CN118127175A - SNP molecular marker related to No. 16 intron region in pig semen quality trait gene ITGA9, primer pair and application thereof - Google Patents
SNP molecular marker related to No. 16 intron region in pig semen quality trait gene ITGA9, primer pair and application thereof Download PDFInfo
- Publication number
- CN118127175A CN118127175A CN202410282778.XA CN202410282778A CN118127175A CN 118127175 A CN118127175 A CN 118127175A CN 202410282778 A CN202410282778 A CN 202410282778A CN 118127175 A CN118127175 A CN 118127175A
- Authority
- CN
- China
- Prior art keywords
- pig
- molecular marker
- itga9
- semen
- sperm
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 210000000582 semen Anatomy 0.000 title claims abstract description 44
- 239000003147 molecular marker Substances 0.000 title claims abstract description 28
- 101001035232 Homo sapiens Integrin alpha-9 Proteins 0.000 title claims abstract description 8
- 101100341501 Homo sapiens ITGA9 gene Proteins 0.000 claims abstract description 22
- 238000009395 breeding Methods 0.000 claims abstract description 20
- 230000001488 breeding effect Effects 0.000 claims abstract description 19
- 241000282887 Suidae Species 0.000 claims abstract description 16
- 238000012216 screening Methods 0.000 claims abstract description 16
- 238000000034 method Methods 0.000 claims abstract description 13
- 239000002773 nucleotide Substances 0.000 claims abstract description 10
- 125000003729 nucleotide group Chemical group 0.000 claims abstract description 10
- 230000019100 sperm motility Effects 0.000 claims abstract description 8
- 230000036244 malformation Effects 0.000 claims abstract description 4
- 230000035772 mutation Effects 0.000 claims abstract description 4
- 108700028369 Alleles Proteins 0.000 claims description 12
- 238000011144 upstream manufacturing Methods 0.000 claims description 7
- 238000012163 sequencing technique Methods 0.000 claims description 6
- 238000012408 PCR amplification Methods 0.000 claims description 4
- 238000004458 analytical method Methods 0.000 claims description 3
- 238000000137 annealing Methods 0.000 claims description 3
- 238000006243 chemical reaction Methods 0.000 claims description 3
- 238000004925 denaturation Methods 0.000 claims description 3
- 230000036425 denaturation Effects 0.000 claims description 3
- 238000012257 pre-denaturation Methods 0.000 claims description 3
- 239000012154 double-distilled water Substances 0.000 claims description 2
- 241000282898 Sus scrofa Species 0.000 claims 10
- 239000003550 marker Substances 0.000 abstract description 6
- 231100000527 sperm abnormality Toxicity 0.000 abstract description 3
- 108020004414 DNA Proteins 0.000 description 15
- 238000001514 detection method Methods 0.000 description 11
- 230000000694 effects Effects 0.000 description 8
- 241000255969 Pieris brassicae Species 0.000 description 7
- 239000012634 fragment Substances 0.000 description 7
- 230000002068 genetic effect Effects 0.000 description 6
- 230000000996 additive effect Effects 0.000 description 5
- 239000000047 product Substances 0.000 description 5
- 230000007730 Akt signaling Effects 0.000 description 4
- 108091008611 Protein Kinase B Proteins 0.000 description 4
- 102000038030 PI3Ks Human genes 0.000 description 3
- 108091007960 PI3Ks Proteins 0.000 description 3
- 102100033810 RAC-alpha serine/threonine-protein kinase Human genes 0.000 description 3
- 230000008901 benefit Effects 0.000 description 3
- 238000010219 correlation analysis Methods 0.000 description 3
- 239000000203 mixture Substances 0.000 description 3
- 230000035755 proliferation Effects 0.000 description 3
- 102000007000 Tenascin Human genes 0.000 description 2
- 108010008125 Tenascin Proteins 0.000 description 2
- 238000000246 agarose gel electrophoresis Methods 0.000 description 2
- 230000006907 apoptotic process Effects 0.000 description 2
- 210000004027 cell Anatomy 0.000 description 2
- 230000004069 differentiation Effects 0.000 description 2
- 238000004519 manufacturing process Methods 0.000 description 2
- 238000013508 migration Methods 0.000 description 2
- 230000026731 phosphorylation Effects 0.000 description 2
- 238000006366 phosphorylation reaction Methods 0.000 description 2
- 230000008569 process Effects 0.000 description 2
- 230000001105 regulatory effect Effects 0.000 description 2
- 230000021595 spermatogenesis Effects 0.000 description 2
- 210000000130 stem cell Anatomy 0.000 description 2
- 102100021975 CREB-binding protein Human genes 0.000 description 1
- 238000007400 DNA extraction Methods 0.000 description 1
- 102000034615 Glial cell line-derived neurotrophic factor Human genes 0.000 description 1
- 108091010837 Glial cell line-derived neurotrophic factor Proteins 0.000 description 1
- 101000896987 Homo sapiens CREB-binding protein Proteins 0.000 description 1
- 101000855516 Homo sapiens Cyclic AMP-responsive element-binding protein 1 Proteins 0.000 description 1
- 101001056180 Homo sapiens Induced myeloid leukemia cell differentiation protein Mcl-1 Proteins 0.000 description 1
- 102100026539 Induced myeloid leukemia cell differentiation protein Mcl-1 Human genes 0.000 description 1
- 241001465754 Metazoa Species 0.000 description 1
- 108090000430 Phosphatidylinositol 3-kinases Proteins 0.000 description 1
- 102000005765 Proto-Oncogene Proteins c-akt Human genes 0.000 description 1
- 208000021945 Tendon injury Diseases 0.000 description 1
- 102100029469 WD repeat and HMG-box DNA-binding protein 1 Human genes 0.000 description 1
- 101710097421 WD repeat and HMG-box DNA-binding protein 1 Proteins 0.000 description 1
- 230000003213 activating effect Effects 0.000 description 1
- 238000000540 analysis of variance Methods 0.000 description 1
- 230000033115 angiogenesis Effects 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 230000008827 biological function Effects 0.000 description 1
- 230000031018 biological processes and functions Effects 0.000 description 1
- 230000033228 biological regulation Effects 0.000 description 1
- 230000022131 cell cycle Effects 0.000 description 1
- 230000012292 cell migration Effects 0.000 description 1
- 230000004663 cell proliferation Effects 0.000 description 1
- 230000001276 controlling effect Effects 0.000 description 1
- 230000007547 defect Effects 0.000 description 1
- 238000010586 diagram Methods 0.000 description 1
- 238000000605 extraction Methods 0.000 description 1
- 239000000499 gel Substances 0.000 description 1
- 238000003208 gene overexpression Methods 0.000 description 1
- 230000004110 gluconeogenesis Effects 0.000 description 1
- 108010068609 integrin alpha 9 beta 1 Proteins 0.000 description 1
- 230000007102 metabolic function Effects 0.000 description 1
- 230000005012 migration Effects 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000007935 neutral effect Effects 0.000 description 1
- 235000015277 pork Nutrition 0.000 description 1
- 230000001737 promoting effect Effects 0.000 description 1
- 238000001243 protein synthesis Methods 0.000 description 1
- 108090000623 proteins and genes Proteins 0.000 description 1
- 238000000746 purification Methods 0.000 description 1
- 239000012264 purified product Substances 0.000 description 1
- 230000008929 regeneration Effects 0.000 description 1
- 238000011069 regeneration method Methods 0.000 description 1
- 238000011160 research Methods 0.000 description 1
- 230000019491 signal transduction Effects 0.000 description 1
- 230000000920 spermatogeneic effect Effects 0.000 description 1
- 238000007619 statistical method Methods 0.000 description 1
- 210000002435 tendon Anatomy 0.000 description 1
- 238000012360 testing method Methods 0.000 description 1
- 230000014616 translation Effects 0.000 description 1
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a SNP molecular marker and a primer pair related to a 16 th intron region in a pig semen quality trait gene ITGA9 and application thereof, and relates to the technical field of pig molecular markers. The semen quality character is an effective sperm density, sperm motility and sperm malformation rate character; the molecular marker is positioned in a partial sequence of the 16 th intron region of the pig ITGA9 gene, the length of the nucleotide sequence is 978bp, as shown in a sequence table SEQ ID NO.1, and a C > T base mutation exists at the 406 th bp of the sequence. The invention also provides a primer pair for amplifying the molecular marker and a method for breeding by using the molecular marker. The invention firstly discovers that one SNP molecular marker in the 16 th intron region of the pig ITGA9 gene is related to the effective sperm density and sperm motility sperm abnormality of pigs, so that the method can be used for pig marker assisted selection breeding, and realizes early screening of the quality characters of the pig semen, and the screening method is simple and quick.
