CN118086508A - Primer group, kit and application for high-sensitivity detection of FLT3-ITD mutation based on high-throughput sequencing technology - Google Patents

Abstract

The invention provides a primer group, a kit and application for detecting FLT3-ITD mutation with high sensitivity based on a high-throughput sequencing technology, which can accurately amplify a corresponding library of FLT3 by combining the high-throughput sequencing technology, realize detection of low-frequency FLT3-ITD, and can realize MRD detection of FLT3-ITD mutation of AML patients with detection sensitivity up to 5 multiplied by 10 ^‑6. In addition, after high-throughput sequencing is carried out on the primer composition, the specific position of the FLT3-ITD mutation and the specific sequence of insertion can be accurately given through bioinformatic analysis, and as the bioinformatic system can uniformly allocate parameters, uniform quality control can be achieved, and the difference of manual interpretation is eliminated.

Description

Primer group, kit and application for high-sensitivity detection of FLT3-ITD mutation based on high-throughput sequencing technology

Technical Field

The invention belongs to the technical field of biological detection, and particularly relates to a primer group for detecting FLT3-ITD mutation with high sensitivity based on a high-throughput sequencing technology, a kit and application thereof.

Background

Acute myeloid leukemia (acute myeloid leukemia, AML) is the most common leukemia subtype in china, and is a common and above all leukemia patients, with AML occurring at a relatively low rate in people under 30 years of age, and then gradually increasing with age, and the clinical manifestations of patients are fever, infection, hemorrhage and leukemic cell infiltration of the viscera. Along with continuous progress of various treatment schemes such as chemotherapy, transplantation, targeted drugs and the like in the recent years, the curative effect of AML is improved sufficiently, the long-term survival rate of patients with the age of less than 60 years can reach 35% -45% in recent years, and the long-term survival rate of patients with the age of more than or equal to 60 years is lower and is only 10% -15%. Leukemia recurrence is the major bottleneck leading to failure of AML treatment.

It is generally believed that the depth of remission of leukemia patients at treatment critical nodes (post-induction treatment, pre-transplantation, post-course of treatment, etc.) can be effective in predicting prognosis of patients. The evaluation of the remission depth includes various methods such as bone marrow morphology, flow cytometry and molecular biology, wherein the traditional bone marrow morphology has not yet been used for judging whether a patient reaches the gold standard of complete remission (complete remission, CR), but after the patient reaches CR (bone marrow smear is stained by Rate-Giemsa, and the original cells are detected by an optical microscope, < 5%), trace malignant tumor cells still exist in the patient, which are called minimal residual disease (minimal residual disease or measurable residual disease, MRD) and often become the root cause of drug resistance and relapse of the patient. Therefore, effective monitoring of patient MRD levels, and based thereon, determining patient risk stratification and subsequent treatment adjustments, becomes a key technical difficulty in determining AML patient prognosis levels.

MRD detection methods for AML patients include multiparameter flow cytometry (Multiparameter flow technology, MFC), real-time quantitative polymerase chain reaction (RQ-PCR) techniques, and digital PCR (dd-PCR) and second generation sequencing techniques (next generation sequencing, NGS), among others. The RQ-PCR and dd-PCR technology is only suitable for patients with positive fusion gene/NPM 1 mutation, and the target gene is required to be stably expressed in the disease treatment process, so that the method is only suitable for 30-60% of AML patients, and the cloning change condition and drug resistance condition in the tumor treatment process cannot be monitored, so that the clinical application of the method is limited to a certain extent; the MFC technology has complex analysis process, is affected by antigen drift and the like, cannot determine specific leukemia sub-populations, and has certain limitation in clinical application.

The occurrence of tandem repeat (FLT 3-ITD) mutations within the FLT3 gene is about 20-30% in AML. In AML prognostic stratification, ELN and NCCN guidelines suggest that AML patient prognosis assessment needs to rely on FLT3-ITD mutation status assessment. ITD mutation of FLT3 gene is one of the most common characteristic mutations of AML, is the most common poor prognosis driver of AML, has very strong clinical relevance in prognosis evaluation of AML diagnosis, and at the same time approves midostaurin or quinizarinib for treatment in international clinical practice, thereby changing risk stratification. However, because ITD mutation is used as a series repeated mutation of a large fragment, heterogeneity (namely sequence, position and length) exists in different patients and different stages of the same patient, so that a sequencing mode based on PCR is insensitive, the detection sensitivity is low, and the low-frequency mutation detection has technical problems. Among the prior art, particularly the first generation capillary electrophoresis is used as the main detection method of FLT3-ITD detection, the detection sensitivity is about 1% (namely 10 ^-2) and the specific sequence and insertion position of mutation cannot be identified. However, positive detection of the FLT3-ITD mutation at the level of 0.01% -0.001% (namely 10 ^-5～10^-6) has clear clinical significance, and accurate identification of specific sequences and insertion positions of the FLT3-ITD mutation can help to accurately identify clone evolution and recurrence prediction of AML patients clinically. At present, the corresponding detection mode and biological information capability are lacking, so that the problem that AML patients need to be solved in molecular biology MRD detection is solved.

Disclosure of Invention

In view of the shortcomings of the prior art, due to the defect of detecting FLT3-ITD mutation Minimal Residual Disease (MRD) of AML patients on the molecular biology level, in order to realize accurate identification and low-frequency detection of different ITD mutations (namely different sequences, positions and lengths) of FLT3 genes of different AML patients, the invention provides a primer group, a kit and application for detecting FLT3-ITD mutations with high sensitivity based on a high-throughput sequencing technology.

In a first aspect of the present invention, there is provided a primer set for detecting FLT3-ITD mutation, characterized in that the primer set has the sequence:

further, the primer set is a primer set for detecting acute myeloid leukemia FLT3-ITD mutation based on a high-throughput sequencing technology.

In a second aspect of the present invention, there is provided a primer set for detecting FLT3-ITD mutation, characterized in that the primer sequences of the primer set comprise a library adaptor sequence and a primer sequence, the primer set sequences being:

further, the primer set is a primer set for detecting acute myeloid leukemia FLT3-ITD mutation based on a high-throughput sequencing technology.

Further, the complete sequence of the primer set is:

In a third aspect of the present invention, there is provided a primer composition for detecting FLT3-ITD mutation, characterized by comprising the primer set of the first or second aspect of the present invention, taq DNA polymerase, buffer.

Further, the primer composition is used for detecting the FLT3-ITD mutation of the acute myeloid leukemia based on a high throughput sequencing technology.

In a fourth aspect of the invention, there is provided a kit for detecting a FLT3-ITD mutation, characterized by comprising a primer set according to the first or second aspect of the invention or a primer composition according to the third aspect of the invention.

Further, the kit is a kit for detecting acute myeloid leukemia FLT3-ITD mutation based on a high throughput sequencing technology.

Further, the kit also comprises Taq DNA polymerase, buffer, PCR ENHANCER, nucleic-FREE WATER, dNTPs and DNA purification magnetic beads.

Further, the kit also comprises a multiplex PCR reagent group, wherein the multiplex PCR reagent group comprises Taq DNA polymerase, buffer, PCR ENHANCER and UDIPrimer; further, specifically included are Enhancer buffer N, enhancer buffer M, polymerase mixture, UDIPrimer, nuclease-FREE WATER, DNA purification magnetic beads.

In a fifth aspect of the invention, there is provided the use of a primer set according to the first or second aspect of the invention or a primer composition according to the third aspect of the invention in the preparation of a kit for detecting FLT3-ITD mutations.

Further, the kit is a kit for detecting acute myeloid leukemia FLT3-ITD mutation based on a high throughput sequencing technology.

Further, the kit also comprises Taq DNA polymerase, buffer, PCR ENHANCER, nucleic-FREE WATER, dNTPs and DNA purification magnetic beads.

Further, the kit also comprises a multiplex PCR reagent group, wherein the multiplex PCR reagent group comprises Taq DNA polymerase, buffer, PCR ENHANCER and UDIPrimer; further, specifically included are Enhancer buffer N, enhancer buffer M, polymerase mixture, UDIPrimer, nuclease-FREE WATER, DNA purification magnetic beads.

Further, the specific steps for detecting FLT3-ITD mutation comprise:

(1) DNA extraction: extracting DNA from a sample to be detected by using a DNA extraction kit;

(2) Multiplex PCR amplification: performing multiplex PCR reaction on the extracted DNA by using a detection kit by using multiplex PCR reagent components to obtain amplicon products of a plurality of target nucleotides;

(3) Purifying the amplified product: adding DNA purification magnetic beads to purify the amplicon products of a plurality of target nucleotides to obtain pure amplicon products;

(4) Library building and amplification: using the purified amplicon product as a template, and performing secondary PCR reaction by using multiple PCR reagent components to obtain a new amplicon library;

(5) Purifying the library product: adding DNA purification magnetic beads to combine with target fragments to recycle amplicon products, and washing to remove reaction impurities to obtain a pure amplicon library;

(6) Sequencing: and carrying out high-throughput sequencing and bioinformatics flow analysis on the pure amplicon library to obtain sequence information of a target region, and obtaining a gene mutation result.

Further preferably, the concentration of the DNA extracted in the step (1) is 55ng/ul or more.

Further preferably, the high throughput sequencing in step (6) is PE150 high throughput sequencing.

Further preferably, the high throughput sequencing in step (6) is performed using an Illumina platform.

Further preferably, the high throughput sequencing in step (6) is performed using a Illumina Novaseq6000 platform.

In a sixth aspect of the invention there is provided the use of a kit according to the fourth aspect of the invention in the preparation of a product for detecting FLT3-ITD mutations.

Further, the specific steps for detecting FLT3-ITD mutation comprise:

(1) DNA extraction: extracting DNA from a sample to be detected by using a DNA extraction kit;

(2) Multiplex PCR amplification: performing multiplex PCR reaction on the extracted DNA by using a detection kit by using multiplex PCR reagent components to obtain amplicon products of a plurality of target nucleotides;

(3) Purifying the amplified product: adding DNA purification magnetic beads to purify the amplicon products of a plurality of target nucleotides to obtain pure amplicon products;

(4) Library building and amplification: using the purified amplicon product as a template, and performing secondary PCR reaction by using multiple PCR reagent components to obtain a new amplicon library;

(5) Purifying the library product: adding DNA purification magnetic beads to combine with target fragments to recycle amplicon products, and washing to remove reaction impurities to obtain a pure amplicon library;

(6) Sequencing: and carrying out high-throughput sequencing and bioinformatics flow analysis on the pure amplicon library to obtain sequence information of a target region, and obtaining a gene mutation result.

Further, the specific steps of the bioinformatics flow analysis are as follows: 1) Quality control analysis was performed on raw off-press data with Fastp1 (version 0.23.2, https:// gitsub.com/OpenGene/fastp), removing adaptors and low quality reads; 2) The quality-controlled data were aligned to the hg19 reference gene using bwa (version 0.7.17, https:// gitsub.com/lh 3/bwa) software; 3) The detection of FLT3-ITD was performed using commercial software Dragen (version 3.10.4, illumina) to obtain the final detection results.

Further preferably, the concentration of the DNA extracted in the step (1) is 55ng/ul or more.

Further preferably, the high throughput sequencing in step (6) is PE150 high throughput sequencing.

Further preferably, the high throughput sequencing in step (6) is performed using an Illumina platform.

Further preferably, the high throughput sequencing in step (6) is performed using a Illumina Novaseq6000 platform.

It is understood that within the scope of the present invention, the above-described technical features of the present invention and technical features specifically described below (e.g., in the examples) may be combined with each other to constitute new or preferred technical solutions. And are limited to a space, and are not described in detail herein.

Compared with the prior art, the invention has the following advantages and improvements:

The primer composition, the kit and the application provided by the invention can accurately amplify the corresponding library of the FLT3 by combining a high-throughput sequencing technology, realize detection of the low-frequency FLT3-ITD, have detection sensitivity of 0.0005% (namely 5 multiplied by 10 ^-6), and finally can realize MRD detection of the FLT3-ITD mutation of an AML patient.

After high-throughput sequencing is carried out on the primer composition, the specific position of the FLT3-ITD mutation and the specific sequence of insertion can be accurately given through bioinformatic analysis.

The conventional FLT3-ITD mutation detection method and reagent mainly adopt first-generation capillary electrophoresis, the detection sensitivity is mainly about 1%, and individual kits can detect 0.01% of mutations in the first-generation capillary electrophoresis, but the methods do not adopt high-throughput sequencing technology for sequencing and corresponding biological information analysis, and the quality control is easily uneven in the manual interpretation process. The primer composition, the kit and the application can complete specific mutation detection (specific insertion position and insertion sequence identification) of the ITD while realizing low-frequency detection, and in addition, as the biological information system can uniformly allocate parameters, uniform quality control can be achieved, and the difference of manual interpretation is eliminated.

Since FLT3-ITD mutation is affected by its region of interest and insert length, the library fragments are longer after amplification using a pair of primers in conventional primer design methods, and sequencing must be performed using PE 250. However, in practical high-throughput assays, most assays employ PE150 sequencing, resulting in a narrow application of PE250 in practical high-throughput assays, which is inconvenient to practice. If two or more pairs of primers are designed for amplification, the FLT3-ITD mutant insertion sequence is interrupted, and the detection data is inaccurate. The invention innovatively adopts a pair of specially designed semi-primers, shortens the library length after the primers are amplified on the basis of ensuring the detection effect, obtains unexpected detection effect, and can be suitable for PE150 sequencing to greatly improve the universality.

Drawings

The accompanying drawings, which are included to provide a further understanding of the invention and are incorporated in and constitute a part of this specification, illustrate embodiments of the invention and together with the description serve to explain the invention.

Fig. 1: general procedure for detection using the kit of the invention.

Detailed Description

The invention provides a primer group, a kit and application for detecting FLT3-ITD mutation with high sensitivity based on a high-throughput sequencing technology. The present invention will be specifically described below with reference to examples to facilitate further understanding of the present invention by those skilled in the art. The embodiments described below are only some of the embodiments of the present invention and should not be construed as limiting the invention in any way. It should be noted that modifications and improvements made by those skilled in the art based on the inventive concept should be considered as the scope of the present invention. The specific technical steps and operators are not identified in the examples and are carried out according to the general technical conditions or the related product specifications described in the literature in this field.

Examples

First part kit and detection method

1. Kit composition

(1) Multiplex PCR reagent set: the multiplex PCR reagent sets included Enhancer buffer N, enhancer buffer M, polymerase mixture, UDIPrimer. 96 human parts.

(2) Amplification primers in a composite amplification system

TABLE 1 sequence of the non-adapter primer set

TABLE 2 adapter + primer set sequences

TABLE 3 complete primer set sequences

TABLE 4 composite Primer System (Primer pool)

(3) The DNA purified beads were 7ml.

(4) Nuclease-FREE WATER, 7ml.

2. Method for detecting acute myeloid leukemia FLT3-ITD mutation based on high-throughput sequencing technology by using kit of the invention

(1) DNA extraction: and extracting the whole genome DNA of the peripheral blood or bone marrow sample by using the DNA extraction kit. Nucleic acid extraction reagent: commercial nucleic acid extraction kit (Lab-Aid 896 genomic DNA type), DNA extraction was performed according to the nucleic acid extraction reagent instructions, the extracted DNA solution was subjected to preliminary determination of nucleic acid concentration by NanoDrop (< 60ng/ul as failed) and A260/A230 purity detection (A260/A230 >1.7 as qualified), and the extracted DNA solution was subjected to nucleic acid concentration determination by Qubit (concentration >40ng/ul as qualified). The nucleic acid extraction kit can select manual extraction/automatic extraction, can be used for extracting nucleic acid from whole cell lines in peripheral blood and bone marrow samples, and can meet the requirements of quality inspection.

(2) The extracted DNA was subjected to multiplex PCR amplification according to the primer compositions provided in table 4.

Wherein the multiplex amplification system is shown in Table 5 below.

TABLE 5 multiplex amplification System

The procedure of the complex amplification reaction is as follows:

The first step: 95 ℃ for 3min30s;

second step (22 cycles): 98 ℃,20s,55 ℃,30s,60 ℃,30s,65 ℃ and 1min

And a third step of: 72 ℃,5min,4 ℃ and storing.

(3) Purification of amplified products

A) Magnetic beads (27. Mu.L) were added in an amount of 0.9 times the volume, and the mixture was sucked or vortexed and allowed to stand at room temperature for 5min.

B) And (3) performing instantaneous centrifugation, and placing the PCR tube on a magnetic rack for 3min until the solution is clear.

C) The supernatant was removed thoroughly while being kept on a magnetic rack, 180. Mu.L of 80% ethanol solution was added to the PCR tube, and the mixture was allowed to stand for 30 seconds. Keeping the PCR tube on a magnetic frame, removing the supernatant, and adding 180 parts into the PCR tube again

Mu.L of 80% ethanol solution was allowed to stand for 30s, and the supernatant was discarded.

D) The tube was covered, centrifuged transiently, the residual ethanol was centrifuged to the bottom, the PCR tube was placed on a magnetic rack, and the bottom residual ethanol was carefully removed using a 10 μl pipette, taking care not to aspirate the beads.

E) Keeping the PCR tube on a magnetic frame, standing for 3-5min at room temperature, airing the magnetic beads, and completely volatilizing the residual ethanol.

F) Adding 24 μl of Nuclear-FREE WATER, removing PCR tube from the magnetic rack, sucking or vortex mixing, and standing at room temperature for 2min.

G) And (5) performing instantaneous centrifugation, placing the PCR tube on a magnetic rack for 2min, and clarifying the solution.

H) The supernatant (13.5. Mu.L) was pipetted into a new PCR tube and the tube supernatant was labeled with the pooled multiplex PCR products and ready for the next reaction.

(4) And preparing the amplified product into a DNA library which can be sequenced by a sequencing platform by adopting a kit, and completing library construction.

TABLE 6 library construction system

Second round amplification of adaptor primer sequences (UDIPrimer): the primer sequence corresponds to the primer joint of the previous PCR reaction, and can be connected with a standard illuminea sequencing Index during the second round of amplification to form a standard library, so that the sequencing on a machine is facilitated.

Table 7UDIPrimer sequence

The library construction PCR reaction conditions were as follows:

The first step: 95 ℃ for 3min30s;

Second step (9 cycles): 98 ℃,20s,58 ℃,1min,72 ℃,30s

And a third step of: 72 ℃,5min,4 ℃ and storing.

(5) Purification of the library product

A) Magnetic beads (27. Mu.L) were added in an amount of 0.9 times the volume, and the mixture was sucked or vortexed and allowed to stand at room temperature for 5min.

B) And (3) performing instantaneous centrifugation, and placing the PCR tube on a magnetic rack for 3min until the solution is clear.

C) The supernatant was removed thoroughly while being kept on a magnetic rack, 180. Mu.L of 80% ethanol solution was added to the PCR tube, and the mixture was allowed to stand for 30 seconds. Keeping the PCR tube on a magnetic frame, removing the supernatant, and adding 180 parts into the PCR tube again

Mu.L of 80% ethanol solution was allowed to stand for 30s, and the supernatant was discarded.

D) The tube was covered, centrifuged transiently, the residual ethanol was centrifuged to the bottom, the PCR tube was placed on a magnetic rack, and the bottom residual ethanol was carefully removed using a 10 μl pipette, taking care not to aspirate the beads.

E) Keeping the PCR tube on a magnetic frame, standing for 3-5min at room temperature, airing the magnetic beads, and completely volatilizing the residual ethanol.

F) Adding 24 μl of Nuclear-FREE WATER, removing PCR tube from the magnetic rack, sucking or vortex mixing, and standing at room temperature for 2min.

G) And (5) performing instantaneous centrifugation, placing the PCR tube on a magnetic rack for 2min, and clarifying the solution.

H) mu.L of the supernatant was pipetted into a new library tube.

(6) And (3) diluting and quantifying the library, starting Novaseq to 6000 programs, placing the library into a library tube of a Illumina Novaseq6000 platform sequencing cartridge according to the prompt of a sequencer screen, placing a sequencing reagent into the sequencer, setting the sequencing reagent into PE150 for sequencing, and starting sequencing. And obtaining the next machine data after the sequencing is completed, and performing bioinformatics analysis on the next machine data. Detailed procedure of the experiment reference Novaseq6000 sequencing platform official description (https://support.illumina.com/content/dam/illumina-support/documents/documentation/system_documentation/novaseq/1000000019358_17_novaseq-6000-system-guide.

Pdf). The specific steps of bioinformatics analysis are: 1) Quality control analysis was performed on raw off-press data with Fastp1 (version 0.23.2, https:// gitsub.com/OpenGene/fastp), removing adaptors and low quality reads; 2) The quality-controlled data were aligned to the hg19 reference gene using bwa (version 0.7.17, https:// gitsub.com/lh 3/bwa) software; 3) The detection of FLT3-ITD was performed using commercial software Dragen (version 3.10.4, illumina) to obtain the final detection results.

Second partial detection results and verification thereof

1. Reproducibility of

Cell verification experiment

(1) Within-batch repeatability

The MV-4-11 cell strain and bone marrow of healthy people are diluted into quality control products (1:10; 1:100;1:1000; 1:10000) and 1 normal human sample according to the proportion, the same person uses the reagent to carry out experiments in the same batch, each sample is repeated for 2 times, and the repeatability of the results of 2 times is analyzed.

(2) Inter-batch repeatability

MV-4-11 cell strain is selected, and diluted with healthy human bone marrow in proportion to obtain quality control product and 1 normal human sample, and the reproducibility of the three results is analyzed.

(3) Results

Conclusion: the batch-to-batch consistency and the batch-to-batch consistency of the detection kit are 100%, and the requirement that the batch-to-batch and the batch-to-batch repeatability is more than 95% is met.

Clinical validation experiment

(1) Within-batch repeatability

2 Clinical positive samples, diluted samples thereof and 1 normal human sample are selected, the reagent is used for experiments by the same person in the same batch, each sample is repeated three times, and the repeatability of the results of the three times is analyzed. 2 clinically positive 10-fold diluted samples were also used as validation data for LOD.

(2) Inter-batch repeatability

2 Clinical positive samples, 2 clinical positive dilution samples (LOD verification) and 1 normal human sample were selected, and the three samples were repeated three times by two different persons between three different batches, and the reproducibility of the three results was analyzed.

(3) Results

/>

Conclusion: the intra-batch consistency of the detection kit is 96.97%, and the inter-batch consistency is 100%. Meets the requirement that the repeatability between batches is more than 95 percent.

2. Accuracy of

(1) Experimental protocol

19 Positive samples are selected, which contain 31 positive results (FLT 3 ITD variation can appear in one sample in various types), 5 normal samples are Kang Renyang, the samples are analyzed by the detection kit system, and the positive coincidence rate (PPA) and the negative coincidence rate (NPA) of detection results are analyzed. Ppa=positive/(positive+false negative), npa=negative/(negative+false positive).

(2) Positive sample results

/>

/>

/>

In the above table, "-" means "lower than detection sensitivity".

(3) Normal healthy person sample results

/>

Conclusion: PPA of the detection result of the detection system and the result of 19 positive samples is 100%; NPA was 100% compared to 5 normal healthy persons. The PPA and NPA results are both more than 90%, which shows that the accuracy of the system is good and meets the clinical detection requirements.

3. Analytical sensitivity

Cell validation experiment:

And selecting a MV-4-11 cell strain positive to the variation of FLT3-ITD, establishing an LOD quality control product with normal bone marrow cells, and then repeatedly detecting for a plurality of times to analyze whether mutation sites near the LOD can be accurately detected. The quality control mutations are shown in the following table:

MV-4-11 normal bone marrow	1:100	1:1000	1:10000	1:10 Ten thousand	1:20 Ten thousand
						Estimating VAF	1％	0.1％	0.01％	0.001％	0.0005％

Determination criteria: the analysis sensitivity of the same mutation site is the lowest mutation frequency which can be detected by the system under the conventional condition, if more than 95% of mutation sites can be detected at a certain lowest mutation frequency level, the frequency is judged to be the lowest detection limit of the system. The minimum detection limit is set appropriately if a mutation site having a LOD level of 95% or more can be detected accurately.

MV-4-11 normal bone marrow	1:100	1:1000	1:10000	1:10 Ten thousand	1:20 Ten thousand
						Estimating VAF	1％	0.1％	0.01％	0.001％	0.0005％
Run 1 VAF	0.9504％	0.1152％	0.01370％	0.001021％	0.0004359％
						Run 2 VAF	0.9371％	0.1030％	0.01109％	0.001208％	0.0004405％
3 Rd experiment VAF	0.9947％	0.1134％	0.01190％	0.001002％	0.0005265％
						Run 4 VAF	0.9854％	0.1165％	0.01213％	0.001576％	0.0004899％
SD value	0.00025107	0.00006769	0.00001222	0.00000221	0.00000035
						Average value of	0.973520％	0.109620％	0.011764％	0.001161％	0.000479％

Conclusion: the system can accurately detect at the level of 10 ^-6, and can be used as the minimum detection sensitivity.

Clinical verification experiment:

the clinical actual initial diagnosis is obtained, and AML patients with positive variation of FLT3 ITD (sensitivity of 0.5%) detected by first-generation capillary electrophoresis (sensitivity of 1%) and targeted NGS are subjected to systematic treatment, and then the patients are relieved in morphology, pathology and flow cytometry, and the kit is used for detecting the relieved patients. The results were as follows:

case 1: the results of the initial diagnosis of the patient are as follows:

/>

after treatment and alleviation, the detection results of the body system are as follows:

the kit detects 1 ITD variation consistent with the initial diagnosis sequence in the remission state of the patient, and accords with clinical practice.

Case 2: the results of the initial diagnosis of the patient are as follows:

after treatment and alleviation, the detection results of the body system are as follows:

The kit detects 2 ITD variations consistent with the initial diagnosis sequence in the remission state of the patient, and accords with clinical practice. Case 3: the results of the initial diagnosis of the patient are as follows:

after treatment and alleviation, the detection results of the body system are as follows:

the kit detects 1 ITD variation consistent with the initial diagnosis sequence in the remission state of the patient, and accords with clinical practice. Case 4: the results of the initial diagnosis of the patient are as follows:

after treatment and alleviation, the detection results of the body system are as follows:

The kit detects 3 ITD variations consistent with the initial diagnosis sequence in the remission state of the patient, and accords with clinical practice.

Conclusion: the MRD detection result is consistent with the initial diagnosis sequence of the patient, the lowest detection sensitivity reaches 10 ^-6, and the clinical situation is met.

The above description is only of the preferred embodiments of the present invention and is not intended to limit the present invention in any way. Modifications and variations of the above embodiments according to the technical principles of the present invention will be within the scope of the present invention for those skilled in the art.

Claims (10)

1. A primer set for detecting FLT3-ITD mutation, wherein the primer set has the sequence:

Forward primer (5 '-3') E14-F: GCAATTTAGGTATGAAAGCCAGCTAC (SEQ ID NO: 1);

Reverse primer (5 '-3') I14-R: ATGGAAAAGAAATGCTGCAGAAAC (SEQ ID NO: 2);

forward primer (5 '-3') I14-F: GCACGTACTCACCATTTGTCTTTG (SEQ ID NO: 3).

2. A primer set for detecting FLT3-ITD mutation, wherein the primer sequence of the primer set comprises a library adaptor sequence and a primer sequence, and the primer set sequence is:

forward primer (5 '-3') ITD-E14-F: library linker sequence + GCAATTTAGGTATGAAAGCCAGCTAC;

reverse primer (5 '-3') ITD-I14-R: library linker sequence + ATGGAAAAGAAATGCTGCAGAAAC;

forward primer (5 '-3') ITD-I14-F: library linker sequence + GCACGTACTCACCATTTGTCTTTG.

3. The primer set according to claim 2, wherein the primer set has a specific sequence of:

forward primer (5 '-3') ITD-E14-F:

ACACTCTTTCCCTACACGACGCTCTTCCGATCTGCAATTTAGGTATGAAAGCC

AGCTAC(SEQ ID NO：4)；

reverse primer (5 '-3') ITD-I14-R:

GTGACTGGAGTTCCTTGGCACCCGAGAATTCCAATGGAAAAGAAATGCTGCA

GAAAC(SEQ ID NO：5)；

forward primer (5 '-3') ITD-I14-F:

ACACTCTTTCCCTACACGACGCTCTTCCGATCTGCACGTACTCACCATTTGTCTTTG(SEQ ID NO：6)。

4. A primer composition for detecting FLT3-ITD mutation, comprising the primer set according to any one of claims 1 to 3, taq DNA polymerase and Buffer.

5. A kit for detecting FLT3-ITD mutation, comprising the primer set of any one of claims 1-3 or the primer composition of claim 3.

6. The kit of claim 5, further comprising a multiplex PCR kit comprising Taq DNA polymerase, buffer, PCR ENHANCER, UDIPrimer.

7. Use of the primer set of any one of claims 1-3 or the primer composition of claim 4 in the preparation of a kit for detecting FLT3-ITD mutations.

8. The use according to claim 7, wherein the specific step of detecting FLT3-ITD mutations comprises:

(1) DNA extraction: extracting DNA from a sample to be detected by using a DNA extraction kit;

(2) Multiplex PCR amplification: performing multiplex PCR reaction on the extracted DNA by using a detection kit by using multiplex PCR reagent components to obtain amplicon products of a plurality of target nucleotides;

(3) Purifying the amplified product: adding DNA purification magnetic beads to purify the amplicon products of a plurality of target nucleotides to obtain pure amplicon products;

(4) Library building and amplification: using the purified amplicon product as a template, and performing secondary PCR reaction by using multiple PCR reagent components to obtain a new amplicon library;

(5) Purifying the library product: adding DNA purification magnetic beads to combine with target fragments to recycle amplicon products, and washing to remove reaction impurities to obtain a pure amplicon library;

(6) Sequencing: and carrying out high-throughput sequencing and bioinformatics flow analysis on the pure amplicon library to obtain sequence information of a target region, and obtaining a gene mutation result.

9. Use of the kit of claim 5 or 6 for the preparation of a product for detecting FLT3-ITD mutations.

10. The use according to claim 9, wherein the specific step of detecting FLT3-ITD mutations comprises:

(1) DNA extraction: extracting DNA from a sample to be detected by using a DNA extraction kit;

(2) Multiplex PCR amplification: performing multiplex PCR reaction on the extracted DNA by using a detection kit by using multiplex PCR reagent components to obtain amplicon products of a plurality of target nucleotides;

(3) Purifying the amplified product: adding DNA purification magnetic beads to purify the amplicon products of a plurality of target nucleotides to obtain pure amplicon products;

(4) Library building and amplification: using the purified amplicon product as a template, and performing secondary PCR reaction by using multiple PCR reagent components to obtain a new amplicon library;

(5) Purifying the library product: adding DNA purification magnetic beads to combine with target fragments to recycle amplicon products, and washing to remove reaction impurities to obtain a pure amplicon library;

(6) Sequencing: and carrying out high-throughput sequencing and bioinformatics flow analysis on the pure amplicon library to obtain sequence information of a target region, and obtaining a gene mutation result.