CN118109556A

CN118109556A - Fluorescent quantitative sensor for detecting telomerase activity and application thereof

Info

Publication number: CN118109556A
Application number: CN202410199850.2A
Authority: CN
Inventors: 刘宏星; 王梦婷; 陈文哲
Original assignee: First Affiliated Hospital of Guangzhou Medical University
Current assignee: First Affiliated Hospital of Guangzhou Medical University
Priority date: 2024-02-23
Filing date: 2024-02-23
Publication date: 2024-05-31

Abstract

The invention discloses a fluorescent quantitative sensor for detecting telomerase activity and application thereof, and belongs to the technical field of sensors. The fluorescent quantitative sensor for detecting the telomerase activity comprises a telomerase RPA isothermal amplification system reagent, a CRISPR/Cas12a reagent and a fluorescent probe. The fluorescence quantitative sensor utilizes the trans-shearing enzyme activity of the CRISPR-Cas12a system, and the combination of the fluorescence probe can further simplify the detection process of telomerase activity and improve the detection specificity and sensitivity; the fluorescent quantitative sensor has low detection cost and short time, can establish an accurate linear relation between a detection result and telomerase activity, is beneficial to realizing early and large-scale screening by result visualization, and has the potential of realizing rapid early diagnosis of bladder cancer.

Description

Fluorescent quantitative sensor for detecting telomerase activity and application thereof

Technical Field

The invention belongs to the technical field of sensors, and particularly relates to a fluorescent quantitative sensor for detecting telomerase activity and application thereof.

Background

Bladder cancer (BCa) is the most common urinary malignancy that occurs on the bladder mucosa, along with the tenth most common cancer and the second most common urinary malignancy worldwide. About 50 thousands of new cases and about 200,000 deaths are now occurring each year, with four times the incidence of men than women, severely threatening human health. Diagnosis of bladder cancer can be broadly divided into non-muscle invasive bladder cancer (NMIBC) (about 75% -80%) and Muscle Invasive Bladder Cancer (MIBC) (about 20% -25%). Wherein NMIBC has tumor heterogeneity and a probability of progressing to MIBC of about 0.8-45% and a probability of recurrence of up to 50-78%. In addition, due to the lack of reliable early diagnosis and screening methods and high recurrence rate after initial treatment, most patients need to be monitored by cystoscopy for a long period of time and various therapeutic interventions, which makes BCa one of the most challenging and expensive cancers to diagnose and treat, which will place a great economic burden on patients and even the entire public health system. The greatest desire to reduce BCa mortality and morbidity remains the early discovery and subsequent surgical excision of NMIBC. An accurate early diagnosis is therefore particularly important to correctly and quickly determine NMIBC patients. Existing methods for detecting bladder cancer include urine cytology, cystoscopy and upper urinary tract radiological examination, cystoscopy being the gold standard used to monitor tumor diagnosis, progression and tumor recurrence, but this is an expensive and invasive diagnostic modality. Whereas uroabscisic cytology is a non-invasive, highly specific method that shows good sensitivity to Carcinoma In Situ (CIS) and high grade BCa, but poor sensitivity to low grade tumors. Although several urine biomarkers have been approved by the drug administration (FDA) over the last decades, they are used as an adjunct to commercial testing and are not used in clinical diagnostic guidelines. There is therefore an urgent need to find bladder cancer biomarkers that are more specific, sensitive, while avoiding unnecessary cystoscopy.

