sequence and the guide sequence promotes CRISPR complex formation, which hybridization requires that the "target sequence" and the "guide sequence" or "guide sequence" have sufficient complementarity to cause hybridization and promote CRISPR complex formation, and complete complementarity is not necessary.

"Complementary" means that the "guide sequence" or "guide sequence" hybridizes to a target nucleotide sequence (the "guide sequence" is designed on the miR-455 gene and flanking regions of the target knockout mouse miR-455 gene, so that the miR-455 gene and the flanking 100 nucleotide regions are target nucleotide sequences) by the principle of nucleotide pairing found by Watson and Crick for purposes of this application. It will be appreciated by those skilled in the art that a "guide sequence" can hybridize to a target nucleotide sequence so long as it has sufficient complementarity, without requiring 100% complete complementarity between them. In some embodiments, the degree of complementarity between a guide sequence and its corresponding target sequence can be about or greater than about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more when optimally aligned using an appropriate alignment algorithm. The optimal alignment may be determined by any suitable algorithm for aligning sequences, including the Smith-Waterman algorithm, the Needleman-Wimsch algorithm, the Burows-Wheeler Transform based algorithm, and the like.

Generally, in the context of endogenous CRISPR systems, the formation of a CRISPR complex (including hybridization of a guide sequence to a target sequence and complexing with one or more Cas proteins) results in cleavage of one or both strands in or near the target sequence (e.g., in a range of 1,2, 3,4, 5,6, 7, 8, 9, 10, 20, 50 or more base pairs from the target sequence). Without wishing to be limited by theory, a tracr sequence may comprise or consist of all or a portion of a wild-type tracr sequence (e.g., about or greater than about 20, 23, 26, 29, 32, 35, 38, 41, 44, 47, 50, 53, 56, 59, 62, 65, 70, 75, 80, 85 or more nucleotides of a wild-type tracr sequence) may also form part of a CRISPR complex, e.g., by hybridization along at least a portion of the tracr sequence to all or a portion of a crRNA sequence to which a guide sequence is operably linked.

In some embodiments, the tracr sequence has sufficient complementarity to the crRNA sequence to hybridize and participate in the formation of CRISPR complexes. Similar to the case of hybridization of a "target sequence" and a "guide sequence" or "guide sequence", complete complementarity is not necessary, as long as it is sufficient to perform its function. In some embodiments, the tracr sequence has at least 50%, 60%, 70%, 80%, 90%, 95% or 99% complementarity along the length of the crRNA sequence, with optimal alignment.

The term "gene knockout" or "knockout" as used herein refers to editing a gene in a cell (e.g., modifying the gene by insertion, substitution, and/or deletion) such that the gene loses its original function (e.g., fails to express a functional protein). Genes in the cell genome can be edited using various known molecular biology techniques (e.g., using zinc finger nuclease-based gene editing techniques, TALEN gene editing techniques, and CRISPR/Cas (e.g., CRISPR/Cas 9) gene editing techniques). Gene knockout is not limited to complete deletion or removal of the entire gene, but may be performed so long as the gene loses its original function. For example, knockout of a gene can be accomplished by inserting an exogenous DNA fragment into the gene such that the gene cannot express a functional protein, or by inserting or deleting one or more bases into the gene such that the gene undergoes a frameshift mutation. For example, CRISPR/Cas9 gene editing techniques can be used in the gene knockout of the present application.

The term "vector" as used herein refers to a nucleic acid vehicle into which a polynucleotide may be inserted. When a vector enables expression of a protein encoded by an inserted polynucleotide, the vector is referred to as an expression vector. The vector may be introduced into a host cell by transformation, transduction or transfection such that the genetic material elements carried thereby are expressed in the host cell. Vectors are well known to those skilled in the art and include, but are not limited to: a plasmid; phagemid; artificial chromosomes, such as Yeast Artificial Chromosome (YAC), bacterial Artificial Chromosome (BAC), or P1-derived artificial chromosome (PAC); phages such as lambda phage or M13 phage, animal viruses, etc. Animal viruses that may be used as vectors include, but are not limited to, retrovirus (including lentivirus), adenovirus, adeno-associated virus, herpes virus (e.g., herpes simplex virus), poxvirus, baculovirus, papilloma virus, papilloma vacuolation virus (e.g., SV 40). A vector may contain a variety of elements that control expression, including, but not limited to, promoter sequences, transcription initiation sequences, enhancer sequences, selection elements, and reporter genes. In addition, the vector may also contain a replication origin.