Description
Technical Field
The invention relates to the technical field of pig molecular markers, in particular to a SNP molecular marker related to the 16 th intron region in a pig semen quality trait gene ITGA9, a primer pair and application thereof.
Background
China is a large pig production country, and is the first world in both the pig breeding scale and the pork consumption. Semen quality characteristics are important characteristics of the live pig industry, and the quality of semen directly influences the production and economic benefits of pig farms. The boar semen quality character is a medium-low genetic character, and the effect of improving the semen quality character by the traditional breeding method is not obvious. Therefore, the key molecular genetic markers for controlling the quality traits of the pig semen are searched, and the key molecular genetic markers are used for molecular marker assisted breeding, so that the method has important significance for improving the quality traits of the pig semen and increasing the economic benefit.
The phosphatidylinositol 3 kinase/protein kinase B (PI 3K/AKT) signaling pathway is capable of modulating various metabolic functions such as gluconeogenesis, protein synthesis, cell cycle, migration, and apoptosis. It has been found that PI3K/AKT signaling pathways are involved in many developmental stages of male reproduction and can regulate processes such as spermatogenesis and proliferation and differentiation of spermatogenic cells. The MCL1, CREBBP and CREB1 genes can inhibit the apoptosis of sperm cells and improve the sperm motility by regulating PI3K/AKT signal paths. GDNF can regulate proliferation of spermatogonia through the PI3K/AKT signaling pathway. The research results show that the PI3K/AKT signal channel participates in the biological processes of spermatogenesis, proliferation and differentiation of spermatogonial stem cells and the like, and has a certain regulation and control effect on the quality characters of boar semen.
The ITGA9 gene is an important component of integrin alpha 9 beta 1, and can regulate cell proliferation, adhesion, angiogenesis and other biological functions. It has been found that tenascin C (TNC) can target ITGA9 gene over-expression, thereby activating PI3K/AKT signaling pathway phosphorylation, ultimately regulating migration of tendon stem cells and promoting regeneration of tendon injury. The above study suggests that ITGA9 gene may affect the phosphorylation of PI3K/AKT signaling pathway, thereby improving semen quality traits of boars. However, few studies on the quality traits of boar semen are reported at present on the ITGA9 gene. Therefore, it is necessary to study the association of ITGA9 gene with boar semen quality traits.
Disclosure of Invention
The invention aims to overcome the technical defects and provide application of a pig SNP molecular marker in pig semen quality trait screening and pig breeding, and the invention explores that a SNP in an ITGA9 gene No. 16 intron region is associated with pig semen quality trait and can be used as a molecular marker for pig semen quality trait screening and pig breeding.
One of the purposes of the invention is to provide a SNP molecular marker related to the 16 th intron region in the pig semen quality trait gene ITGA9, wherein the semen quality trait is effective sperm density, sperm motility and sperm malformation rate; the molecular marker is positioned in a partial sequence of the 16 th intron region of the pig ITGA9 gene, the length of the nucleotide sequence is 978bp, as shown in a sequence table SEQ ID NO.1, and a C > T base mutation exists at the 406 th bp of the sequence.
Further, the C or T base polymorphism site at 406bp in the sequence SEQ ID NO.1 is represented as three genotypes of CC, CT and TT, wherein the C allele is a dominant allele.
The second object of the invention is to provide the application of the SNP molecular marker in screening of pig semen quality traits and/or pig breeding.
It is a third object of the present invention to provide a primer set for amplifying the above molecular markers, comprising: the nucleotide sequence of the upstream primer is shown as SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 3.
The fourth object of the invention is to provide an application of the primer pair in screening of quality traits of pig semen and/or pig breeding.
The fifth object of the invention is to provide a kit, which comprises the primer pair, wherein the nucleotide sequence of the upstream primer is shown as SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 3.
The invention aims at providing a method for screening quality traits of pig semen and/or selecting and breeding pigs, which comprises the following steps:
s1, extracting genome DNA of a pig;
s2, carrying out PCR amplification by using the genomic DNA obtained in the step S1 as a template and adopting the primer pair to obtain a molecular marker as one of purposes and purifying;
s3, carrying out sequencing analysis on the molecular marker purified in the step S2, reserving individuals carrying C alleles at the 406bp position of the sequence, and eliminating the individuals carrying T alleles.
Further, in step S1, genomic DNA is extracted from the ear border tissue of the pig to be tested.
Further, in step S2, the PCR reaction system is 50. Mu.L, and the components in the system are as follows: 100ng of genomic DNA, 25 mu L of PCR mix, 1 mu L of each of the above upstream and downstream primers, and adding ddH2O to make up to a total volume of 50 mu L; the PCR was run as follows: pre-denaturation at 94℃for 3min; denaturation at 94℃for 30s, annealing at 56℃for 30s, elongation at 72℃for 30s,35 cycles; extending at 72 ℃ for 10min; preserving at 4 ℃.
Compared with the prior art, the invention has the beneficial effects that: the invention firstly discovers that one SNP molecular marker in the 16 th intron region of the pig ITGA9 gene is related to the semen quality character of pigs, in particular to the effective sperm density and sperm motility sperm abnormality, so that the molecular marker can be used for screening the semen quality character and breeding, namely, the invention provides a new application of one SNP molecular marker in the 16 th intron region of the pig ITGA9 gene in the auxiliary breeding of the semen quality character of pigs, realizes the early screening of the semen quality character of pigs, and has simple and quick screening method.
Drawings
FIG. 1 is a diagram showing agarose gel electrophoresis detection of a PCR product in example 1 of the present invention, wherein lane M is DL1000 DNA MARKER, lanes 1-5 are amplified fragments in a large white pig, and the fragment size is 978bp;
FIG. 2 is a sequencing map of g.22437684C > T site in example 1 of the present invention.
Detailed Description
The present invention will be described in further detail with reference to the drawings and examples, in order to make the objects, technical solutions and advantages of the present invention more apparent. It should be understood that the specific embodiments described herein are for purposes of illustration only and are not intended to limit the scope of the invention.
Example 1 acquisition of pig ITGA9 Gene SNP detection fragment and establishment of method for detecting polymorphic site
1. Extraction of pig genomic DNA
Pig genomic DNA was extracted using an animal tissue genomic DNA extraction kit (PureLink TM Pro 96Genomic DNA PurificTtion Kit,K182104T) manufactured by Invitrogen company, and pig genomic DNA was extracted according to the kit instructions. And (3) detecting the concentration and quality of the extracted DNA, and storing at-20 ℃ for standby.
2. Acquisition of pig ITGA9 gene SNP genetic marker detection fragment
(1) PCR amplification
A pair of primers is designed according to SNP genetic marker detection sequences (shown as SEQ ID NO. 1) in genome sequences of pig ITGA9 genes, and fragments of polymorphic sites are amplified.
Wherein, the nucleotide sequence of the SNP genetic marker detection sequence is as follows:
ATCAGGGTTGCGTACCACAGTGTCTGCCCTTACTGGGTATGTGGAATGTTTGCCATTTCTTCCCTCCACGTCTGTGCTGCACCATCATTCTCCCTGCTTTGTGCCCCTGGAGGCCCACCTTCCTTCTGGCTTTCTGTTTGGTTCAGTCTGAAGGGAGCCCAAGGAAAAGGTGGTGGAAGTGTGACTACCTACAGGACGGTATGACCATGACCATGACCCCCTGTAGAAAGCCATAGCTTTTGCCAGGTGGCTAGTTCTGGTAACCTCAGGGTTCTAGTAACCTTCAGACCTAAGGGTTCAAGAGCTCCTCTTGTTGCTAGCTGTCATATACGTTATCCCGGGAGGCGGAGGCAGGGGGCTTCTTTTAAACCTGCCCCTTCTCTTGTCAGTAGTCCCTTCACTGAACGCATTCTTCCTGTTTGTTCCTGGCCAGGACCCTCATGGATACATTAGGTGCTCAATAAGAGCATGATTGCGTATCATCCTTATTTTTCCTCCCTTCTGGCCTTTACACTGGCCACTTCCTCTACTTGAAAACCTCATGGGATTTCAGATGAGGAGCCCTCCCTCTCTCCCTATTAGTTGTCCAATCAGGGTTCATTGCTTCTCACAAGAACCTGGCAGTGTAGGAGTTCCTATTTTGGCGCAGCAGAACAAATCCGACTAGGAACCATGAAGTTGCAGGTTCGATCCCTGGCCTTGCTCAGTGGGTTAAAGATCTGGCGTTGCCATGAGCTATAGTGTAGGTCGCAGATGTGGCTCGGATCCTGTGTTGCTGGTGGCTGTGGTGTAGGCTGGCTGCTGTAGCTCCGATTGGACCCCTAGCCTGGGAACCTCCATATGCCACGAATGTGGCCCTAAAAAGTGGAAAAAACAAAACAAAACAAAACAACACCTGGCAGTGTAAATTCATCAGAGAGAATCCAGGTAGAGAAGATCTTACTTTTTTCTCTGAGTTTTTTGACACGCCCTTTGGGA, As shown in SEQ ID NO. 1.
The primers were as follows:
An upstream primer: 5'ATCAGGGTTGCGTACCACAG 3' as shown in SEQ ID NO. 2.
A downstream primer: 5'TCCCAAAGGGCGTGTCAAAA 3' as shown in SEQ ID NO. 3.
Extracting pig genome DNA from the ear edge tissues of pigs to be detected by using the primers, and carrying out PCR amplification by taking the large white pig genome DNA as a template, wherein the PCR reaction system comprises 50 mu L, and the components in the system are as follows: 100ng of genomic DNA, 25. Mu.L of PCR mix, 1. Mu.L of each of the above-mentioned upstream and downstream primers, and a total volume of 50. Mu.L by adding ddH 2O.
The PCR was run as follows: pre-denaturation at 94℃for 3min; denaturation at 94℃for 30s, annealing at 56℃for 30s, elongation at 72℃for 30s,35 cycles; extending at 72 ℃ for 10min; preserving at 4 ℃. The PCR products were detected by 1.5% agarose gel electrophoresis, the detection result is shown in FIG. 1, wherein lane M is DL1000 DNA MARKER, lanes 1-5 are amplified fragments in big white pigs, and the amplified fragments have a size of 978bp.
(2) PCR product purification
The PCR amplified product was purified by Gel ExtrTction Kit kit from Shanghai Biotechnology Co., ltd, and specific steps are shown in the kit instruction.
3. Detection of molecular markers by direct sequencing of PCR products
The PCR purified product obtained above is directly sent to Beijing Oreg company for sequencing, and the genotype of the site in the detection population is judged according to the sequencing result. Analysis using DNA StTr software, as shown in FIG. 2, found that there was a C > T allele mutation at position 406bp in the sequence, i.e., g.22437684C > T, which caused polymorphism in the ITGA9 gene.
EXAMPLE 2 detection of polymorphism distribution of molecular markers in white pigs
In this example, polymorphism distribution rules of g.22437684C > T locus of ITGA9 gene of pig were detected in 171 large white pigs with semen quality traits, and the detection results are shown in Table 1.
TABLE 1 polymorphism distribution law of ITGA9 gene g.22437684C > T site
From the results in Table 1, it can be seen that: the ITGA9 gene g.22437684C > T locus in large white pigs is represented by three genotypes of CC, CT and TT, wherein the CC genotypes have more individuals and the C allele frequency is 80.1 percent.
Example 3 correlation analysis of molecular markers and boar semen quality traits
In order to determine whether the pig ITGA9 gene g.22437684C > T locus is related to the quality character difference of pig semen, polymorphism detection is carried out by adopting the method established in the embodiment 1, and the correlation of different genotypes of the polymorphic locus with the effective sperm density and sperm motility sperm abnormality rate characters of pigs is analyzed. Analysis of variance of different SNP genotype combinations was performed using the STS statistical software (STS Institute Inc, version 9.1) GLM program and significance test, using the model:
Yij＝μ+Gi+Fj+Dk+eijk；
yij is a trait phenotype value, mu is an average value, gi is a genotype effect (including a gene additive effect and a dominant effect; additive effect applications 1,0 and-1 represent CC, CT and TT genotypes respectively, dominant effect applications 1, -1 and 1 represent CC, CT and TT genotypes respectively); fj is the pig farm comprehensive effect; dk is the effect of the matched boar; eijk is the residual effect.