Telomerase is a ribonucleoprotein Reverse Transcriptase (RT), a catalytic center of which is composed of telomerase reverse transcriptase (TERT) and RNA component hTR (human telomerase RNA component), responsible for maintaining telomere length and genomic stability by adding a tandem repeat sequence of (TTAGGG) n to the 3' end of the chromosome during reverse transcription with RNA as template. A large number of data indicate that telomerase activity is inhibited in normal human tissue and over-expressed by various mechanisms in more than 85% of cancer cells. The most widely understood and accepted mechanism now is the mutation of the human telomerase reverse transcriptase (hTERT) promoter to overactivate transcription of hTERT and gene amplification of hTR encoding gene TERC, suggesting that telomerase may be one of the most promising biomarkers for early diagnosis of malignancy, evaluation of chemotherapeutic efficacy and screening of new therapeutic compounds. Among them, it has been shown that point mutations in the hTERT promoter are prevalent in 85% of patients with bladder cancer, resulting in increased telomerase activity and telomere length in urothelial cancer cells, which are the most common urothelial cell cancers, and bladder cancer is closely related to expression levels of telomerase. Therefore, telomerase can be used as a bladder cancer biomarker with excellent specificity, and can be used for screening high risk groups of bladder cancer (such as habitual smokers or symptomatic patients) and diagnosing early patients through detecting the activity level of telomerase in urine. There are significant advantages to urine cytology, which are limited to low-grade and/or early stage urothelial cancer, and invasive cystoscopy. There are studies of the detection of telomerase activity levels in urine of patients with bladder cancer by means of a telomerase repeat amplification assay (TRAP): sensitivity was 90% (95% confidence interval [ CI ],83% -94%) and specificity was 88% (95% CI,79% -93%). For individuals 75 years old or less, the specificity increased to 94% (95% ci,85% -98%). The same predictive power of telomerase activity levels was observed for patients with low grade tumors or negative cytologic results. Therefore, the development of a telomerase activity detection mode with high sensitivity, simplicity and high economic benefit has very important clinical significance.

Currently, TRAP based on quantitative PCR is a gold standard for telomerase activity detection due to its high sensitivity and specificity, but this method is often limited by complicated steps, large-scale expensive instruments and reagents, and the like. Thus, various different PCR amplification-free based sensing platforms have been developed. Among these are fluorescence, dipstick, colorimetric, chemiluminescent, surface Enhanced Raman Scattering (SERS), dynamic light scattering, and the like. However, these methods have some drawbacks to a greater or lesser extent, including the problems of complicated synthesis of the nanoprobe, long detection time, low sensitivity, complicated sample pretreatment steps, expensive instrumentation, etc. The transverse flow test paper method can read signals rapidly and accurately, but has complex system, complicated sample/reagent processing steps and slightly reduced sensitivity compared with the quantitative PCR method; the color of the sample itself is susceptible to environmental interference. The fluorescence-based biosensing platform has the advantages of high sensitivity, convenience, quick reading of detection results and the like. Existing telomerase isothermal amplification methods include linear amplification and exponential amplification. The method can effectively realize rapid amplification of telomerase, but has lower sensitivity due to limitation of linear amplification; the exponential amplification is to design a probe to realize exponential amplification of signals after the telomerase is extended, and although the method can obviously improve the sensitivity of telomerase detection, complex probe design is generally required, and the exponential amplification method generally requires participation of multiple enzymes, so that an amplification system is difficult to adapt to the optimal enzyme activity conditions of different enzymes, and the amplification efficiency is insufficient. Therefore, in order to improve the detection sensitivity of telomerase, a constant temperature exponential amplification method of telomerase is required to be developed, so that rapid and sensitive detection of telomerase is realized. The RPA amplification is a method for realizing isothermal exponential amplification by utilizing recombinase, single-chain binding protein and polymerase, and can open double-chain DNA under the action of the recombinase, and prevent the opened double-chain from being combined again by utilizing the single-chain binding protein, and finally realize isothermal exponential amplification by utilizing the polymerase, so that the method has the advantages of simple amplification conditions, high amplification efficiency, simple primer design and the like, and avoids high-temperature deformation and annealing extension. Therefore, we aim to overcome the defect of TRAP amplification, and realize the RPA isothermal index amplification of telomerase by utilizing the advantages of RPA amplification, unlike TRAP, the telomerase RPA amplification is a process of replacing deformation annealing by utilizing recombinase and single-chain binding protein, and finally, extracting telomerase is used for extending TS primers and then amplifying with ACX primers. The method avoids complex probe design, does not introduce excessive enzyme, can effectively realize isothermal exponential amplification of telomerase, and improves sensitivity and simplicity of telomerase detection.

RPA amplification results in double stranded DNA products, the detection of which often requires methods of nucleic acid electrophoresis or sequencing, which are time consuming and require complex manipulations. In recent years, the CRISPR/Cas (Clustered Regularly Interspaced Short Palindromic Repeats-CRISPR associated proteins) system for gene editing has specific cleavage capability of Cas effector protein, and also shows great potential in the development of next generation biosensors, wherein Cas12a is widely used in CRISPR-based biosensing research due to its cis-and trans-cleavage activity. The Cas12a-crRNA gene editing system is combined with the RPA amplification product to form a compound, and a fluorescent probe close to the compound can be sheared by utilizing the trans-shearing activity of the compound, so that quantitative fluorescent shearing can be realized, and the purposes of detecting the RPA amplification product and realizing quantitative and rapid detection of telomerase are achieved.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provide a fluorescent quantitative sensor for detecting telomerase activity and application thereof, and the fluorescent quantitative sensor is introduced into a fluorescent biosensor based on the reverse cleavage activity of CRISPR/Cas12a, and combines with recombinase-assisted amplification (RPA) to construct the fluorescent sensor which is convenient to operate, rapid and accurate in detection and is used for detecting telomerase activity.

In order to achieve the above purpose, the technical scheme adopted by the invention is as follows: a fluorescent quantitative sensor for detecting telomerase activity, comprising a telomerase RPA isothermal amplification system reagent, a CRISPR/Cas12a reagent and a fluorescent probe.

The inventor starts from an improved telomerase activity detection method, adopts a fluorescent sensor which is more convenient to read, rapid and sensitive as a detection platform, rapidly amplifies a substrate of telomerase through an RPA technology, specifically recognizes an amplified product through a CRISPR-Cas12a system, visualizes the detection result and further enhances the sensitivity and the specificity through simplifying the detection method, shortens the detection time and more intuitively represents the detection result. The fluorescence quantitative sensor for detecting telomerase activity, disclosed by the application, has wide application prospect and industrialization prospect when being used for detecting telomerase activity in screening bladder cancer.

As a preferred embodiment of the fluorescent quantitative sensor for detecting telomerase activity according to the present invention, the telomerase RPA isothermal amplification system reagent comprises a telomerase isothermal amplification primer; the telomerase isothermal amplification primer is any one of the following pairs:

WTS-1-F：GCATGCGCTTGAGCATCCGTCACCGAGAGTT(SEQ ID NO:1)

ACX-R：GCGCGGCTTACCCTTACCCTTACCCTAACC(SEQ ID NO:2)

WTS-2-F：GACCAACGCCGTGGCGCACGTGGACAGAGTT(SEQ ID NO:3)

WCX-1-R：AAGCTTGTGCGCGACCCTTACCCTTACCCTA(SEQ ID NO:4)

WTS-3-F：CTCGGGCCTTTCCCCACTCTTGGCAAGAGTT(SEQ ID NO:5)

WCX-2-R：GGGTCCACCCGAAACCCTAACCCTAACCCTA(SEQ ID NO:6)

WTS-4-F：CTCGGGCCTTTCCAATCCGTCGAGCAGAGTT(SEQ ID NO:7)

WCX-3-R：GCCGAAAAGAAATCCCATTCCCATTCCCATC(SEQ ID NO:8)

more preferably, the isothermal amplification method of the telomerase RPA isothermal amplification system reagent is a recombinant polymerase mediated isothermal nucleic acid amplification technology.

As a preferred embodiment of the fluorescent quantitative sensor for detecting telomerase activity according to the invention, the CRISPR/Cas12a reagent comprises a specific crDNA primer, cas12a protein.

As a preferred embodiment of the fluorescent quantitative sensor for detecting telomerase activity according to the present application, the specific crRNA primer includes an upstream primer and a downstream primer; the sequence of the upstream primer is shown as SEQ ID NO. 9; the sequence of the downstream primer is shown as SEQ ID NO. 10. The inventors of the present application designed PCR amplification primers for crRNA in vitro transcription of a desired DNA template through a number of experiments, wherein crDNA-F comprises 25-nt T7 promoter region definite sequence, crDNA-R comprises 22-nt target gene complementary sequence and 46-nt fixed sequence.

As a preferred embodiment of the fluorescent quantitative sensor for detecting telomerase activity according to the present invention, the fluorescent probe is FQ probe containing TTATT sequences; and the 5 'end of the FQ probe is modified with a FAM fluorescent group, and the 3' end of the FQ probe is modified with a BHQ1 fluorescent quenching group.

The invention also provides a method for detecting telomerase activity by adopting the fluorescence quantitative sensor, which comprises the following steps:

s1, extracting total telomerase in a sample;

S2, performing RPA amplification by using telomerase isothermal amplification primers extracted from the S1 to obtain an RPA amplification product;

S3, performing bridge PCR amplification by adopting a specific crRNA primer to obtain crRNA, and incubating the crRNA with the Cas12a protein to obtain a Cas12a-crRNA complex;

s4, incubating the Cas12a-crRNA complex with an RPA amplification product to obtain a Cas12a-crRNA-amplicon complex;

S5, adding the Cas12a-crRNA-amplicon complex, the FQ fluorescent probe and a reaction buffer solution into a pore plate, and observing a fluorescence curve and a fluorescence intensity signal after incubation and shearing at 45 ℃ on a machine.

Preferably, the bridge PCR amplification system in S3 is: 1.4. Mu.L of the upstream primer, 1.4. Mu.L of the downstream primer, 25. Mu.L of 2xTaq DNA polymerase mix and 22.2. Mu.L of diethyl pyrrolidone carbonate (DEPC) water; the bridge PCR amplification conditions in the step S3 are as follows: denaturation at 95℃for 5 min, denaturation at 95℃for 20 sec, annealing at 63℃for 10 sec, extension at 72℃for 45 sec, cycling 35 times, and extension at 72℃for 15 min.

As a preferred embodiment of the method for detecting telomerase activity using the fluorescence quantitative sensor of the present invention, the reaction buffer in step S5 includes the following components in the following concentrations: 63mM KCl, 1.5mM MgCl ₂, 1mM EGTA, 0.05% Tween-20 and 20mM Tris-HCl buffer containing 0.1mg/mL BSA; the pH of the reaction buffer was 8.3.

As a preferred embodiment of the method for detecting telomerase activity using the fluorescence quantitative sensor of the present invention, the concentration ratio of crRNA to Cas12a protein in step S3 is 1:1.

As a preferred embodiment of the method for detecting telomerase activity using the fluorescence quantitative sensor of the present invention, the sample comprises a urine sample.

The invention also provides application of the fluorescence quantitative sensor for detecting telomerase activity in preparation of products for diagnosing bladder cancer.

The invention has the beneficial effects that: the invention provides a fluorescence quantitative sensor for detecting telomerase activity, which has the following advantages: (1) Compared with bladder tumor antigen detection (BTA) screening, the biomarker telomerase selected by the invention shows higher specificity in diagnosis of bladder cancer, and simultaneously, a detected sample can be taken from urine, so that unnecessary puncture biopsy is reduced, and pain of a patient is reduced; (2) Compared with the complex operation and long-time amplification reaction of TRAP based on PCR, the fluorescent quantitative sensor adopts RPA isothermal exponential amplification, has simpler and more convenient operation and shorter amplification reaction time, and can obtain detection results more quickly; (3) The fluorescence quantitative sensor utilizes the trans-shearing enzyme activity of the CRISPR-Cas12a system, and the combination of the fluorescence probe can further simplify the detection process of telomerase activity and improve the detection specificity and sensitivity; (4) The fluorescent quantitative sensor has low detection cost and short time, can establish an accurate linear relation between a detection result and telomerase activity, is beneficial to realizing early and large-batch screening by visualizing the result, and has the potential of realizing rapid early diagnosis; (5) The constructed telomerase RPA isothermal amplification method can be combined with a test strip method, a colorimetric method, an electrochemical method, an electrochemiluminescence and fluorescence detection method and the like to realize point-of-care rapid detection (POCT).

Drawings

FIG. 1 is a schematic diagram of primer pair screening for telomerase amplification by RPA.

Fig. 2: a is a non-denaturing polyacrylamide gel electrophoresis (PAGE) of a product obtained by amplifying a front primer and a rear primer under the action of telomerase activity by using a TRAP method; b is a PAGE diagram of amplified products of the TRAP method by the front primer and the rear primer under the action of different telomerase concentrations.

FIG. 3 is a graph of PCR after TRAP amplification with telomerase activity.

FIG. 4 is a PAGE image of products obtained by amplification of the front and rear primers by RPA under the action of telomerase activity.

Fig. 5: a is a crDNA product electrophoresis chart corresponding to an amplification product obtained under the action of telomerase activity; b is CrRAN product electrophoresis diagram corresponding to amplified product obtained under action of telomerase activity.

FIG. 6 is a schematic diagram of a fluorescent quantitative sensor for detecting telomerase activity.

Fig. 7: a is a fluorescence shear graph of Cas12a-crRNA trans-cleavage activity initiated by TRAP amplification products; b is a fluorescence shear graph of the trans-cleavage activity of Cas12a-crRNA initiated by the amplification product of the RPA method.

FIG. 8 is a graph of specificity of CRISPR-Cas12a-RPA amplification product complex cleavage.

Figure 9 is a Cas12a-crRNA recognition result of RPA amplification products of different concentrations of telomerase.

Detailed Description

For a better description of the objects, technical solutions and advantages of the present invention, the present invention will be further described with reference to the following specific examples.

Reagents and materials used in the following examples are commercially available unless otherwise specified.

The telomerase extraction method of the embodiment of the invention adopts the following steps: the cultured T24,5637 cells were dispersed using pancreatin digestion, and the cells were washed down and collected, and the pancreatin reaction was terminated by adding serum-containing medium. The collected cells were centrifuged at 3500rpm for 5 minutes at 4℃and washed twice with ice-cold PBS buffer (pH 7.4), and then centrifuged at 3500rpm for 5 minutes at 4℃and finally the supernatant was discarded. The precipitated cells were resuspended thoroughly with NP-40 lysate containing protease inhibitors and lysed in an ice bath for 30 minutes at low temperature. And (3) centrifuging the cell lysis mixture for 30 minutes at the temperature of 12000pm at the temperature of 4 ℃, and collecting supernatant to obtain the telomerase extract. Telomerase extracts were dispensed into RNase-free and sterile EP tubes and stored at-80 ℃.

Example 1

The embodiment provides a fluorescence quantitative sensor for detecting telomerase activity, which comprises a telomerase RPA isothermal amplification system reagent, a CRISPR/Cas12a reagent and a fluorescence probe; the telomerase RPA isothermal amplification system reagent comprises a telomerase isothermal amplification primer; the CRISPR/Cas12a reagent comprises a specific crRNA primer, cas12a protein.

1. The telomerase RPA amplification primer pair is designed and screened as follows:

1) The primer has a very great influence on the RPA reaction, and the optimal length of the primer is generally 30-35 bases. Since telomerase amplification products are double-stranded DNA products of fragments of different lengths consisting of six repeated bases, multiple screening of primers is necessary for specific and sensitive amplification purposes. The primer pairs designed in this example are 31 bases in length, and the GC content is set at about 60% to increase the stability of the primer and the target sequence while ensuring that a large number of repeated sequences and the formation of dimers by the interactions between the primers are avoided in the designed primers, the primer sequences being shown in table 1. After amplification of the designed primer pairs using the RPA method, cas12a is activated after crRNA mediated recognition and binding to the target, and is able to non-specifically cleave the ssDNA probe with fluorescent and quenching groups at its surrounding ends indifferently, thereby indicating the presence or absence of the amplification product of interest, wherein each primer pair is provided with a negative and positive control group, which replaces the target with DEPC water, such as WTS1-ACX (-), and the positive control group is a diluted telomerase extract, such as WTS-ACX (+).

As shown in FIG. 1, in the same reaction conditions and reaction system, the WTS1-ACX primer pair can achieve the expected effect of RPA isothermal exponential amplification on telomerase, while the other primer pairs such as WTS2-WCX1, WT3-WCX2, WTS4-WCX3 and the like cannot be acted by telomerase to achieve effective amplification. Therefore, we selected the WTS1-ACX primer pair for further experiments.

TABLE 1

2) The PCR-based TRAP method and the RPA method of the invention are respectively adopted to detect the activity of telomerase, and the two methods comprise two steps of extension reaction of telomerase and amplification reaction of extension product, specifically: TRAP method: amplification is carried out by using a pair of primers synthesized by TAKARA and a manufacturing company, the two steps of extension reaction and quantitative PCR reaction of telomerase are carried out in the same PCR tube, the reaction system is shown in table 2, a PAGE electrophoresis diagram of an amplification product is shown in figure 2A, B, and a PCR amplification curve is shown in figure 3; rpa method: using TAKARA and primers synthesized by Productivity, followed by TwistDx ^TM The RPA kit of (2) simultaneously carries out extension and amplification reaction to realize one-tube detection, the reaction condition is 37 ℃ and 60 minutes, and the reaction system is shown in Table 3. And simultaneously, carrying out PAGE electrophoresis verification on the amplified product, and the result is shown in figure 4.

From the results, the lanes in the negative control group with target replaced with DEPC water are shown as blank, indicating that the negative control group was not amplified effectively; the lanes of the positive control group added with the diluted target show DNA amplification bands with the length ranging from 50 bp to 300bp, which shows that the whole RPA reaction system is efficiently amplified under the condition that the target exists. This suggests that the RPA reaction has excellent specificity for amplification of telomerase.

The extension buffer contained 20mM Tris, 63mM KCl, 1.5mM MgCl ₂, 1mM EGTA, 50mM NaCl, 0.05% Tween-20 and 0.1mg/mL BSA.

TABLE 2 TRAP reaction System

TABLE 3 telomerase extension+RPA amplification System

2. The crRNA primer is designed as follows:

1) Designing PCR amplification primers of a DNA template required by crRNA in vitro transcription, wherein an upstream primer comprises a T7 promoter region and a 21-nt fixed sequence, a downstream primer comprises a complementary sequence of a 19-nt target gene and the 21-nt fixed sequence, and then obtaining crRNA transcription template DNA through bridge PCR amplification. Wherein the primer sequences are shown in table 4, the system of bridge PCR amplification is shown in table 5, and the conditions of bridge PCR amplification are: firstly, denaturation is carried out for 5 minutes at 95 ℃; then denaturation at 95 ℃ for 20 seconds, annealing at 63 ℃ for 10 seconds, extension at 72 ℃ for 45 seconds, and circulation for 35 times; finally, the extension is carried out at 72 ℃ for 15 minutes.

TABLE 4 primers required for crDNA

TABLE 5 bridge PCR amplification System

2) The amplified product is purified by a PCR product purification kit and then is used for T7 RNA polymerase mediated transcription reaction, so that crRNA is transcribed in vitro, and the product is verified by polyacrylamide gel electrophoresis, and the rest crRNA is frozen in a refrigerator at the temperature of minus 80 ℃. The agarose gel electrophoresis results are shown in FIG. 5. FIG. 5A, B shows the corresponding crDNA and crRNA of the amplified products obtained by extension and subsequent amplification, respectively, under the action of telomerase activity. As can be seen from FIG. 5, the amplified products were synthesized successfully with crDNA and crRNA, and the electrophoresis bands were single and bright, which can be used in the next experiment.

Example 2

In this example, the fluorescence sensor of example 1 was used to detect telomerase activity, the detection principle is shown in fig. 6, and the specific method is as follows:

(1) Preparing a Cas12 a-crRNA-target gene complex: cas protein and crRNA from example 1 were first expressed as 1:1 in a reaction buffer solution at room temperature for mixed static incubation for 10 minutes to form a Cas12a-crRNA complex; the Cas12a-crRNA complex was then interacted with the double stranded DNA product amplified using the TRAP method and RPA method in example 1, under reaction conditions of 37 ℃ for 25 minutes; thereby obtaining a Cas12a-crRNA-amplicon complex; the final concentration of Cas12a and crRNA in the final system was 100nM. To verify specific binding of Cas12a-crRNA complex to the gene of interest, telomerase in the telomerase extension+rpa amplification system was replaced with DEPC water and the resulting amplification product was subjected to fluorescent cleavage reaction with Cas12a-crRNA complex under the same reaction conditions. As can be seen from fig. 7A, the Cas12a-crRNA complex specifically binds to only the telomerase positive amplification product, thereby activating the trans-cleavage activity of Cas12a, and shearing FQ-probe, thereby generating fluorescence signal intensity, and realizing quantitative detection of the telomerase activity. This demonstrates that Cas12 a-crrnas of the invention bind to RPA amplification products of telomerase with very high specificity.

(2) The fluorescent probe FAM-Q was mixed with Cas12a-crRNA-amplicon complex and other components for detection, and the reaction system and reaction conditions are shown in Table 6.

TABLE 6CRISPR fluorescence shear reaction System

The TRAP amplification products of Table 2 and the RPA amplification products of Table 3 were added separately to the PCR tubes, and the amplification products of each well were added last and on the tube wall, with a total loading system of 20. Mu. For each well. The last step of the machine is to centrifuge the PCR tube for about 10s, and the aim is to mix the product on the tube wall with the whole reaction system. Immediately thereafter, the reaction conditions for each cycle were 45℃and the reaction time was 1 minute for a total of 50 cycles.

As shown in FIG. 7A, B, in the same fluorescence shearing reaction system and conditions, the fluorescence shearing value of the target amplification product obtained by the TRAP method can be up to about 6000, while the fluorescence shearing value of the target amplification product obtained by the RPA reaction can be up to about 16000. This suggests that the sensitivity of amplification of telomerase by means of the RPA reaction is far higher than that of the conventional TRAP method.

Example 3

This example demonstrates the function of the fluorescence sensor of example 1, using the detection method of example 2 to detect the following 4 samples:

Sample one: DEPC water, r2.1 and crRNA are added into a PCR tube, and after reacting for 5 minutes at room temperature, RPA amplification products are added;

sample two: DEPC water, r2.1 and Cas12a are added into a PCR tube, and after reacting for 5 minutes at room temperature, an RPA amplification product is added;

Sample three: adding DEPC water, r2.1 and Cas12a, crRNA, FQ-Probe into a PCR tube, reacting for 5 minutes at room temperature, and adding the DEPC water to replace telomerase to serve as an RPA amplification product of negative control;

Sample four: DEPC water, r2.1, cas12a and crRNA are added into a PCR tube, and telomerase positive RPA amplification products are added after reaction for 5 minutes at room temperature.

As shown in fig. 8, the fluorescence signal of the fluorescent quantitative sensor of sample one did not change significantly, demonstrating that the generation of the fluorescence signal after the amplification product was bound to crRNA was dependent on the cleavage capacity of Cas12a protein; the current signal of the electrochemical sensor of the sample II is not changed obviously, which proves that the combination of the amplified product and the Cas12a protein depends on the targeting ability of crRNA, thereby activating trans-cleavage activity; the fluorescent signal of the fluorescent sensor of the sample III is not changed obviously, so that the binding of the amplified product and the Cas12a protein is proved to depend on the targeting capability of specific crRNA; the fluorescence signal intensity of the fluorescence sensor of the sample IV has obvious change, and the fact that when a reaction system contains telomerase amplification products, corresponding crRNA and Cas12a protein, the crRNA can be specifically combined with the amplification products to activate the trans-cleavage activity of the Cas12a, so that the FQ-probe fluorescence probe is cleaved, and finally obvious fluorescence signal change is generated. From the above experimental results, it is known that the Cas12a protein, crRNA and target amplification product all play an indispensable role in forming a ternary complex, and crRNA can only specifically bind to the corresponding amplification product. The constructed fluorescent quantitative sensor detection platform can achieve the expected purpose.

Example 4

The minimum detection limit of the fluorescence sensor of the embodiment 1 is verified in the embodiment, and the specific method is as follows: taking the packaged telomerase extract according to the weight ratio of 1: 10. 1: 100. 1: 1000. 1: 10000. 1: after five concentrations of 100000 times of gradient dilution, telomerase self-extension and RPA amplification are combined to realize one-tube detection, and the total reaction system is 100 mu L. The reaction system and reaction conditions are shown in Table 3.

As shown in fig. 9, the Cas12a-crRNA recognition is performed on the RPA amplification products of five telomerase concentrations, and the experimental results can be intuitively observed through the detection of the fluorescent quantitative sensor. Cells were counted to give a cell number of 1.67×10 ⁶ before telomerase extraction of T24 cells, and after lysis with 200ul of NP-40 lysate during extraction, the supernatant was dispensed at a volume of 20 μl per tube. Thus, the lowest detection limit of the constructed RPA-CRISPR-fluorescence quantitative sensing platform at the bladder cancer cell level is 2 cells.

From the above, the telomerase fluorescence quantitative sensor of the invention has a secondary biological signal amplification system, and RPA can rapidly carry out exponential amplification on telomerase extension products in a short time; cas12a-crRNA can non-specifically cleave single-stranded DNA by specific binding to the amplification product activating the trans-cleavage activity of Cas12 a. Thus, in detecting telomerase activity, the fluorescent quantitative sensor detection should exhibit a good linear response range.

Finally, it should be noted that the above embodiments are only for illustrating the technical solution of the present invention and not for limiting the scope of the present invention, and although the present invention has been described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that modifications or equivalent substitutions can be made to the technical solution of the present invention without departing from the spirit and scope of the technical solution of the present invention.

Claims

1. A fluorescent quantitative sensor for detecting telomerase activity, comprising a telomerase RPA isothermal amplification system reagent, a CRISPR/Cas12a reagent, and a fluorescent probe.

2. The fluorescent quantitative sensor for detecting telomerase activity of claim 1, wherein said telomerase RPA isothermal amplification system reagents comprise telomerase isothermal amplification primers; the telomerase isothermal amplification primer is any one of the following pairs:

WTS-1-F：GCATGCGCTTGAGCATCCGTCACCGAGAGTT(SEQ ID NO:1)

ACX-R：GCGCGGCTTACCCTTACCCTTACCCTAACC(SEQ ID NO:2)

WTS-2-F：GACCAACGCCGTGGCGCACGTGGACAGAGTT(SEQ ID NO:3)

WCX-1-R：AAGCTTGTGCGCGACCCTTACCCTTACCCTA(SEQ ID NO:4)

WTS-3-F：CTCGGGCCTTTCCCCACTCTTGGCAAGAGTT(SEQ ID NO:5)

WCX-2-R：GGGTCCACCCGAAACCCTAACCCTAACCCTA(SEQ ID NO:6)

WTS-4-F：CTCGGGCCTTTCCAATCCGTCGAGCAGAGTT(SEQ ID NO:7)

WCX-3-R：GCCGAAAAGAAATCCCATTCCCATTCCCATC(SEQ ID NO:8)。

3. The fluorescent quantitative sensor for detecting telomerase activity of claim 1, wherein the CRISPR/Cas12a reagent comprises a specific crRNA primer, cas12a protein.

4. The fluorescent quantitative sensor for detecting telomerase activity of claim 3, wherein said specific crRNA primers comprise an upstream primer and a downstream primer; the sequence of the upstream primer is shown as SEQ ID NO. 9; the sequence of the downstream primer is shown as SEQ ID NO. 10.

5. The fluorescent quantitative sensor for detecting telomerase activity of claim 1, wherein said fluorescent probe is an FQ probe comprising a TTATT sequence; and the 5 'end of the FQ probe is modified with a FAM fluorescent group, and the 3' end of the FQ probe is modified with a BHQ1 fluorescent quenching group.

6. A method for detecting telomerase activity using the fluorescent quantitative sensor of any of claims 1-5, comprising the steps of:

s1, extracting total telomerase in a sample;

s2, performing RPA amplification by using telomerase isothermal amplification primers extracted from the S1 to obtain a target amplification product;

7. The method for detecting telomerase activity using a fluorescent quantitative sensor as claimed in claim 6, wherein the reaction buffer in step S5 comprises the following components in the following concentrations: 63mM KCl, 1.5mM MgCl ₂, 1mM EGTA, 0.05% Tween-20 and 20mM Tris-HCl buffer containing 0.1mg/mL BSA; the pH of the reaction buffer was 8.3.

8. The method of detecting telomerase activity using a fluorescent quantitative sensor of claim 6, wherein the concentration ratio of crRNA to Cas12a protein in step S3 is 1:1.

9. The method of detecting telomerase activity using a fluorescent quantitative sensor of claim 6, wherein the sample comprises a urine sample.

10. Use of a fluorescent quantitative sensor for detecting telomerase activity as claimed in any of claims 1 to 5 in the manufacture of a product for use in the diagnosis of bladder cancer.