CN118109490A - Terpene synthase gene cluster SaTPS _P450 derived from Solanum parvifolium, and encoding protein and application thereof - Google Patents

Abstract

The invention belongs to the technical field of plant genetic engineering, and particularly relates to a terpene synthase gene cluster SaTPS _P450 derived from Solanum parviflora, and encoding protein and application thereof. The resistance gene sequences shown in SEQ ID NO. 2 and SEQ ID NO. 5 are derived from Solanum cymosum (Solanum americanum); heterologous overexpression of the above sequences increased the levels of SaTPS and SaP450 encoded proteins in the cultivated potato; the potato cultivation after genetic modification has stronger late blight resistance.

Description

Terpene synthase gene cluster SaTPS _P450 derived from Solanum parvifolium, and encoding protein and application thereof

Technical Field

The invention belongs to the technical field of plant genetic engineering, and particularly relates to a terpene synthase gene cluster SaTPS _P450 derived from Solanum cymosum, and a coding protein and application thereof.

Background

Late blight is a destructive agricultural disease which jeopardizes the safe production of potatoes, often resulting in loss of yield and quality of potatoes and great economic loss (Guha Roy,S.,Dey,T.,Cooke,D.E.L.,Cooke,L.R.(2021).The dynamics of Phytophthora infestans populations in the major potato-growing regions of Asia—A review.Plant Pathology,70:1015–1031).

The potato late blight in China frequently happens, the annual average yield loss accounts for more than half of the yield loss caused by all diseases, and the hazard degree is far higher than that of other agricultural diseases (Li Jie, shuo, zhang Fang, li Xiaobo, ren Bin Yuan, hu Tong le, national weeding, dou Daolong, wang Xiaodan.2021. In recent years, the space-time evolution characteristics and prevention and control situation analysis of potato late blight in China. The plant protection school, 48 (4): 703-711). Scientific researchers mostly use closely related disease-resistant germplasm such as wild potatoes and the like as test materials, continuously clone new R genes, introduce the new R genes into cultivars by adopting a traditional hybridization breeding method to realize effective control (Hein,I.,Birch,P.R.J.,Danan,S.,Lefebvre,V.,Achieng Odeny,D.,Gebhardt,C.,Trognitz,F.,Bryan,G.J.(2009).Progress in Mapping and Cloning Qualitative and Quantitative Resistance Against Phytophthora infestans in Potato and Its Wild Relatives.Potato Research,52:215–227). of late blight because resistance mediated by dominant disease-resistant genes R is easy to lose due to pathogenic bacteria mutation, so that novel disease-resistant genes of non-host plants of the late blight are mined and the functions of the novel disease-resistant genes are verified to become a new research direction.

Disclosure of Invention

Aiming at the problems existing in the prior art, the invention provides a terpene synthase gene cluster SaTPS _P450 derived from Solanum parviflora, and a coding protein and application thereof.

In order to achieve the above object, the present invention provides the following technical solutions:

A terpene synthase gene cluster SaTPS _p450 derived from solanum parviflora, comprising the nucleotide sequence of: the genomic nucleotide sequences shown in SEQ ID NO. 1 and SEQ ID NO. 4; or the nucleotide sequences of the coding regions of SEQ ID NO. 1 and SEQ ID NO. 4 shown in SEQ ID NO. 2 and SEQ ID NO. 5; or the nucleotide sequence corresponding to the amino acid sequence codes with the same function, which is formed by artificially engineering the amino acid sequences shown in SEQ ID NO. 3 and SEQ ID NO. 6 or by replacing, deleting or adding one or more amino acids caused by natural nucleic acid polymorphism.

Preferably, the resistance gene sequences shown in SEQ ID NO. 1 and SEQ ID NO. 4 are derived from Solanum cymosum (Solanum americanum).