Correlation analysis between different genotypes and semen quality traits was performed in large white pigs, and the statistical analysis results are shown in table 2:
TABLE 2 correlation analysis of ITGA9 Gene g22437684C > T locus and quality traits of porcine semen
Note that: the composition of the table neutral mean is mean ± standard deviation, a and B represent significant differences (P < 0.05), represent very significant differences (P < 0.01)
As can be seen from table 2, in large white pigs, the effective sperm density and sperm motility were significantly higher in individuals with CC genotypes at the g.22437684c > T locus than in individuals with CT and TT genotypes (P < 0.05), the sperm malformation rate was significantly higher in individuals with TT genotypes than in individuals with CC and CT genotypes (P < 0.05), and the additive effects reached significant levels (P < 0.05). The semen volume was significantly higher for individuals with the TT genotype than for individuals with the CC and CT genotypes (P < 0.05), but the additive effect did not reach significant levels (P > 0.05).
Example 4 application of SNP molecular markers related to No. 16 intron region in ITGA9 Gene in screening of quality traits of porcine semen and/or pig breeding
The SNP molecular marker g.224684C > T site on the 16 th intron region in the ITGA9 gene is obviously related to the quality character of the pig semen, and the additive effect of the C allele reaches a remarkable level. Therefore, in the process of breeding large white pigs, CC type individuals with good semen quality performance can be selected in an assisted manner through the SNP molecular marker, and individuals carrying the dominant allele should be reserved in breeding, so that the productivity of the population is improved.
The above-described embodiments of the present invention do not limit the scope of the present invention. Any other corresponding changes and modifications made in accordance with the technical idea of the present invention shall be included in the scope of the claims of the present invention.
Claims (9)
1. A SNP molecular marker associated with intron 16 in the porcine semen quality trait gene ITGA9, characterized in that the semen quality trait is an effective sperm density, sperm motility, sperm malformation rate trait; the molecular marker is positioned in a partial sequence of the 16 th intron region of the pig ITGA9 gene, the length of the nucleotide sequence is 978bp, as shown in a sequence table SEQ ID NO.1, and a C > T base mutation exists at the 406 th bp of the sequence.
2. The SNP molecular marker associated with the 16 th intron region in the swine semen quality trait gene ITGA9 according to claim 1, wherein the C or T base polymorphism site at 406bp in the sequence SEQ ID NO.1 is represented as three genotypes of CC, CT and TT, wherein the C allele is a dominant allele.
3. Use of the SNP molecular marker of any one of claims 1 or 2 in screening of swine sperm quality traits and/or swine breeding.
4. A primer pair for amplifying the molecular marker of claim 1, wherein the primer pair comprises: the nucleotide sequence of the upstream primer is shown as SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 3.
5. The use of the primer pair according to claim 4 in screening of quality traits of porcine semen and/or in breeding of pigs.
6. A kit comprising the primer pair of claim 3.
7. The method for screening the quality traits of the pig semen and/or selecting and breeding the pig is characterized by comprising the following steps of:
s1, extracting genome DNA of a pig;
S2, carrying out PCR amplification by using the genomic DNA obtained in the step S1 as a template and adopting the primer pair as claimed in claim 3 to obtain the molecular marker as claimed in claim 1 and purifying;
s3, carrying out sequencing analysis on the molecular marker purified in the step S2, reserving individuals carrying C alleles at the 406bp position of the sequence, and eliminating the individuals carrying T alleles.
8. The method for screening and/or breeding pig semen quality traits according to claim 7, wherein in step S1, genomic DNA is extracted from the ear margin tissue of the pig to be tested.
9. The method for screening and/or breeding pig semen quality traits according to claim 7, wherein in step S2, the PCR reaction system is 50 μl, and the components in the system are: 100ng of genomic DNA, 25 mu L of PCR mix, 1 mu L of each of the above upstream and downstream primers, and adding ddH2O to make up to a total volume of 50 mu L;
The PCR was run as follows: pre-denaturation at 94℃for 3min; denaturation at 94℃for 30s, annealing at 56℃for 30s, elongation at 72℃for 30s,35 cycles; extending at 72 ℃ for 10min; preserving at 4 ℃.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202410282778.XA CN118127175A (en) | 2024-03-13 | 2024-03-13 | SNP molecular marker related to No. 16 intron region in pig semen quality trait gene ITGA9, primer pair and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202410282778.XA CN118127175A (en) | 2024-03-13 | 2024-03-13 | SNP molecular marker related to No. 16 intron region in pig semen quality trait gene ITGA9, primer pair and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN118127175A true CN118127175A (en) | 2024-06-04 |
Family
ID=91246748
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202410282778.XA Pending CN118127175A (en) | 2024-03-13 | 2024-03-13 | SNP molecular marker related to No. 16 intron region in pig semen quality trait gene ITGA9, primer pair and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN118127175A (en) |
-
2024
- 2024-03-13 CN CN202410282778.XA patent/CN118127175A/en active Pending
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101629209B (en) | Method for detecting cattle Six6 gene single nucleotide polymorphism | |
| AU2020104202A4 (en) | Application of a molecular marker assisted selection in number of piglets born alive | |
| CN109837347B (en) | SNP of third exon of CATPER 4 gene as genetic marker of boar semen quality character | |
| CN111996264B (en) | Application of pig SNP molecular marker in pig breeding character screening and pig breeding | |
| Sharma et al. | Polymorphism of BMP4 gene in Indian goat breeds differing in prolificacy | |
| AU2020104123A4 (en) | An SNP Molecular Marker for Screening and/or Detecting Bovine Cell Viability | |
| CN112251518A (en) | Molecular marker related to lambing number and growth traits in goat RSAD2 gene and application thereof | |
| CN114369669B (en) | Molecular marker related to pork quality traits and application thereof | |
| CN115820879B (en) | Molecular marker related to intramuscular fat traits of pigs in pig AOPEP gene and application thereof | |
| CN116083598B (en) | SNP molecular marker related to intramuscular fat traits of pigs and application thereof | |
| CN116397033A (en) | SNP molecular marker related to porcine reproductive trait gene NCK1, primer pair and application thereof | |
| CN115927667B (en) | Molecular marker and primer related to intramuscular fat traits of pigs and application of molecular marker and primer | |
| CN107513579B (en) | Method for rapidly detecting single nucleotide polymorphism of cattle CRABP2 gene and special kit thereof | |
| CN114196765B (en) | Application of single nucleotide polymorphism markers of SLC7A5 gene of milk goat in early selection of milk production traits | |
| CN118127175A (en) | SNP molecular marker related to No. 16 intron region in pig semen quality trait gene ITGA9, primer pair and application thereof | |
| CN115323061A (en) | Pig intramuscular fat content character related ADIG gene haplotype variation genetic marker and application | |
| CN116024354A (en) | SNP molecular marker related to cattle growth traits, detection primer, kit and breeding method | |
| CN118127177A (en) | SNP molecular marker related to 5' UTR region in pig semen quality trait gene ITGA9, primer pair and application thereof | |
| CN118086526A (en) | SNP molecular marker related to porcine semen quality trait gene EFNA3, primer pair and application thereof | |
| CN114574593B (en) | Application of pig SNP molecular marker in pig nipple number character screening and pig breeding | |
| CN116162714B (en) | Haplotype molecular marker related to intramuscular fat traits of pigs in SYK gene and application | |
| CN107574234B (en) | Method for detecting single nucleotide polymorphism of cattle ACVR1 gene and application thereof | |
| CN112126688B (en) | Multiple allele molecular marker related to reproductive traits in pig OLR1 gene and application | |
| CN117051128B (en) | NARS2 gene molecular marker related to pork quality traits and application thereof | |
| CN110373480B (en) | Molecular marker related to quality traits of boar semen in eighth intron of pig SPATA6 gene and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination |