CN114574593B - Application of pig SNP molecular marker in pig nipple number character screening and pig breeding - Google Patents
Application of pig SNP molecular marker in pig nipple number character screening and pig breeding Download PDFInfo
- Publication number
- CN114574593B CN114574593B CN202210087229.8A CN202210087229A CN114574593B CN 114574593 B CN114574593 B CN 114574593B CN 202210087229 A CN202210087229 A CN 202210087229A CN 114574593 B CN114574593 B CN 114574593B
- Authority
- CN
- China
- Prior art keywords
- pig
- nipple
- molecular marker
- breeding
- screening
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention discloses application of a pig SNP molecular marker in pig nipple number character screening and pig breeding, wherein the nipple number characters are left nipple number character, right nipple number character and total nipple number character; the nucleotide sequence of the molecular marker is shown as a sequence table SEQ ID NO.1, and a C > T base mutation exists at 356bp of the sequence. The invention also provides a primer pair for amplifying the molecular marker and a method for breeding by using the molecular marker. The invention discovers that one SNP molecular marker in the pig ENSSSCG00000002825 gene is related to the left nipple number character, the right nipple number character and the total nipple number character of the pig for the first time, so that the invention can be used for pig marker assisted selection breeding, namely provides a new application of one SNP molecular marker in the pig ENSSSCG00000002825 gene in marker assisted breeding of the pig nipple number character, and realizes early screening of the pig nipple number character, and the screening method is simple and quick.
Description
Technical Field
The invention relates to the technical field of pig molecular markers, in particular to application of a pig SNP molecular marker in screening of nipple number traits of pigs and pig breeding.
Background
The reproductive trait of pigs is an important trait of breeding pigs and is an important component for measuring economic benefit of pig farms. With the continuous improvement of litter size, the nipple size is of increasing importance in relation to lactation. The number of the emulsion heads is a discrete countable character, and is regulated and controlled by multiple genes, so that the major genes are not clear at present. Therefore, the key molecular genetic markers for controlling the nipple number traits of pigs are searched, and the key molecular genetic markers are used for molecular marker assisted breeding, so that the method has important significance for improving the nipple number traits of pigs and increasing economic benefits.
Molecular markers for MAS include protein markers, microsatellite markers, single nucleotide polymorphism (single nucleotide polymorphism, SNP) markers, and the like. SNP markers refer to DNA sequence polymorphisms caused by genomic single nucleotide variation, including base transitions, transversions, single base insertions or deletions, etc., and are recognized as the latest third generation DNA molecular markers.
The ENSSSCG00000002825 gene (Carboxylesterase 1) encodes an important Carboxylesterase enzyme involved in the hydrolysis or transesterification of a large number of exogenous materials and endogenous substrates having ester, thioester or amide linkages. A large number of researches show that the gene is related to ester metabolism and drug metabolism process in human body and can play a role in blood brain barrier; however, no report has been made on the influence of the gene on nipple number traits.
Disclosure of Invention
The invention aims to overcome the technical defects and provide application of a pig SNP molecular marker in pig nipple trait screening and pig breeding, and the invention discovers that a SNP in a second intron of an ENSSSCG00000002825 gene is associated with the pig nipple trait and can be used as a molecular marker for pig nipple trait screening and pig breeding.
One of the purposes of the invention is to provide an application of a pig SNP molecular marker in screening of pig nipple number characters and/or pig breeding, wherein the nipple number characters are left nipple number characters, right nipple number characters and total nipple number; the nucleotide sequence of the molecular marker is shown as a sequence table SEQ ID NO.1, and a C > T base mutation exists at 356bp of the sequence. The molecular marker is positioned in a partial sequence of a second intron of the pig ENSSSCG00000002825 gene, and the length of the sequence is 417bp.
Further, the C or T base polymorphism site at 356bp in sequence SEQ ID NO.1 is represented as CC, TC or TT genotypes, wherein the T allele has higher additive effect.
Another object of the present invention is to provide a primer set for amplifying the above molecular markers, comprising: the nucleotide sequence of the upstream primer is shown as SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 3.
The invention also aims to provide an application of the primer pair in screening of swine nipple number traits and/or swine breeding.
The fourth object of the invention is to provide a kit, which comprises the primer pair, wherein the nucleotide sequence of the upstream primer is shown as SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 3.