Preferably, the amino acid sequence comprises the following: amino acid sequences shown in SEQ ID NO. 3 and SEQ ID NO. 6; or the amino acid sequences shown in SEQ ID No. 3 and SEQ ID No. 6 are replaced, deleted or added by one or more amino acids caused by artificial engineering or natural nucleic acid polymorphism to form the amino acid sequence with the same function.

Preferably, the genes shown in SEQ ID No. 2 and SEQ ID No. 5 are heterologously over-expressed in cultivated potatoes, thereby increasing the levels of SaTPS and SaP450 encoded proteins in the potatoes.

Preferably, the heterologous over-expression of the genes shown in SEQ ID NO.2 and SEQ ID NO. 5 is realized by a stable genetic transformation technology of potatoes.

A method of growing potatoes with enhanced late blight resistance by heterologous overexpression of terpene synthase gene cluster SaTPS _p450 comprising the steps of:

s1, extracting RNA of leaves of Solanum cymosum (Solanum americanum), synthesizing a cDNA template, cloning nucleotide sequences of SaTPS and SaP protein coding regions shown in SEQ ID NO. 2 and SEQ ID NO. 5 into a binary plant expression vector pCHF-YFP to obtain a recombinant plasmid pCHF3-SaTPS _P450;

s2, transfecting the recombinant plasmid pCHF3-SaTPS _P450 obtained in the S1 into an escherichia coli strain;

s3, positively screening the strain in the S2, and extracting plasmid DNA thereof;

s4, transfecting the plasmid DNA obtained in the S3 into an agrobacterium strain;

S5, carrying out positive screening on the strain in the S4;

s6, co-culturing the positive plants obtained in the step S5 with potato stem segments;

s7, carrying out resistance screening on the co-cultured differentiated buds in the S6, transferring the screened buds to a rooting culture medium, and transplanting the screened buds to a sunlight greenhouse after root system development and field planting;

s8, detecting the expression level of SaTPS and SaP450 protein coding genes of the positive plants obtained in the S7;

s9, identifying the late blight resistance of the strain with higher over-expression multiple obtained in the S8.

Preferably, the E.coli strain used in S2 is DH 5. Alpha.

Preferably, the agrobacterium strain used in S4 is EHA105 or GV3101.

The beneficial effects of the invention at least comprise:

1) The resistance gene sequences shown in SEQ ID NO. 1 and SEQ ID NO. 4 are derived from Solanum cymosum (Solanum americanum);

2) Heterologous overexpression of the above sequences increased the levels of SaTPS and SaP450 encoded proteins in the cultivated potato;

3) The genetically modified potato leaf has stronger late blight resistance.

The features and advantages of the present invention will be described in detail in the detailed description that follows.

Drawings

FIG. 1 is a schematic diagram of SaTPS _P450 overexpression vector of example 1 of the invention;

among them, the resistance selection marker was kanamycin (kanamycin), spectinomycin (Spectaculin resistan).

Fig. 2 is a schematic diagram of the relative expression levels of SaTPS and SaP450 genes (representing Pvalue < 0.0001).

FIG. 3 is a graph showing the statistical result of the diameter of the lesion area of leaf blade of late blight and the symptoms of leaf necrosis 5 days after the in vitro leaf blade inoculation of the transgenic SaTPS _P450 potato.

Detailed Description

In order to make the objects, technical solutions and advantageous effects of the present invention more apparent, the present invention will be described in further detail with reference to the accompanying drawings and specific embodiments. Examples of which are illustrated in the accompanying drawings. It should be understood that the specific examples described in the following embodiments of the present invention are intended to be illustrative of the specific embodiments of the present invention and are not to be construed as limiting the invention.

The endpoints and any values of the ranges disclosed herein are not limited to the precise range or value, and are understood to encompass values approaching those ranges or values. For numerical ranges, one or more new numerical ranges may be found between the endpoints of each range, between the endpoint of each range and the individual point value, and between the individual point value, in combination with each other, and are to be considered as specifically disclosed herein. In the description of the present application, unless otherwise indicated, the meaning of "a/an", "a/a" and the like are two/species or more than two/species.

In the description of the present invention, the specific conditions are not specified in examples, and the description is carried out under conventional conditions. The reagents or apparatus used were conventional products commercially available without the manufacturer's attention.

EXAMPLE 1SaTPS_P450 overexpression vector construction

RNA from leaves of Solanum cymosum (Solanum americanum) was extracted using an RNA extraction kit (RNA-easy Isolation Reagent, cat# R701-01) manufactured by Nanjinouzan biotechnology Co., ltd.) and the corresponding cDNA was obtained using a reverse transcription kit (HISCRIPT III 1st Strand cDNA Synthesis Kit, cat# R312-01) of the company. Using black nightshade cDNA as template, using seamless cloning kit (ClonExpress Ultra One Step Cloning Kit, cat# C115-01) produced by Nanjinouzan biotechnology Co., ltd, cloning the nucleotide sequence of SaTPS protein coding region shown in SEQ ID NO. 2 into binary plant expression vector Super1300, selecting Xba I and Kpn I as enzyme cutting site, and the upstream primer sequence is: CAAATCGACTCTAGTCTAGAATGCATGTCCTCAATTTTTCTTGC; the downstream primer sequences were: CCCTTGCTCACCATGGTACCTTCAACTGGCTCAAATAACACTTTAGAT ATGT. After positive cloning of Escherichia coli was confirmed by Sanger sequencing by Shanghai Biotechnology Co., ltd., the complete expression cassette was cloned SaTPS using Super1300-SaTPS plasmid as a template, and the nucleotide sequence of the SaP protein coding region shown in SEQ ID NO:5 was cloned into binary plant expression vector pCHF-YFP with the primer sequence ,1300-F：ACAGCTATGACCATGATTACGAATTCGGATCCCTGAAAGCGACGTTG;1300-R：AAAAGGCTAATCTGGGGACCGAATTCCCGATCTAGTAACATAGATGA CACCGC. on the other hand, kpn I and Sal I were selected as cleavage sites, and the upstream primer sequence was: AGAACACGGGGGACGAGCTCGGTACCATGGAGTCCATTGCAATTTAT TTCTTTG; the downstream primer sequences were: TCCTCGCCCTTGCTCACCATGTCGACCAGAGGCTTGCAGACAATAGG AATTAC. After positive E.coli clones were confirmed by Sanger sequencing by Shanghai Biotechnology Co., ltd., recombinant plasmid pCHF-SaP 450 was cut with EcoRI. Finally, the complete expression cassette of Super1300-SaTPS was fused to recombinant plasmid pCHF-SaP 450 using a seamless cloning kit (ClonExpress Ultra One Step Cloning Kit, cat# C115-01) manufactured by Nanjinouzan Biotechnology Co., ltd, and the ligation system transfected into E.coli strain DH 5. Alpha. The cells were cultured on LB solid medium containing spectinomycin Spe (concentration: 50 ug/mL), and the monoclonal cells were selected and transferred to liquid LB medium containing spectinomycin for culture and propagation. Positive clone bacterial solutions were identified by PCR and sent to Sanger sequencing by Shanghai Biotechnology Co. After confirming the sequence, the recombinant plasmid pCHF-SaTPS _P450 was extracted using plasmid miniprep kit (TIANGEN: #DP103) manufactured by Tiangen Biochemical technology (Beijing) Co. Taking 5 mu L of recombinant plasmid pCHF-SaTPS _P450, adding 100 mu L of agrobacterium EHA105 for competence, standing on ice for 20 minutes, quickly freezing with liquid nitrogen for 5 minutes, carrying out heat shock at 37 ℃ for 3 minutes, adding 800 mu L of LB liquid medium, placing on a shaking table at 28 ℃ for 220 revolutions per minute, recovering for 2 hours, coating on solid LB medium containing rifampin Rif and spectinomycin Spe (working concentration is 50 ug/mL), and culturing at 28 ℃ for 2 days. After bacterial plaque grows out, the monoclonal is selected for propagation and culture, and positive clones are screened by using amplification primers and used for subsequent agrobacteria infection of explants.

Example 2SaTPS_P450 transfection and screening of overexpressed Potato lines

The transgenic Agrobacterium strain containing the binary plant expression vector (FIG. 1) obtained in example one was co-cultured with potato stems under sterile conditions on Murashige-Skoog medium for 2 days. The regenerated shoots differentiated after co-cultivation were transferred to a new MS medium containing kanamycin (concentration 4 mg/L) for selection culture. Transferring the obtained positive differentiation buds to a rooting culture medium, culturing for 3 weeks, and transplanting to a sunlight greenhouse.

Based on the nucleotide sequences of SaTPS and SaP protein coding regions shown in SEQ ID NO. 2 and 5, a plurality of identification primers were designed and synthesized as shown in Table 1:

primer sequences for nucleotide sequences of the SaTPS and SaP450 protein coding regions shown in Table 1SEQ ID NO:2 and 5

Transgenic potato leaf DNA was extracted using a plant genomic DNA rapid extraction kit (cat# DN 1501) from Beijing Edley Biotechnology Co., ltd.) and PCR amplification reaction procedure was 95℃for 5 minutes, 95℃for 10 seconds, 60℃for 15 seconds, 72℃for 60 seconds, cycle number 35, and finally 72℃for 10 minutes using PCR technique. The target band was preliminarily confirmed by 2% agarose gel electrophoresis, and the amplified fragment was sent to Shanghai Biotechnology Co., ltd for Sanger sequencing confirmation, and T0 generation transgenic potato positive plants were selected. On this basis, RNA of positive plants was extracted using an RNA extraction kit (RNA-easy Isolation Reagent, cat# R701-01) produced by Nanjinouzan Biotechnology Co., ltd.) and corresponding cDNA was obtained using a reverse transcription kit (HISCRIPT III 1st Strand cDNA Synthesis Kit, cat# R312-01) of the company. The relative expression level of the gene encoding the protein SaTPS _p450 of the transgenic line was detected using a BIO-RAD Real-time fluorescence quantification system (CFX Opus Real-TIME PCR SYSTEMS) with reference to wild type potatoes. The quantitative primers SaTPS and SaP450 are shown in table 2:

Quantitative primer sequences of tables 2SaTPS and SaP450

The reaction procedure of the real-time fluorescent quantitative PCR is as follows: pre-denaturation at 95℃for 10 min, denaturation at 95℃for 15 sec, annealing at 60℃for 30 sec, and fluorescence signal collection with cycle number 40. Transgenic potato lines with higher expression levels of SaTPS _p450 protein-encoding genes were selected for subsequent late blight resistance identification. The results of the real-time fluorescent quantitative PCR showed that the gene expression levels of transgenic potato lines SaTPS _P450-26 and SaTPS _P450-57 were significantly higher than the control (see FIG. 2).

Example 3 identification of late blight resistance of transgenic Potato line SaTPS _P450-26/57

Based on the results of the expression measurements of SaTPS and SaP450 in transgenic potatoes, one strain of each of SaTPS _p450-26 and SaTPS _p450-57 with higher over-expression fold was selected for late blight resistance identification.

Preparation of phytophthora infestans spore suspension: inoculating phytophthora infestans T30-4 into rye solid medium, culturing for about 20 days, adding 15 mL of sterile water, standing at 4 ℃ for 4 hours, scraping spore suspension in a flat plate, centrifuging at 3000rpm for 12 minutes, and adjusting the number of spores to 1X 10 ⁸/mL by utilizing a blood cell counting plate for identifying late blight resistance of in vitro leaves.

Identification of resistance to late blight of in vitro leaves: with wild plants as a control, 10 μl of spore suspension was pipetted into the center of the potato in vitro leaves, and the control group was replaced with sterile water, 6 leaves per group. Leaves were placed in a square petri dish with wet paper towels spread thereon, and after dark culture for 6 days at 18 ℃, leaf disease conditions were observed and leaf spot size measurements were performed. The resistance identification test was repeated three times. The leaf spot size and lesion area diameter showed that SaTPS _p450 transgenic potato showed reduced late blight onset symptoms in vitro leaf (see figure 3).

Claims (8)

1. A terpene synthase gene cluster SaTPS _p450 derived from solanum torvum, comprising the nucleotide sequence of: the genomic nucleotide sequences shown in SEQ ID NO. 1 and SEQ ID NO. 4; or the nucleotide sequences of the coding regions of SEQ ID NO. 1 and SEQ ID NO.4 shown in SEQ ID NO. 2 and SEQ ID NO. 5; or the nucleotide sequence corresponding to the amino acid sequence codes with the same function, which is formed by artificially engineering the amino acid sequences shown in SEQ ID NO.3 and SEQ ID NO. 6 or by replacing, deleting or adding one or more amino acids caused by natural nucleic acid polymorphism.

2. The terpene synthase gene cluster SaTPS _p450 derived from solanum pauciflorum according to claim 1, wherein said resistance gene sequences shown in SEQ ID No. 1 and SEQ ID No. 4 are derived from solanum pauciflorum (Solanum americanum).

3. A protein encoded by the terpene synthase gene cluster SaTPS _p450 derived from solanum torvum, comprising the amino acid sequence: amino acid sequences shown in SEQ ID NO. 3 and SEQ ID NO. 6; or the amino acid sequences shown in SEQ ID No. 3 and SEQ ID No. 6 are replaced, deleted or added by one or more amino acids caused by artificial engineering or natural nucleic acid polymorphism to form the amino acid sequence with the same function.

4. Use of the gene cluster of claim 1 or the protein of claim 3 for enhancing resistance to potato late blight, characterized in that the genes of SEQ ID No.2 and SEQ ID No. 5 are heterologously over-expressed in cultivated potatoes, thereby producing SaTPS and SaP encoded proteins in potatoes.

5. The use according to claim 4, wherein the heterologous overexpression of the genes indicated by SEQ ID No. 2 and SEQ ID No. 5 is achieved by means of the potato stable genetic transformation technique.

6. A method of growing potatoes with increased late blight resistance by heterologous overexpression of terpene synthase gene cluster SaTPS _p450 comprising the steps of:

s1, extracting RNA of leaves of Solanum cymosum (Solanum americanum), synthesizing a cDNA template, cloning nucleotide sequences of SaTPS and SaP protein coding regions shown in SEQ ID NO. 2 and SEQ ID NO. 5 into a binary plant expression vector pCHF-YFP to obtain a recombinant plasmid pCHF3-SaTPS _P450;

s2, transfecting the recombinant plasmid pCHF3-SaTPS _P450 obtained in the S1 into an escherichia coli strain;

s3, positively screening the strain in the S2, and extracting plasmid DNA thereof;

s4, transfecting the plasmid DNA obtained in the S3 into an agrobacterium strain;

S5, carrying out positive screening on the strain in the S4;

s6, co-culturing the positive plants obtained in the step S5 with potato stem segments;

s7, carrying out resistance screening on the co-cultured differentiated buds in the S6, transferring the screened buds to a rooting culture medium, and transplanting the screened buds to a sunlight greenhouse after root system development and field planting;

s8, detecting the expression level of SaTPS and SaP450 protein coding genes of the positive plants obtained in the S7;

s9, identifying the late blight resistance of the strain with higher over-expression multiple obtained in the S8.

7. The method of claim 6, wherein the E.coli strain used in S2 is DH 5. Alpha. By heterologous over-expression of terpene synthase gene cluster SaTPS _P450.

8. The method of claim 6, wherein the agrobacterium strain used in S4 is EHA105 or GV3101.