The term "delivery" as used herein refers to the introduction of biological macromolecules such as nucleic acids, proteins, and the like into a cell membrane from outside the cell membrane by some means. Such as electrotransfection, lipofection, lipid-nanoparticle delivery, viral delivery, exosome delivery, and the like.

The term "flanking" as used herein refers to both ends of a sequence, meaning upstream and/or downstream of the sequence (i.e., the 5 'and/or 3' ends of the sequence).

The present application provides a gRNA for targeting a mouse miR-455 gene, said gRNA comprising a nucleotide sequence partially complementary to the mouse miR-455 gene and flanking 100 nucleotide regions.

In a specific embodiment, the nucleotide sequence of the gRNA is shown as SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3 or SEQ ID NO. 4.

Wherein SEQ ID NO. 1 is:

CACACCAGGGAGGGCAGCAC；

SEQ ID NO. 2 is:

TCCTTCCACAGGTCGCGAGC；

SEQ ID NO. 3 is:

CCTCAAGGTCTATGTCATCG；

SEQ ID NO. 4 is:

TCTATGTCATCGAGGACCCC。

The present application provides a method for gene knockout in mice, wherein the method comprises: the mouse miR-455 gene is disrupted by gene editing techniques.

It will be appreciated by those skilled in the art that after learning the high-efficiency gene editing region (in the present application, the mouse miR-455 gene), those skilled in the art can edit the learned high-efficiency gene editing region by any gene editing method, such as zinc finger nuclease-based gene editing technology, TALEN gene editing technology, CRISPR/Cas (e.g., CRISPR/Cas 9) gene editing technology, and other gene editing methods discovered in the future, so as to optimize the gene editing conditions and achieve the purpose of high-efficiency editing. Thus, the application encompasses the technical approach of gene knockout of the mouse miR-455 gene identified by the application by any available gene editing method.

In a specific embodiment, the application disrupts the mouse miR-455 gene by a CRISPR/Cas9 technique, wherein the gRNA used in the CRISPR/Cas9 technique targets the mouse miR-455 gene.

Wherein the miR-455 gene is located on chromosome 4 of the mouse, and the gene position is GRCm NC_000070.7 (63175088-63175169).

In a specific embodiment, the gRNA used to target the mouse miR-455 gene is selected from one or two of the first gRNA shown in SEQ ID NO.1, the second gRNA shown in SEQ ID NO. 2, the third gRNA shown in SEQ ID NO. 3, and the fourth gRNA shown in SEQ ID NO. 4.

In a specific embodiment, the gRNAs used to target the mouse miR-455 gene are a first gRNA shown in SEQ ID NO.1 and a third gRNA shown in SEQ ID NO. 3. In a specific embodiment, the gRNAs used to target the mouse miR-455 gene are a first gRNA shown in SEQ ID NO.1 and a fourth gRNA shown in SEQ ID NO. 4. In a specific embodiment, the gRNA used to target the mouse miR-455 gene is a second gRNA shown in SEQ ID NO. 2 and a third gRNA shown in SEQ ID NO. 3. In a specific embodiment, the gRNA used to target the mouse miR-455 gene is a second gRNA shown in SEQ ID NO. 2 and a fourth gRNA shown in SEQ ID NO. 4.

In a specific embodiment, the method of gene knockout in mice comprises the steps of: preparing a gene editing fluid comprising Cas9 and a gRNA for targeting the mouse miR-455 gene; delivering the gene editing fluid into a fertilized ovum of a mouse; culturing the delivered fertilized eggs until the two cells are transplanted into pseudopregnant mice to obtain miR-455 gene knockout mice.

Among them, the gene editing liquid preparation method can be prepared by various methods known in the art.

In a specific embodiment, the gRNA used to target the mouse miR-455 gene is that of the miR-455 gene that has been identified by screening for knockdown efficiency using mouse cells.

In a specific embodiment, the screening for knockout efficiency using mouse cells comprises the steps of: constructing the designed gRNA into a PX459 vector for delivery to a mouse cell; puromycin is screened to obtain gRNA with high knockout efficiency as the gRNA of miR-455 gene obtained after screening and confirmation.