The fifth purpose of the invention is to provide a method for screening nipple number characters of pigs and/or breeding pigs, which comprises the following steps:
s1, extracting genome DNA of a pig;
s2, carrying out PCR amplification by using the genomic DNA obtained in the step S1 as a template and adopting the primer pair as claimed in claim 3 to obtain the molecular marker as claimed in claim 1 and purifying;
s3, carrying out sequencing analysis on the molecular marker purified in the step S2, reserving individuals carrying T alleles at 356bp of the sequence, and eliminating individuals carrying C alleles.
Further, in step S1, genomic DNA is extracted from the ear border tissue of the pig to be tested.
Further, in step S2, the PCR reaction system is 50. Mu.L, and the components in the system are as follows: 100ng of genomic DNA, 25 mu L of PCR mix, 1 mu L of each of the above upstream and downstream primers, and adding ddH2O to make up to a total volume of 50 mu L; the PCR was run as follows: pre-denaturation at 94℃for 3min; denaturation at 94℃for 30s, annealing at 56℃for 30s, elongation at 72℃for 30s,35 cycles; extending at 72 ℃ for 10min; preserving at 4 ℃.
Compared with the prior art, the invention has the beneficial effects that: the invention firstly discovers that one SNP molecular marker in the pig ENSSSCG00000002825 gene is related to the nipple number character of the pig, in particular to the left nipple number, the right nipple number and the total nipple number character, so that the molecular marker can be used for screening the nipple number character of the pig and breeding, namely, the invention provides a new application of one SNP molecular marker in the pig ENSSSCG00000002825 gene in the auxiliary breeding of the pig nipple number character marker, realizes the early screening of the pig nipple number character, and has simple and quick screening method.
Drawings
FIG. 1 is a diagram showing agarose gel electrophoresis detection of a PCR product in example 1 of the present invention, wherein lane M is DL2000 Marker, lanes 1-3 are amplified fragments in a large white pig, and the fragment size is 417bp;
FIG. 2 is a sequencing map of g.29909253C > T site in example 1 of the present invention.
Detailed Description
The present invention will be described in further detail with reference to the drawings and examples, in order to make the objects, technical solutions and advantages of the present invention more apparent. It should be understood that the specific embodiments described herein are for purposes of illustration only and are not intended to limit the scope of the invention.
Example 1 acquisition of pig ENSSSCG00000002825 Gene SNP detection fragment and establishment of method for detecting polymorphic site
1. Extraction of pig genomic DNA
Extraction of porcine genomic DNA an animal tissue genomic DNA extraction kit (PureLink) manufactured by Invitrogen company was used TM Pro 96Genomic DNA Purification Kit,K182104A), and the pig genomic DNA was extracted according to the kit instructions. And (3) detecting the concentration and quality of the extracted DNA, and storing at-20 ℃ for standby.
2. Acquisition of SNP genetic marker detection fragment of pig ENSSSCG00000002825 gene
(1) PCR amplification
A pair of primers is designed according to SNP genetic marker detection sequences (shown as SEQ ID NO. 1) in genome sequences of pig ENSSSCG00000002825 genes, and fragments of polymorphic sites are amplified. The primers were as follows:
an upstream primer: 5'AACACAGCCAATTAACATCC 3'
A downstream primer: 5'TCTACTCGTGAACAGAACAA 3'
By using the primers and taking the genome DNA of the large white pig as a template, carrying out PCR amplification, wherein the PCR reaction system comprises 50 mu L, and the components in the system are as follows: 100ng of genomic DNA, 25. Mu.L of PCR mix, 1. Mu.L of each of the above-mentioned upstream and downstream primers, and a total volume of 50. Mu.L by adding ddH 2O.
The PCR was run as follows: pre-denaturation at 94℃for 3min; denaturation at 94℃for 30s, annealing at 56℃for 30s, elongation at 72℃for 30s,35 cycles; extending at 72 ℃ for 10min; preserving at 4 ℃. The PCR products were detected by 1.5% agarose gel electrophoresis, the detection result is shown in FIG. 1, wherein lane M is DL2000 Marker, lanes 1-3 are amplified fragments in big white pigs, and the amplified fragments have the size of 417bp.
(2) PCR product purification
The PCR amplified product was purified using a Gel Extraction Kit kit from Shanghai Biotechnology Co., ltd, and specific steps are shown in the kit specification.