In a specific embodiment, the delivery is liposome transfection. Specific procedures for lipofection are known in the art.

In a specific embodiment, the mouse cell is a B16 cell.

In a specific embodiment, preparing a gene editing fluid comprising Cas9 and a gRNA for targeting the mouse miR-455 gene comprises the steps of: synthesizing a gRNA mixed solution for targeting the mouse miR-455 gene; mixing the gRNA cocktail and the Cas9 to obtain a gene editing fluid.

Wherein the synthesis comprising the gRNA cocktail, and comprising Cas9, can be by methods known in the art.

In a specific embodiment, preparing a gene editing fluid comprising Cas9 and a gRNA for targeting the mouse miR-455 gene comprises the steps of: synthesizing a gRNA mixture comprising the first gRNA and the fourth gRNA; mixing the gRNA cocktail and the Cas9 to obtain a gene editing fluid.

In a specific embodiment, synthesizing a gRNA cocktail for targeting the mouse miR-455 gene comprises: mixing the first gRNA and the fourth gRNA in a molar ratio of (1-2): (1-2) to obtain a gRNA mixed solution, for example, 1:1, 1:1.5, 1:2, 1.5:1, 1.5:2, 2:1, 2:1.5, and the like.

In a specific embodiment, the molar ratio of Cas9 to gRNA mixture in the gene editing fluid is (2-3): (2-5), for example, may be 1:1, 2:2.5, 2:3, 2:3.5, 1:2, 2:4.5, 2:5, 2.5:2, 2.5:3, 2.5:3.5, 2.5:4, 2.5:4.5, 3:2, 3:2.5, 3:3.5, 3:4, 3:4.5, 3:3:5.

In a specific embodiment, the delivery is electrotransfection. Specific procedures for electrotransfection are known in the art.

In a specific embodiment, the method of gene knockout in mice comprises the steps of: synthesizing a gRNA mixture comprising the first gRNA and the fourth gRNA, mixing the gRNA mixture with the Cas9 to obtain a gene editing solution; delivering the gene editing fluid into a fertilized ovum of a mouse; culturing the delivered fertilized eggs until the two cells are transplanted into pseudopregnant mice to obtain miR-455 gene knockout mice. Wherein the nucleotide sequence of the first gRNA is shown as SEQ ID NO. 1, the nucleotide sequence of the fourth gRNA is shown as SEQ ID NO. 4, and the molar ratio of the first gRNA to the fourth gRNA is (1-2). The molar ratio of the Cas9 to the gRNA mixed solution in the gene editing solution is (2-3) to (2-5). The delivery is electrotransfection.

In a specific embodiment, the mouse is a C57BL/6J mouse.

The application also provides a construction method of the miR-455 gene knockout mouse model, which comprises the following steps: the mouse miR-455 gene is disrupted by gene editing techniques.

In a specific embodiment, the method of gene knockout in mice comprises the steps of: synthesizing a gRNA mixture comprising the first gRNA and the fourth gRNA, mixing the gRNA mixture with the Cas9 to obtain a gene editing solution; delivering the gene editing fluid into a fertilized ovum of a mouse; culturing the delivered fertilized eggs until the two cells are transplanted into pseudopregnant mice to obtain miR-455 gene knockout mice. Wherein the nucleotide sequence of the first gRNA is shown as SEQ ID NO. 1, the nucleotide sequence of the fourth gRNA is shown as SEQ ID NO. 4, and the molar ratio of the first gRNA to the fourth gRNA is (1-2). The molar ratio of the Cas9 to the gRNA mixed solution in the gene editing solution is (2-3) and (2-5). The delivery is electrotransfection.

The application also provides a mouse model constructed by the method.

Examples

The instrument used in the application comprises:

A stereoscopic vision (olymbas, SZX 7), a 5% CO2 incubator at 37 ℃ (Sanyang, MCO 15A), a fluorescence inversion microscope (olymbas, IX 73), a heat station (THERMOPLATE), an electrotometer (BEX, CUY21 EDIT II), proFlex PCR SYSTEM (Siemens fly, proFlex 3 ×32well PCR system), a gel imager (BiO-RAD, universal Hood II), an electrophoresis apparatus (BiO-RAD, powerPac (TM) Basic), a carbon dioxide thermostated incubator (Ruiword, D180-P), a thermostated low speed centrifuge (Ai Bende, 5702R), an inverted fluorescence microscope (olymbas, IX 51), a thermostated water bath (Shanghai Simpson, DKS 24), a cell counter (Rewadded, C100), a double biosafety cabinet (Shandorperace, BSC-1360IIA 2).

The reagent used in the application comprises the following components:

BPII (Sairofil, ER 0291), minElute PCR Purification Kit (QIAGEN, 2084), T4 DNALIGASE KIT (Sorpe, T1410), phanta Max Super-FIDELITY DNA Polymerase (Norwegian, P505), minElute PCR Purification Kit (Kjeldahl, 28004), ageI (Cexise, SE 1464S), hyaluronidase (Nanjing Abbe, M2215), M2 broth (Sigma, M7167), tissue culture oil (SAGE, ARF 4008P-5P), pregnana serum hormone PMSG (Ningbo triose), human chorionic gonadotrophin hCG (Ningbo triose), PBS solution (Sorby, P1010), TSINGKE TSE 030T 3 Super PCR Mix (TSInGK 030, TSE 030), small-medium kits (NGEN, DP 118), agarose fast gel recovery Kit (Generay, GK 7045-200), PCR product purification Kit (Generay, GK 2052-100), 5 min/Blujin (Clone, brown), PCR (Centin, tsingal), PCR solution (Centin, tsingal, P601), PCR (Centipedin, tsingal, P37) and (Tsingal, 35) are described herein, Spy Cas9NLS(NEB，M0646T)。

Example 1

1GRNA design

Four gRNAs for knockout, namely gRNA1, gRNA2, gRNA3 and gRNA4, are designed aiming at miR-455 genes.

Wherein, the sequence of the gRNA1 is as follows: CACACCAGGGAGGGCAGCAC (SEQ ID NO: 1);

The sequence of gRNA2 is: TCCTTCCACAGGTCGCGAGC (SEQ ID NO: 2);

the gRNA3 sequence is: CCTCAAGGTCTATGTCATCG (SEQ ID NO: 3);

the gRNA4 sequence is: TCTATGTCATCGAGGACCCC (SEQ ID NO: 4).

2 Target single nucleotide polymorphism detection

Using NCBIPrimer-BLAST, a pair of primers was designed to amplify all gRNAs, and NO nonspecific band was generated after genome editing was performed using the primers, wherein the forward primer had a sequence of CATTGGGCCCAGATGACCTT (SEQ ID NO: 5) and the reverse primer had a sequence of TACACATGCTGCTTCCTGGG (SEQ ID NO: 6).

The amplified product was subjected to 1% agarose gel electrophoresis detection and sequencing detection, and the agarose gel electrophoresis detection results are shown in FIG. 1. M is D2000 Marker, the bands are respectively 100bp,250bp,500bp,750bp,1000bp and 2000bp, the electrophoresis detection result shows that the target band is 724bp, and the primer has no specific band.

And (3) sending the PCR stock solution containing the target band to a company for sequencing detection, wherein the detection result shows that the position of the gRNA has no single nucleotide mutation.

3 Construction of plasmid

Mixing gRNA-F and gRNA-R synthesized by the Optimaceae company, and annealing according to the procedure of table 1; selecting a proper cloning site, linearizing a PX459 vector by adopting an enzyme digestion method, wherein an enzyme digestion system is shown in Table 2; the ligation products were transformed, plated, and monoclonal were selected according to the ligation of the enzyme-linked system of Table 3, and the successful construction of the vector PX459-gRNA was finally confirmed by bacterial liquid PCR, and the results are shown in FIG. 2. The electrophoresis result shows that all four gRNAs were successfully inserted into PX459 vector.

TABLE 1gRNA annealing procedure

Table 2PX459 vector cleavage System

TABLE 3 enzyme-linked systems

4 Identification of vector efficiency

PX459-gRNA1+PX459-gRNA3 vector, PX459-gRNA1+PX459-gRNA4 vector, PX459-gRNA2+PX459-gRNA3 vector and PX459-gRNA2+PX459-gRNA4 vector were prepared according to 1:1 into the melanoma cells (B16) of the mice, adding puromycin after 48 hours for screening culture, extracting the cells after 48 hours for PCR amplification, and carrying out 1% agarose gel electrophoresis identification on the PCR products. As shown in the figure 3, the identification result of the vector efficiency shows that the gRNA1+gRNA3, the gRNA1+gRNA4, the gRNA2+gRNA3 or the gRNA2+gRNA4 can lead the fragments to be knocked out successfully, the target strips are two, the knocked-out fragments are different in size, the knocked-out fragments of the gRNA1+gRNA4 are 107bp in length, and the knocked-out efficiency is higher.

5 Preparation of Gene editing liquid

Synthesizing gRNA1 and gRNA4, and preparing gRNA1 and gRNA4 into gRNA mixed solution according to the mol ratio of 1:1; and then will beThe Spy Cas9NLS and gRNA mixed solution were mixed in a molar ratio of 3:2 and Opti-MEM culture solution was added by volume to prepare a gene editing solution.

6. Gene editing liquid conveying fertilized egg

6.1 Superovulation of female mice

PMSG and hCG were diluted to 50IU/ml and PMSG was intraperitoneally injected into 4-week-old C57BL/6J female mice, 10 IU/mouse. 48 hours after PMSG, hCG was injected intraperitoneally, 10 IU/mouse. Immediately after hCG injection, the mice were housed in a male cage, and 1 male mouse was housed in a female cage.

6.2 Preparation of culture droplets

Hyaluronidase digested droplets: 200. Mu.L of hyaluronidase were prepared in 35mm dishes, 5 drops were prepared around 50. Mu. L M2, covered with mineral oil and incubated overnight at 37 ℃.

M2 culture drop: 100 mu L M drops were prepared in 35mm dishes and covered with mineral oil and the incubator was preheated overnight at 37 ℃.

6.3 Electrotransfection

Vaginal suppositories were checked the next day in the cage and the male rats were retrieved. Killing female mice after cervical spining, dissecting back, exposing uterus, oviduct and ovary, and taking oviduct; removing fat and blood from the paper; tearing the oviduct expansion part in the digestive drip oil, pulling the ovum with the cumulus cells into hyaluronidase, waiting for 1-2 minutes, and shaking the culture dish clockwise for 8-10 times. Picking eggs after digestion into M2 culture drops, washing three times, and adding into M2 culture solution

Is cultured for more than 2 hours and is ready for electric transfection. And 5 mu L of gene editing solution is added into the platinum plate gap of the electrode, meanwhile, fertilized eggs are transferred into the Opti-MEM culture solution for three times of cleaning, and then transferred into the gene editing solution for electrotransfection. After electrotransfection, the fertilized eggs are washed three times by using an M2 culture solution, the fertilized eggs are transferred into M2 culture drops, a 5% CO2 incubator at 37 ℃ is used for overnight culture, the fertilized eggs are cultured to two cells, the cells are transplanted to oviduct of a surrogate female mouse the next day, and the mouse is taken out for rat tail identification after birth.

7MiR-455 gene knockout mouse genotype identification

Collecting the tail of the mice with the length of 0.5cm after 5 days of birth of the F0 generation mice, putting the mice into a sterile centrifuge tube, and performing crude extraction on DNA of the tail after cracking. PCR amplification was performed using rat tail DNA as template and target mononucleotide identification primers, and the amplification systems are shown in tables 4 and 5. The amplified products were identified by 1% agarose gel electrophoresis and sequenced. As shown in FIG. 4, the agarose gel electrophoresis identification result shows that the number 8 mouse has two bands, one size is 541bp, and the other size is 436bp. The F1 generation mouse is obtained by hybridizing the F0 generation 8 mouse with a wild type mouse, and the F1 generation mouse is found to have two bands (figure 5), wherein one band is 724bp in size, the other band is 436bp in size, and the knockout fragment length is 288bp. The result shows that the miR-455 gene knockout mouse model is successfully constructed.

And (3) sending the PCR stock solution containing the target band to a company for sequencing detection, wherein the detection result shows that the miR-455 gene is knocked out.

TABLE 4PCR reaction System

TABLE 5 nested PCR reaction System

Claims

2. The gRNA of claim 1, wherein the nucleotide sequence of the gRNA is set forth in SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3, or SEQ ID No. 4.

3. A method of gene knockout in a mouse, wherein the method comprises:

the mouse miR-455 gene is disrupted by gene editing techniques.

4. The method of claim 3, wherein the gene editing technique is a zinc finger nuclease-based gene editing technique, a TALEN gene editing technique, or a CRISPR/Cas9 gene editing technique.

5. The method of claim 4, wherein the gene editing technique is a CRISPR/Cas9 gene editing technique.

6. The method of claim 3, wherein the gRNA used to target the mouse miR-455 gene is selected from one or more of a first gRNA shown in SEQ ID No. 1, a second gRNA shown in SEQ ID No. 2, a third gRNA shown in SEQ ID No. 3, and a fourth gRNA shown in SEQ ID No. 4.

7. The method of claim 6, wherein the grnas used to target the mouse miR-455 gene are a first gRNA shown in SEQ ID No. 1 and a third gRNA shown in SEQ ID No. 3, a first gRNA shown in SEQ ID No. 1 and a fourth gRNA shown in SEQ ID No. 4, a second gRNA shown in SEQ ID No. 2 and a third gRNA shown in SEQ ID No. 3, or a second gRNA shown in SEQ ID No. 2 and a fourth gRNA shown in SEQ ID No. 4.

8. The method according to any one of claims 3-7, wherein the method comprises the steps of:

delivering the gene editing fluid into a fertilized ovum of a mouse;

9. The method of claim 8, wherein the gRNA used to target the mouse miR-455 gene is the gRNA of the miR-455 gene that was screened for knockdown efficiency using mouse cells.

10. The method of claim 9, wherein screening for knockout efficiency using mouse cells comprises the steps of:

11. The method of claim 10, wherein the delivery is liposome transfection.

12. The method of claim 10, wherein the mouse cells are B16 cells.

13. The method of claim 8, wherein the preparing a gene editing fluid comprising Cas9 and a gRNA for targeting the mouse miR-455 gene comprises the steps of:

Synthesizing a gRNA mixed solution for targeting the mouse miR-455 gene;

mixing the gRNA cocktail and the Cas9 to obtain a gene editing fluid.

15. The method of claim 13, wherein the molar ratio of Cas9 to gRNA cocktail in the gene editing fluid is (2-3): 2-5.

16. The method of claim 8, wherein the delivery is electrotransfection.

the mouse miR-455 gene is disrupted by gene editing techniques.

18. The method of claim 17, wherein the gene editing technique is a zinc finger nuclease-based gene editing technique, a TALEN gene editing technique, or a CRISPR/Cas9 gene editing technique.

19. The method of claim 18, wherein the gene editing technique is a CRISPR/Cas9 gene editing technique.

20. The method of claim 17, wherein the gRNA used to target the mouse miR-455 gene is selected from one or more of a first gRNA shown in SEQ ID No. 1, a second gRNA shown in SEQ ID No. 2, a third gRNA shown in SEQ ID No. 3, and a fourth gRNA shown in SEQ ID No. 4.

21. The method of claim 20, wherein the grnas used to target the mouse miR-455 gene are a first gRNA shown in SEQ ID No. 1 and a third gRNA shown in SEQ ID No. 3, a first gRNA shown in SEQ ID No. 1 and a fourth gRNA shown in SEQ ID No. 4, a second gRNA shown in SEQ ID No. 2 and a third gRNA shown in SEQ ID No. 3, or a second gRNA shown in SEQ ID No. 2 and a fourth gRNA shown in SEQ ID No. 4.

delivering the gene editing fluid into a fertilized ovum of a mouse;

23. The method of claim 22, wherein the gRNA used to target the mouse miR-455 gene is the gRNA of the miR-455 gene that was screened for knockdown efficiency using mouse cells.

24. The method of claim 23, wherein screening for knockout efficiency using mouse cells comprises the steps of:

25. The method of claim 24, wherein the delivery is liposome transfection.

26. The method of claim 24, wherein the mouse cell is a B16 cell.

Synthesizing a gRNA mixed solution for targeting the mouse miR-455 gene;

mixing the gRNA cocktail and the Cas9 to obtain a gene editing fluid.

29. The method of claim 27, wherein the molar ratio of Cas9 to gRNA cocktail in the gene editing fluid is (2-3): 2-5.

30. The method of claim 22, wherein the delivery is electrotransfection.