3. Detection of molecular markers by direct sequencing of PCR products
The PCR purified product obtained above is directly sent to Beijing Oreg company for sequencing, and the genotype of the site in the detection population is judged according to the sequencing result. Analysis using DNAStar software revealed that there was a C > T allele mutation at 356bp in the sequence, i.e., g.29909253C > T, which caused a polymorphism in the ENSSSCG00000002825 gene, as shown in FIG. 2.
EXAMPLE 2 detection of polymorphism distribution of molecular markers in white pigs
In this example, the polymorphism distribution rule of the g.29909253C > T locus of the pig ENSSSCG00000002825 gene was detected in 397 large white pigs, and the detection results are shown in Table 1.
Table 1 ENSSSCG00000002825 Gene g.29909253C > T site polymorphism distribution rule
From the results in Table 1, it can be seen that: the ENSSSCG00000002825 gene g.29909253C > T locus in large white pigs is represented by three genotypes TT, TC and CC, wherein CC genotypes have more individuals and the C allele frequency is 94.1 percent.
Example 3 correlation analysis of molecular markers and porcine Nipple number traits
In order to determine whether the pig ENSSSCG00000002825 gene g.29909253C > T locus is related to the nipple number trait difference of pigs, polymorphism detection is carried out by adopting the method established in the example 1, and the correlation of different genotypes of the polymorphic locus with the nipple number of the left side, the nipple number of the right side and the total nipple number trait of the pigs is analyzed. The variance analysis of the different SNP genotype combinations was performed using SAS statistical software (SAS Institute Inc, version 9.1) GLM program and the significance test was performed using the following models:
Yij＝μ+Gi+Fj+eij；
yij is a trait phenotype value, mu is an average value, gi is a genotype effect (including a gene additive effect and a dominant effect; additive effect applications 1,0 and-1 represent TT, TC and CC genotypes respectively, dominant effect applications 1, -1 and 1 represent TT, TC and CC genotypes respectively); fj is the pig farm comprehensive effect; eij is the residual effect.
Correlation analysis between different genotypes and nipple number traits was performed in large white pigs, and the statistical analysis results are shown in table 2:
table 2 ENSSSCG00000002825 analysis of the correlation of g.29909253C > T locus and swine nipple number trait
Note that: the composition of the table neutral mean is mean ± standard deviation, a and B represent significant differences (P < 0.05), represent very significant differences (P < 0.01)
As can be seen from table 2, in large white pigs, the left, right and total nipple numbers of TT genotype individuals at g.29909253c > T locus were significantly higher than those of TC and CC genotype individuals (P < 0.05), and the additive effect reached an extremely significant level (P < 0.05), so the T allele was the dominant allele.
Example 4 ENSSSCG00000002825 application of Gene SNP molecular markers in screening of swine nipple number traits and/or pig breeding
The SNP molecular marker g.29909253C > T locus on the ENSSSCG00000002825 gene intron is obviously related to the nipple number character of pigs, and the additive effect of T alleles reaches extremely obvious level. Therefore, TT type or TC type individuals with good nipple number characteristics (more nipple numbers) can be selected in an auxiliary way through the SNP molecular markers in the process of breeding large white pigs, and individuals carrying the dominant allele should be reserved in breeding, so that the nipple number characteristics of the groups are improved, and the lactation capacity of the sows is improved.
The above-described embodiments of the present invention do not limit the scope of the present invention. Any other corresponding changes and modifications made in accordance with the technical idea of the present invention shall be included in the scope of the claims of the present invention.
SEQUENCE LISTING
<110> institute of livestock and veterinary at the academy of agricultural sciences of Hubei province
<120> application of porcine SNP molecular marker in screening of porcine nipple number traits and pig breeding
<130> 1
<160> 3
<170> PatentIn version 3.5
<210> 1
<211> 417
<212> DNA
<213> pig (Sus scrofa)
<400> 1
aacacagcca attaacatcc acgaaatgac aaactcccag tttcctccaa aggatttttc 60
tgtataatgg tcccgcccaa attctccttt tctacagaag ggtttacttt cctttgtctt 120
accaaacttg catgtggtgc cccctccagt tgcacgtcca aactgcaagt ctttgctgct 180
cccaatacat ccctgggttt gcctgtaaca tacctggctg ggtgactgtt ctagattgct 240
agagcattac ctctgagtcc cctcgcctgc tctcctttct gttttcgtcc acaggactta 300
ccgtcttcta acacatgaca caatcgattt gttagcctgc gtattgtgta gtaaccctct 360
gcccctgcta cagtgcagct cagagaggct gggaggtttg ttctgttcac gagtaga 417
<210> 2
<211> 20
<212> DNA
<213> artificial sequence
<400> 2
aacacagcca attaacatcc 20
<210> 3
<211> 20
<212> DNA
<213> artificial sequence
<400> 3
tctactcgtg aacagaacaa 20
Claims (6)
1. The application of the porcine SNP molecular marker in screening and/or breeding of porcine nipple number traits is characterized in that the nipple number traits are left nipple number trait, right nipple number trait and total nipple number trait; the nucleotide sequence of the molecular marker is shown as a sequence table SEQ ID NO.1, and a C > T base mutation exists at 356bp of the sequence.
2. The use of a molecular marker of porcine SNP according to claim 1 for screening porcine nipple trait and/or breeding pigs, wherein the C or T base polymorphism site at 356bp in sequence SEQ ID No.1 is represented by three genotypes, CC, TC or TT, wherein the T allele is a dominant allele.
3. Use of a primer pair for amplifying the molecular marker of claim 1 in swine nipple trait screening and/or swine breeding, wherein the primer pair comprises: the nucleotide sequence of the upstream primer is shown as SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 3.
4. A method for screening and/or breeding nipple number traits of pigs, which is characterized by comprising the following steps:
s1, extracting genome DNA of a pig to be detected;
s2, carrying out PCR amplification by using the genomic DNA obtained in the step S1 as a template and adopting the primer pair as set forth in claim 3 to obtain the molecular marker as set forth in claim 1 and purifying;
s3, carrying out sequencing analysis on the molecular marker purified in the step S2, reserving individuals carrying T alleles at 356bp of the sequence, and eliminating individuals carrying C alleles.
5. The method for screening and/or breeding swine nipple trait according to claim 4, wherein in step S1, genomic DNA is extracted from the ear margin tissue of the swine to be tested.
6. The method for screening and/or breeding pigs according to claim 4, wherein in the step S2, the PCR reaction system is 50 μl, and the components in the system are as follows: 100ng of genomic DNA, 25. Mu.L of PCR mix, 1. Mu.L of each of the upstream and downstream primers, and ddH 2 O was made up to a total volume of 50. Mu.L; the PCR was run as follows: pre-denaturation at 94℃for 3min; denaturation at 94℃for 30s, annealing at 56℃for 30s, elongation at 72℃for 30s,35 cycles; extending at 72 ℃ for 10min; preserving at 4 ℃.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210087229.8A CN114574593B (en) | 2022-01-25 | 2022-01-25 | Application of pig SNP molecular marker in pig nipple number character screening and pig breeding |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210087229.8A CN114574593B (en) | 2022-01-25 | 2022-01-25 | Application of pig SNP molecular marker in pig nipple number character screening and pig breeding |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114574593A CN114574593A (en) | 2022-06-03 |
| CN114574593B true CN114574593B (en) | 2023-09-22 |
Family
ID=81769415
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210087229.8A Active CN114574593B (en) | 2022-01-25 | 2022-01-25 | Application of pig SNP molecular marker in pig nipple number character screening and pig breeding |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114574593B (en) |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR101796158B1 (en) * | 2016-08-19 | 2017-11-10 | 경남과학기술대학교 산학협력단 | SNP markers of NAT9 gene for prediction of pigs litter size and methods for selection of fecund pigs using the same |
| CN110484636A (en) * | 2019-09-06 | 2019-11-22 | 华中农业大学 | One kind molecular labeling relevant to the total teat number trait of pig and application |
| CN111996264A (en) * | 2020-09-17 | 2020-11-27 | 湖北省农业科学院畜牧兽医研究所 | Application of pig SNP molecular marker in pig breeding character screening and pig breeding |
| CN112501311A (en) * | 2020-12-18 | 2021-03-16 | 南京农业大学 | SNP (Single nucleotide polymorphism) marker primer pair related to pig nipple number character and application thereof |
| CN112779339A (en) * | 2021-01-29 | 2021-05-11 | 广西扬翔农牧有限责任公司 | SNP molecular marker related to total papilla number of large white pigs as well as acquisition and application thereof |
| CN113817841A (en) * | 2021-09-26 | 2021-12-21 | 南京农业大学 | SNP (Single nucleotide polymorphism) marker primer pair related to pig nipple number character and application thereof |
-
2022
- 2022-01-25 CN CN202210087229.8A patent/CN114574593B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR101796158B1 (en) * | 2016-08-19 | 2017-11-10 | 경남과학기술대학교 산학협력단 | SNP markers of NAT9 gene for prediction of pigs litter size and methods for selection of fecund pigs using the same |
| CN110484636A (en) * | 2019-09-06 | 2019-11-22 | 华中农业大学 | One kind molecular labeling relevant to the total teat number trait of pig and application |
| CN111996264A (en) * | 2020-09-17 | 2020-11-27 | 湖北省农业科学院畜牧兽医研究所 | Application of pig SNP molecular marker in pig breeding character screening and pig breeding |
| CN112501311A (en) * | 2020-12-18 | 2021-03-16 | 南京农业大学 | SNP (Single nucleotide polymorphism) marker primer pair related to pig nipple number character and application thereof |
| CN112779339A (en) * | 2021-01-29 | 2021-05-11 | 广西扬翔农牧有限责任公司 | SNP molecular marker related to total papilla number of large white pigs as well as acquisition and application thereof |
| CN113817841A (en) * | 2021-09-26 | 2021-12-21 | 南京农业大学 | SNP (Single nucleotide polymorphism) marker primer pair related to pig nipple number character and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| 猪数量性状位点的定位和候选基因研究进展;杨敏;殷宗俊;;养猪(第06期);全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114574593A (en) | 2022-06-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111996264B (en) | Application of pig SNP molecular marker in pig breeding character screening and pig breeding | |
| AU2020104202A4 (en) | Application of a molecular marker assisted selection in number of piglets born alive | |
| CN110791574B (en) | Molecular marker associated with goat lambing number and growth traits and application thereof | |
| CN111286541B (en) | Haplotype marker related to lambing number in 3' UTR of goat ZBP1 gene and application thereof | |
| CN112852976B (en) | Molecular marker related to later egg laying characteristics in NCS1 gene of laying hen and application thereof | |
| CN115820879B (en) | Molecular marker related to intramuscular fat traits of pigs in pig AOPEP gene and application thereof | |
| CN116083598B (en) | SNP molecular marker related to intramuscular fat traits of pigs and application thereof | |
| CN113846169A (en) | SNP molecular marker related to pig muscle growth traits and application thereof | |
| CN115927667B (en) | Molecular marker and primer related to intramuscular fat traits of pigs and application of molecular marker and primer | |
| CN114574593B (en) | Application of pig SNP molecular marker in pig nipple number character screening and pig breeding | |
| CN116397033A (en) | SNP molecular marker related to porcine reproductive trait gene NCK1, primer pair and application thereof | |
| CN114369669B (en) | Molecular marker related to pork quality traits and application thereof | |
| CN113265471B (en) | Method for detecting sheep FASN gene single nucleotide polymorphism and application of method in meat quality early screening | |
| CN108841971B (en) | Method for detecting cattle SH3PXD2B gene insertion/deletion marker | |
| CN114350818A (en) | Prolactin gene SNP molecular marker related to egg laying traits of Muscovy ducks and application thereof | |
| CN116162714B (en) | Haplotype molecular marker related to intramuscular fat traits of pigs in SYK gene and application | |
| CN108841969B (en) | Method for detecting cattle MSRB3 gene insertion/deletion marker | |
| CN107574234B (en) | Method for detecting single nucleotide polymorphism of cattle ACVR1 gene and application thereof | |
| CN113046443A (en) | SNP molecular marker influencing pig rib number and application thereof | |
| CN101481740B (en) | Separated nucleic acid sequence of total number of piglets related gene MMP3 | |
| CN112126688B (en) | Multiple allele molecular marker related to reproductive traits in pig OLR1 gene and application | |
| CN117051128B (en) | NARS2 gene molecular marker related to pork quality traits and application thereof | |
| CN114350820B (en) | Molecular marker related to pig carcass traits and application thereof | |
| CN109628611A (en) | It is a kind of influence beef cattle intramuscular fat content ARID5B gene mutation site and its application | |
| CN116287293A (en) | Porcine SNP molecular marker and application thereof in swine litter size trait screening and/or swine breeding |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |