CN116445478B - Primer combination for constructing IGHV gene library and application thereof - Google Patents

Primer combination for constructing IGHV gene library and application thereof Download PDF

Info

Publication number
CN116445478B
CN116445478B CN202310686206.3A CN202310686206A CN116445478B CN 116445478 B CN116445478 B CN 116445478B CN 202310686206 A CN202310686206 A CN 202310686206A CN 116445478 B CN116445478 B CN 116445478B
Authority
CN
China
Prior art keywords
primer
seq
ighv
primers
constructing
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202310686206.3A
Other languages
Chinese (zh)
Other versions
CN116445478A (en
Inventor
张�林
白海齐
肖敏
刘明坤
叶锋
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Beijing Genomeprecision Technology Co ltd
Tongji Medical College of Huazhong University of Science and Technology
Original Assignee
Beijing Genomeprecision Technology Co ltd
Tongji Medical College of Huazhong University of Science and Technology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Beijing Genomeprecision Technology Co ltd, Tongji Medical College of Huazhong University of Science and Technology filed Critical Beijing Genomeprecision Technology Co ltd
Priority to CN202310686206.3A priority Critical patent/CN116445478B/en
Publication of CN116445478A publication Critical patent/CN116445478A/en
Application granted granted Critical
Publication of CN116445478B publication Critical patent/CN116445478B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869—Methods for sequencing
    • C—CHEMISTRY; METALLURGY
    • C40—COMBINATORIAL TECHNOLOGY
    • C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B50/00—Methods of creating libraries, e.g. combinatorial synthesis
    • C40B50/06—Biochemical methods, e.g. using enzymes or whole viable microorganisms
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Genetics & Genomics (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a primer combination for constructing an IGHV gene library and application thereof. The primer combination comprises a Leader primer and/or an FR1 primer; the Leader primer comprises 6 pre-primers and 3 post-primers; the FR1 primer comprises 15 pre-primers and 2 post-primers. The invention skillfully designs a plurality of groups of primer combinations, and the front primer of the Leader primer is positioned in the IGH gene leading region, so that the full-length IGHV gene sequence can be amplified, and the IGHV mutation state can be analyzed in an all-around way; the front primer of the FR1 primer is positioned in the FR1 region of the IGH gene, can be matched with a Leader primer for use, ensures accurate and stable amplification to obtain an IGHV gene sequence, obtains a gene library, is convenient for high-throughput sequencing analysis, and realizes stable detection of IGHV gene mutation.

Description

Primer combination for constructing IGHV gene library and application thereof
Technical Field
The invention belongs to the technical field of molecular biology, and relates to a primer combination for constructing an IGHV gene library and application thereof.
Background
Chronic lymphocytic leukemia (Chronic lymphocytic leukemia, CLL) is one of the most common malignant lymphoproliferative diseases. The clinical course and prognosis of CLL patients are highly heterogeneous, with part of the patients living in the same time as normal persons of the same age, and part of the patients dying within a short time after the disease progression. Some patients suffer from inert diseases and for many years do not require treatment, while others require early therapeutic intervention. Therefore, prognosis-related factor studies have important instructive significance in the decision of clinical strategies. Factors closely related to CLL prognosis are: disease stage, serum beta 2 microglobulin, lactate Dehydrogenase (LDH), ZAP-70, CD38, etc., while immunoglobulin heavy chain variable region (IGHV) gene mutation is one of the most important independent prognostic factors of CLL.
Taking the IGH gene expressing the immunoglobulin heavy chain polypeptide as an example, in undifferentiated lymphocytes, the IGH gene is mainly composed of a variable region (variable V), a diversity region (diversity D) and a junction region (joining J), and each gene region is composed of a plurality of gene fragments. As lymphocytes differentiate from blast cells to mature lymphocytes, the original IGH gene cleaves a fragment in each gene region under the action of a recombinase and is religated to form a new gene with expression function.
In recent years, the determination of the mutation status of rearranged immunoglobulin heavy chain variable region (IGHV) genes in most Chronic Lymphocytic Leukemia (CLL) patients has been shown to have a strong independent prognostic value. Thus, IGHV mutant status is considered one of the most important prognostic indicators in clinical trials. The current method for detecting IGHV mutation state mainly depends on a first generation sequencing platform, but the following disadvantages exist in the first generation sequencing detection of IGHV due to technical limitations: (1) low detection sensitivity; (2) accommodate relatively few cases; (3) Each workflow finally results in only a single IGHV mutation result; (4) The subcloning result and the clone diversity information cannot be detected; (5) Poor sequencing quality at the front and back ends of sequencing results in inaccurate IGHV mutation results.
In conclusion, the development of a method for efficiently and stably detecting IGHV gene mutation has important significance in the field of IGH gene research.
Disclosure of Invention
Aiming at the defects and actual demands of the prior art, the invention provides a primer combination for constructing an IGHV gene library and application thereof, adopts a high-throughput sequencing method to detect IGHV gene mutation, obviously improves detection sensitivity and accuracy, and can accurately obtain sequence information.
In order to achieve the above purpose, the invention adopts the following technical scheme:
in a first aspect, the invention provides a primer combination for constructing an IGHV gene library, the primer combination comprises a Leader primer and/or an FR1 primer, the Leader primer comprises 6 pre-primers and 3 post-primers, the nucleic acid sequence of the pre-primers comprises sequences shown in SEQ ID NO. 1-SEQ ID NO.6, the nucleic acid sequence of the post-primers comprises sequences shown in SEQ ID NO. 7-SEQ ID NO.9, the FR1 primer comprises 15 pre-primers and 2 post-primers, the nucleic acid sequence of the pre-primers comprises sequences shown in SEQ ID NO. 10-SEQ ID NO.24, and the nucleic acid sequence of the post-primers comprises sequences shown in SEQ ID NO. 25-SEQ ID NO. 26.
The invention further analyzes the IGHV gene structure, skillfully designs a plurality of groups of primer combinations, and the lead primer is positioned in the IGH gene leading region, so that the full-length IGHV gene sequence can be amplified, and the IGHV mutation state can be analyzed in an all-around way; the front primer of the FR1 primer is positioned in the FR1 region of the IGH gene, can be matched with a Leader primer for use, ensures accurate and stable amplification to obtain an IGHV gene sequence, obtains a gene library, and is convenient for high-throughput sequencing analysis.
SEQ ID NO.1：gtaaaacgacggccagtccatggactgkarrtggagvrta。
SEQ ID NO.2：gtaaaacgacggccagtatggacacactttgcttcacrctg。
SEQ ID NO.3：gtaaaacgacggccagtccatggagttmggrctbhgctgc。
SEQ ID NO.4：gtaaaacgacggccagtacatgatccarctgtgttcttca。
SEQ ID NO.5：gtaaaacgacggccagtatggggtcaaccgccatcct。
SEQ ID NO.6：gtaaaacgacggccagtatgtctgtctccttcctcatt。
SEQ ID NO.7：taatacgactcactatagggttgtagcgggatgcacg。
SEQ ID NO.8：taatacgactcactatagggaagtagtcctcggaccaga。
SEQ ID NO.9：taatacgactcactataggggaggctcagtggggagacctg。
SEQ ID NO.10：gtaaaacgacggccagtctggggctgaggtgaagaaat。
SEQ ID NO.11：gtaaaacgacggccagtgcagtctggagcagaggtgaatt。
SEQ ID NO.12：gtaaaacgacggccagttcaccttgaaggagtctggtct。
SEQ ID NO.13：gtaaaacgacggccagtaggtgtagctgagtggagta。
SEQ ID NO.14：gtaaaacgacggccagtgaggtgcagctgttgacagta。
SEQ ID NO.15：gtaaaacgacggccagtccaggactggtgaagccttc。
SEQ ID NO.16：gtaaaacgacggccagtcagtggggcgcaggactgtc。
SEQ ID NO.17：gtaaaacgacggccagtccaggactgtttgagcgcctct。
SEQ ID NO.18：gtaaaacgacggccagtgtacagctgtagccggtcagc。
SEQ ID NO.19：gtaaaacgacggccagtgctgctgcaatctttacgtcta。
SEQ ID NO.20：gtaaaacgacggccagtcctcagtgaagatgtccttcaags。
SEQ ID NO.21：gtaaaacgacggccagtaaacccacagagatcctcacgctt。
SEQ ID NO.22：gtaaaacgacggccagtctggggggtcgctgagccactcctg。
SEQ ID NO.23：gtaaaacgacggccagtcttcacagagcctgtctctaaccta。
SEQ ID NO.24：gtaaaacgacggccagtacgcagagcctcttactctcctgtc。
SEQ ID NO.25：taatacgactcactatagcgcttaccagatgatacggtgacg。
SEQ ID NO.26：taatacgactcactatagggctgacctgagtagacagtgaca。
The above sequences have degenerate bases where r=a/g, m=a/c, k=g/t, s=c/g, h=a/c/t, b=c/g/t, v=a/c/g.
The method is suitable for an Ion Torrent high-throughput sequencing platform.
Optionally, the primer combination further comprises a adaptor primer.
Optionally, the adaptor primer comprises an Ion Torrent platform adaptor primer.
Optionally, the adaptor primer comprises 12 pre-primers and 1 post-primer, the nucleic acid sequence of the pre-primer comprises the sequence shown in SEQ ID NO. 27-SEQ ID NO.38, and the nucleic acid sequence of the post-primer comprises the sequence shown in SEQ ID NO. 39.
SEQ ID NO.27：
ccatctcatccctgcgtgtctccgactcagccgcatggaacgatgtaaaacgacggccag。
SEQ ID NO.28：
ccatctcatccctgcgtgtctccgactcagctggcaatcctcgatgtaaaacgacggccag。
SEQ ID NO.29：
ccatctcatccctgcgtgtctccgactcagccggagaatcgcgatgtaaaacgacggccag。
SEQ ID NO.30：ccatctcatccctgcgtgtctccgactcagtccacctcctcgatgtaaaacgacggccag。
SEQ ID NO.31：ccatctcatccctgcgtgtctccgactcagcagcattaattcgatgtaaaacgacggccag。
SEQ ID NO.32：
ccatctcatccctgcgtgtctccgactcagtctggcaacggcgatgtaaaacgacggccag。
SEQ ID NO.33：ccatctcatccctgcgtgtctccgactcagtcctagaacacgatgtaaaacgacggccag。
SEQ ID NO.34：ccatctcatccctgcgtgtctccgactcagtccttgatgttcgatgtaaaacgacggccag。
SEQ ID NO.35：ccatctcatccctgcgtgtctccgactcagtctagctcttcgatgtaaaacgacggccag。
SEQ ID NO.36：ccatctcatccctgcgtgtctccgactcagtcactcggatcgatgtaaaacgacggccag。
SEQ ID NO.37：ccatctcatccctgcgtgtctccgactcagttcctgcttcacgatgtaaaacgacggccag。
SEQ ID NO.38：ccatctcatccctgcgtgtctccgactcagccttagagttcgatgtaaaacgacggccag。
SEQ ID NO.39：ccactacgcctccgctttcctctctatgggcagtcggtgattaatacgactcactataggg。
In a second aspect, the invention provides the use of a primer combination for constructing an IGHV gene library according to the first aspect for the preparation of a product for detecting IGHV genes.
In a third aspect, the invention provides a kit for detecting mutations in an IGHV gene, the kit comprising the primer combination for constructing an IGHV gene library according to the first aspect.
Preferably, the kit further comprises multiplex PCR amplification reagents and/or sequencing adapter amplification reagents;
preferably, the multiplex PCR amplification reagents comprise a DNA polymerase and an amplification buffer;
preferably, the sequencing adapter amplification reagents comprise a DNA polymerase and an amplification buffer.
In a fourth aspect, the invention provides the use of a primer combination for constructing an IGHV gene library according to the first aspect for detecting IGHV genes.
In a fifth aspect, the present invention provides a method of constructing an IGHV gene library, the method comprising:
and (3) taking nucleic acid of a sample to be detected as a template, carrying out multiplex PCR amplification by using the primer combination for constructing the IGHV gene library in the first aspect, mixing a multiplex PCR amplification product with the joint primer, and carrying out joint PCR amplification reaction to obtain the IGHV gene library.
Preferably, the sample to be tested comprises any one of peripheral blood, bone marrow or FFPE samples.
Preferably, the conditions for multiplex PCR amplification are: (1) pre-denaturation at 93-96 ℃ for 8-12 min; (2) Denaturation at 93-95 ℃ for 1-3 min, annealing at 60-65 ℃ for 1-3 min, extension at 70-73 ℃ for 25-35 s, and 30-40 cycles; (3) extending at 70-73 ℃ for 8-12 min; preferably, (1) pre-denaturation at 94℃for 10min; (2) Denaturation at 94℃for 1min, annealing at 63℃for 1min, extension at 72℃for 30s,35 cycles; (3) extension at 72℃for 10 min.
Preferably, the conditions of the adaptor PCR amplification reaction are: (1) pre-denaturation at 94-96 ℃ for 10-14 min; (2) Denaturation at 93-95 ℃ for 25-35 s, annealing at 60-65 ℃ for 25-35 s, extension at 70-73 ℃ for 25-35 s, and 18-23 cycles; (3) extending at 70-73 ℃ for 3-6 min; preferably at 95℃for 12min; (2) Denaturation at 94℃of 30s, annealing at 63℃of 30s, elongation at 72℃of 30s,20 cycles; (3) extension at 72℃for 5 min.
In a sixth aspect, the present invention provides a method for detecting mutations in an IGHV gene for the purpose of non-disease diagnosis, the method comprising:
constructing an IGHV gene library by using the method for constructing an IGHV gene library in the fifth aspect, purifying the IGHV gene library, and performing on-machine sequencing and data analysis on the purified IGHV gene library to judge the mutation condition of the IGHV gene.
Preferably, the method of purification comprises a magnetic bead purification method.
The invention designs a specific primer combination, ensures accurate and stable amplification to obtain the IGHV gene sequence, obtains a gene library, combines a high-throughput sequencing technology, can greatly improve detection sensitivity and accuracy, has wide application prospect, and can be applied to the field of cell immunity research and the like.
In a seventh aspect, the present invention provides a device for detecting mutations in an IGHV gene, the device comprising a library construction unit and a sequencing unit;
the library construction unit is for performing a method comprising:
constructing an IGHV gene library by using the method for constructing an IGHV gene library according to the fifth aspect, and purifying the IGHV gene library;
the sequencing unit is for performing a sequence comprising:
and (3) performing on-machine sequencing and data analysis on the IGHV gene library after the library construction unit is purified, and judging the mutation condition of the IGHV gene.
In an eighth aspect, the present invention provides a system for high throughput sequencing detection of IGHV gene mutations, the system comprising a kit for detecting IGHV gene mutations according to the third aspect and a high throughput sequencing platform.
Compared with the prior art, the invention has the following beneficial effects:
the invention skillfully designs a plurality of groups of primer combinations, and the front primer of the Leader primer is positioned in the IGH gene leading region, so that the full-length IGHV gene sequence can be amplified, and the IGHV mutation state can be analyzed in an all-around way; the front primer of the FR1 primer is positioned in the FR1 region of the IGH gene, can be matched with a Leader primer for use, ensures accurate and stable amplification to obtain an IGHV gene sequence, obtains a gene library, is convenient for high-throughput sequencing analysis, and realizes stable detection of IGHV gene mutation.
Drawings
FIG. 1 shows IGHV gene composition and primer profile;
FIG. 2A is a graph showing the result of analysis of amplification products of a Leader primer;
FIG. 2B is a graph showing the results of the amplification product analysis of the primer set 1;
FIG. 2C is a graph showing the results of the amplification product analysis of the primer control group 2;
FIG. 2D is a graph showing the results of analysis of FR1 primer amplification products;
FIG. 2E is a graph showing the results of analysis of the amplification products of the FR1 primer control group 1;
FIG. 2F is a graph showing the results of analysis of the amplification products of the FR1 primer control group 2;
FIG. 3A is a graph showing the result of analysis of a primer amplification library;
FIG. 3B is a graph showing the results of amplification library analysis of the primer control group 1;
FIG. 3C is a graph showing the results of analysis of the amplified library of the primer control group 2;
FIG. 3D is a graph showing the results of analysis of an FR1 primer amplification library;
FIG. 3E is a graph showing the results of analysis of the amplification library of the FR1 primer control group 1;
FIG. 3F is a graph showing the results of analysis of an FR1 primer control group 2 amplified library.
Detailed Description
The technical means adopted by the invention and the effects thereof are further described below with reference to the examples and the attached drawings. It is to be understood that the specific embodiments described herein are merely illustrative of the invention and are not limiting thereof.
The specific techniques or conditions are not identified in the examples and are described in the literature in this field or are carried out in accordance with the product specifications. The reagents or equipment used were conventional products available for purchase through regular channels, with no manufacturer noted.
Example 1
The embodiment provides an IGHV gene detection kit, which comprises a Leader primer (a front primer SEQ ID NO. 1-SEQ ID NO.6; a rear primer SEQ ID NO. 7-SEQ ID NO. 9), an FR1 primer (a front primer SEQ ID NO. 10-SEQ ID NO.24; a rear primer SEQ ID NO. 25-SEQ ID NO. 26) and a joint primer (a front primer SEQ ID NO. 27-SEQ ID NO.38; a rear primer SEQ ID NO. 39), wherein the IGHV gene composition and the primer distribution are shown in figure 1.
Example 2
The present example extracts sample DNA.
The kit for extracting DNA is a blood/cell/tissue genome DNA extraction kit (product number DP 304-02) of Tiangen biochemical company, and the specific experimental steps are as follows:
notice that:
(b1) Before first use, absolute ethyl alcohol is added into a buffer solution GD and a rinsing solution PW according to the specification of a reagent bottle label;
(b2) The sample should be prevented from repeated freeze thawing, otherwise, the extracted DNA fragments are smaller and the extraction amount is reduced;
(b3) If the buffer solution GA or GB has sediment, the buffer solution GA or GB can be redissolved in a water bath at 37 ℃ and can be used after shaking;
(b4) All centrifugation steps were performed using a bench centrifuge at 25 ℃.
Procedure (taking peripheral blood as an example):
(c1) The treatment material, such as extraction material, is blood, 200 μl of fresh, frozen or blood with various anticoagulants can be directly used, and less than 200 μl of buffer GA can be added for supplementing;
(c2) Adding 20 mu L of protease K solution, and uniformly mixing;
(c3) Adding 200 mu L of buffer solution GB, fully and reversely and uniformly mixing, standing at 70 ℃ for 10min, keeping the solution clear, and centrifuging briefly to remove water drops on the inner wall of the tube cover;
(c4) Adding 200 mu L of absolute ethyl alcohol, fully oscillating and uniformly mixing to obtain 15 s, wherein flocculent precipitate can appear at the moment, and centrifuging briefly to remove water drops on the inner wall of the tube cover;
(c5) Adding the solution obtained in the last step and flocculent precipitate into an adsorption column CB3 (the adsorption column is placed into a collecting pipe), centrifuging at 12,000 rpm (13,400 Xg) for 30s, pouring out waste liquid, and placing the adsorption column CB3 into the collecting pipe;
(c6) Adding 500 mu L of buffer solution GD into an adsorption column CB3 (before use, checking whether absolute ethyl alcohol is added or not), centrifuging at 12,000 rpm (13, 400 Xg) for 30s, pouring out waste liquid, and placing the adsorption column CB3 into a collecting tube;
(c7) Adding 600 mu L of rinsing solution PW (before use, checking whether absolute ethyl alcohol is added or not) into an adsorption column CB3, centrifuging at 12,000 rpm (13, 400 Xg) for 30s, pouring out waste liquid, and placing the adsorption column CB3 into a collecting pipe;
(c8) Repeating the operation step c7;
(c9) The adsorption column CB3 is put back into a collecting pipe, and is centrifuged at 12,000 rpm (13,400 Xg) for 2min, and the waste liquid is poured out. Placing the adsorption column CB3 at 25 ℃ for a plurality of minutes to thoroughly dry the residual rinsing liquid in the adsorption material;
(c10) Transferring the adsorption column CB3 into a clean centrifuge tube, suspending and dripping 50-200 mu L of elution buffer TE into the middle part of the adsorption film, standing at 25 ℃ for 2-5 min, centrifuging at 12,000 rpm (13,400 Xg) for 2min, and collecting the solution into the centrifuge tube.
Example 3
This example uses the primers of example 1 to amplify a fragment of interest of the IGHV gene, comprising the steps of
(d1) The amplification reagent used in this example was AmpliTaq Gold from Thermofiser TM DNA Polymerase (cat# N8080259);
(d2) IGHV gene fragment amplification System: PCR Buffer II (10×) was added at 5. Mu.L, mgCl2 (25 mM) was added at 3. Mu.L, dNTP-Mix (10 mM) was added at 1. Mu.L, ampliTaq Gold (5U/. Mu.L) was added at 0.2. Mu.L, the Leader primer or FR1 primer was added at a final concentration of 0.2. Mu.M, the DNA was added at 100 ng, and water was added to a total volume of 50. Mu.L;
(d3) Adding the system into a PCR tube, transferring the PCR tube into a PCR instrument, and starting an amplification reaction system;
(d4) The amplification reaction is completed according to a PCR thermal cycling procedure, and the amplification procedure is as follows: (1) pre-denaturation at 94℃for 10min; (2) Denaturation at 94℃for 1min, annealing at 63℃for 1min, extension at 72℃for 30s,35 cycles; (3) extending at 72 ℃ for 10min,4 ℃ in infinity;
(d5) After the reaction is finished, if no subsequent experiment is immediately carried out, the amplified product is placed at 4 ℃ (short time) or-20 ℃ (long time);
(d6) The amplified product is subjected to Qubit concentration quality inspection and Agilent 4200 instrument fragmentation analysis, so that the amplified product is ensured to appear, and the amplification results of the Leader primer and the FR1 primer are respectively shown in FIG. 2A and FIG. 2D, and the amplified product 4200 of the normal sample is subjected to quality inspection and has a band with a target fragment size.
(d7) In the embodiment, three groups of primers are designed simultaneously, and through a comparison experiment, proper primers are screened out. The other two sets of primer sequences were as follows:
control group 1
（1）gtaaaacgacggccagtccatggactggacctgga。
（2）gtaaaacgacggccagtatggacatactttgttccac。
（3）gtaaaacgacggccagtccatggagtttgggctgagc。
（4）gtaaaacgacggccagtatgaaacacctgtggttctt。
（5）gtaaaacgacggccagtatggggtcaaccgccatcct。
（6）gtaaaacgacggccagtatgtctgtctccttcctcat。
（7）gtaaaacgacggccagtggcctcagtgaaggtctcctgcaag。
（8）gtaaaacgacggccagtgtctggtcctacgctggtgaaaccc。
（9）gtaaaacgacggccagtctggggggtccctgagactctcctg。
（10）gtaaaacgacggccagtcttcggagaccctgtccctcacctg。
（11）gtaaaacgacggccagtcggggagtctctgaagatctcctgt。
（12）gtaaaacgacggccagttcgcagaccctctcactcacctgtg。
（13）taatacgactcactatagggttggggcggatgcact。
（14）taatacgactcactatagggaagtagtccttgaccagg。
（15）taatacgactcactataggggaggctcagcgggaagacctt。
Control group 2
（1）gtaaaacgacggccagtctcaccatggactggacctggag。
（2）gtaaaacgacggccagtatggacatactttgttccacgctc。
（3）gtaaaacgacggccagtccatggagtttgggctgagctgg。
（4）gtaaaacgacggccagtacatgaaacayctgtggttcttcc。
（5）gtaaaacgacggccagtatggggtcaaccgccatcctccg。
（6）gtaaaacgacggccagtatgtctgtctccttcctcatcttc。
（7）gtaaaacgacggccagtgagaccctgtccctcacctg。
（8）gtaaaacgacggccagtggagtctctgatgatctcctgtaagg。
（9）gtaaaacgacggccagtggtccctcagactctcctgtg。
（10）gtaaaacgacggccagttcgcagaccctctcactcacc。
（11）gtaaaacgacggccagttcgctggtgaaacccacagagac。
（12）gtaaaacgacggccagttctcagtgaaggtatcctgcaagg。
（13）taatacgactcactatagggttggggcggatgcact。
（14）taatacgactcactatagggaagtagtccttgaccagg。
（15）taatacgactcactataggggaggctcagcgggaagacctt。
The experimental procedure is the same as that in this example, and the PCR primers required for the second step of adaptor are the same as those in this example.
The results of the primer comparison group of the Leader are shown in fig. 2B and 2C respectively, the results of the primer comparison group of the FR1 are shown in fig. 2E and 2F respectively, and the peak value of the target fragment is low or no target fragment, which indicates that the specificity of the specific primer combination amplification product designed by the invention is the best.
Example 4
This example connects the IGHV amplification products of example 3 to a linker, comprising the steps of:
(e1) The reagent used in the IGHV amplification product linker system is the FastStart High Fidelity PCR System reagent of Roche (cat# 4738292001);
(e2) Sucking 2. Mu.L of the amplification product of example 3 into a new PCR tube, adding water to 100. Mu.L, and diluting the amplification product 50 times;
(e3) The IGHV amplification product linker system is: PCR Buffer with MgCl2 (10×) 5. Mu.L dNTP-Mix (10 mM) 1. Mu.L, adaptor pre-primer (10. Mu.M) 1. Mu.L, adaptor post-primer (10. Mu.M) 1. Mu.L, amplification product (50-fold diluted) 1. Mu.L, fast Start High Fidelity polymerase (5U/. Mu.L) 0.5. Mu.L, and make-up to 50. Mu.L;
(e4) Adding the system into a PCR tube, transferring the PCR tube into a PCR instrument, and starting an amplification reaction system;
(e5) The amplification reaction is completed according to a PCR thermal cycling procedure, and the amplification procedure is as follows: (1) pre-denaturation at 95℃for 12min; (2) Denaturation at 94℃for 30s, annealing at 63℃for 30s, elongation at 72℃for 30s,20 cycles; (3) extending at 72℃for 5min,4℃in infinity;
(e6) The product obtained after the ligation reaction is completed is the human IGHV library.
Example 5
IGHV library purification was performed in this example.
The magnetic beads used for purification are Amp XP magnetic beads, which were incubated at 25℃half an hour prior to use.
(f1) Adding 50 mu L of Amp magnetic beads which are completely incubated at 25 ℃ into the linking product, mixing uniformly by vortex, and standing at 25 ℃ for 5 min;
(f2) Transferring the reaction tube to a magnetic rack for adsorption until the solution is clarified, and removing supernatant;
(f3) 200 mu L of newly prepared 80% ethanol is added into a reaction tube, the mixture is gently blown up and down for 4 times, and the supernatant is removed;
(f4) Repeating step (f 3);
(f5) The reaction tube is instantaneously centrifuged, then the reaction tube is put back to the magnetic rack for adsorption, 80% of residual ethanol is removed, and the reaction tube is continuously placed on the magnetic rack;
(f6) Standing at 25deg.C for 5min, and air drying the magnetic beads;
(f7) Adding 35 mu L of RNase-free water into the reaction tube, removing the reaction tube from the magnetic rack, mixing by vortex, and standing at 25 ℃ for 5 min;
(f8) Transferring the reaction tube to a magnetic rack again for adsorption for 3 min until the solution is clear;
(f9) The supernatant was pipetted into a new EP tube, where the library was purified.
Example 6
This example quantifies the IGHV library purified in example 5.
(g1) The library quantitative reagent is KAPA Library Quantification Kit Ion Torrent ™ Platforms kit; the quantitative instrument is ABI 7500
(g2) Library fragment size was quality controlled using an Agilent 4200 instrument.
The amplification results of the Leader primer and the FR1 primer are shown in FIG. 3A and FIG. 3D respectively, the final size of the Leader library is about 650 bp, the final size of the FR1 library is about 430 bp, the results of the Leader primer control group are shown in FIG. 3B and FIG. 3C respectively, a plurality of nonspecific amplification libraries are arranged except for the target library about 650 bp, the results of the FR1 primer control group are shown in FIG. 3E and FIG. 3F respectively, the target size library is not obvious and the nonspecific amplification library is obvious, which shows that the specific primer combination specificity of the design of the invention is best.
Example 7
The present example performs an IGHV library on-board test.
(h1) According to the quantitative result of the example 6 and the on-machine requirement, the constructed library poling is carried out together;
(h2) The on-line instrument is selected from Ion Torrent S5 platform of thermo filter.
Example 8
This example performed IGHV library off-machine data bioinformatic analysis.
(i1) After the IGHV library is on-machine, determining that the quality of the on-machine data meets the requirement of off-machine data;
(i2) And (5) using an IMGT database and IGblast to analyze the down-call data.
The analysis results are shown in Table 1.
TABLE 1
Table 1 shows the first ten cloning information, first determining if the first clone is a clonal rearrangement based on a first cloning percentage greater than 5% and a first cloning percentage greater than 2 times the third cloning percentage, so Table 1 ranks the first clone as a clonal rearrangement; under the condition that the first clone is the cloning rearrangement, the mutation proportion of the V region of the first clone is the final detection result, so that the IGHV mutation proportion of the table 1 is 7.72%.
In summary, the invention skillfully designs a plurality of groups of primer combinations, and the lead primer is positioned in the IGH gene Leader region, so that the full-length IGHV gene sequence can be amplified, and the IGHV mutation state can be analyzed in an all-around way; the front primer of the FR1 primer is positioned in the FR1 region of the IGH gene, can be matched with a Leader primer for use, ensures accurate and stable amplification to obtain an IGHV gene sequence, obtains a gene library, is convenient for high-throughput sequencing analysis, and realizes stable detection of IGHV gene mutation.
The applicant states that the detailed method of the present invention is illustrated by the above examples, but the present invention is not limited to the detailed method described above, i.e. it does not mean that the present invention must be practiced in dependence upon the detailed method described above. It should be apparent to those skilled in the art that any modification of the present invention, equivalent substitution of raw materials for the product of the present invention, addition of auxiliary components, selection of specific modes, etc., falls within the scope of the present invention and the scope of disclosure.

Claims (7)

1. A primer combination for constructing an IGHV gene library, wherein the primer combination comprises a Leader primer and an FR1 primer;
the Leader primer comprises 6 pre-primers and 3 post-primers, the nucleic acid sequences of the pre-primers are shown in SEQ ID NO. 1-SEQ ID NO.6, and the nucleic acid sequences of the post-primers are shown in SEQ ID NO. 7-SEQ ID NO. 9;
the FR1 primer comprises 15 pre-primers and 2 post-primers, the nucleic acid sequences of the pre-primers are shown in SEQ ID NO. 10-SEQ ID NO.24, and the nucleic acid sequences of the post-primers are shown in SEQ ID NO. 25-SEQ ID NO. 26.
2. The primer combination for constructing an IGHV gene library according to claim 1, wherein the primer combination further comprises a linker primer;
the adaptor primer comprises an Iontorrent platform adaptor primer;
the adaptor primer comprises 12 pre-primers and 1 post-primer, the nucleic acid sequence of the pre-primer comprises sequences shown in SEQ ID NO. 27-SEQ ID NO.38, and the nucleic acid sequence of the post-primer comprises sequences shown in SEQ ID NO. 39.
3. Use of a primer combination for constructing an IGHV gene library according to claim 1 or 2 for the preparation of a kit for detecting an IGHV gene.
4. A kit for detecting mutations in IGHV genes, comprising the primer combination according to claim 1 or 2 for constructing an IGHV gene library;
the kit further comprises multiplex PCR amplification reagents and/or sequencing adapter amplification reagents;
the multiplex PCR amplification reagent comprises DNA polymerase and an amplification buffer;
the sequencing adapter amplification reagent comprises a DNA polymerase and an amplification buffer.
5. A method of constructing an IGHV gene library for non-disease diagnosis purposes, the method comprising:
using nucleic acid of a sample to be detected as a template, performing multiplex PCR amplification by using the primer combination for constructing the IGHV gene library according to claim 1 or 2, mixing a multiplex PCR amplification product with the joint primer, and performing joint PCR amplification reaction to obtain the IGHV gene library.
6. The method of constructing an IGHV gene library for non-disease diagnosis according to claim 5, wherein the sample to be tested comprises any one of peripheral blood, bone marrow or FFPE samples;
the conditions for multiplex PCR amplification are: (1) pre-denaturation at 93-96 ℃ for 8-12 min; (2) Denaturation at 93-95 ℃ for 1-3 min, annealing at 60-65 ℃ for 1-3 min, extension at 70-73 ℃ for 25-35 s, and 30-40 cycles; (3) extending at 70-73 ℃ for 8-12 min;
the conditions of the adaptor PCR amplification reaction are as follows: (1) pre-denaturation at 94-96 ℃ for 10-14 min; (2) Denaturation at 93-95 ℃ for 25-35 s, annealing at 60-65 ℃ for 25-35 s, extension at 70-73 ℃ for 25-35 s, and 18-23 cycles; (3) extending at 70-73 ℃ for 3-6 min.
7. A system for high throughput sequencing detection of IGHV gene mutations, comprising the kit for detecting IGHV gene mutations of claim 4 and a high throughput sequencing platform.
CN202310686206.3A 2023-06-12 2023-06-12 Primer combination for constructing IGHV gene library and application thereof Active CN116445478B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202310686206.3A CN116445478B (en) 2023-06-12 2023-06-12 Primer combination for constructing IGHV gene library and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202310686206.3A CN116445478B (en) 2023-06-12 2023-06-12 Primer combination for constructing IGHV gene library and application thereof

Publications (2)

Publication Number Publication Date
CN116445478A CN116445478A (en) 2023-07-18
CN116445478B true CN116445478B (en) 2023-09-05

Family

ID=87120480

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202310686206.3A Active CN116445478B (en) 2023-06-12 2023-06-12 Primer combination for constructing IGHV gene library and application thereof

Country Status (1)

Country Link
CN (1) CN116445478B (en)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108998508A (en) * 2018-08-28 2018-12-14 深圳联合医学科技有限公司 The construction method and primer sets and kit of amplicon sequencing library
CN112654720A (en) * 2018-07-18 2021-04-13 生命技术公司 Compositions and methods for immunohistorian sequencing
CN114592035A (en) * 2022-03-21 2022-06-07 深圳金域医学检验实验室 Asymmetric amplification-based library construction primer group and application thereof
CN115433768A (en) * 2022-09-09 2022-12-06 江苏先声医学诊断有限公司 IGH (immunoglobulin-binding H) hypermutation detection method and system based on NGS (Next Generation kit) amplicon sequencing technology
CN116064818A (en) * 2022-12-06 2023-05-05 广州金域医学检验中心有限公司 Primer group, method and system for detecting IGH gene rearrangement and hypermutation

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3227464B1 (en) * 2014-12-05 2022-04-20 Foundation Medicine, Inc. Multigene analysis of tumor samples

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112654720A (en) * 2018-07-18 2021-04-13 生命技术公司 Compositions and methods for immunohistorian sequencing
CN108998508A (en) * 2018-08-28 2018-12-14 深圳联合医学科技有限公司 The construction method and primer sets and kit of amplicon sequencing library
CN116064753A (en) * 2018-08-28 2023-05-05 深圳联合医学科技有限公司 High-efficiency sequencing library construction method, primer set and kit
CN114592035A (en) * 2022-03-21 2022-06-07 深圳金域医学检验实验室 Asymmetric amplification-based library construction primer group and application thereof
CN115433768A (en) * 2022-09-09 2022-12-06 江苏先声医学诊断有限公司 IGH (immunoglobulin-binding H) hypermutation detection method and system based on NGS (Next Generation kit) amplicon sequencing technology
CN116064818A (en) * 2022-12-06 2023-05-05 广州金域医学检验中心有限公司 Primer group, method and system for detecting IGH gene rearrangement and hypermutation

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
The absolute percent deviation of IGHV mutation rather than a 98% cut-off predicts survival of chronic lymphocytic leukaemia patients treated with fludarabine, cyclophosphamide and rituximab;Preetesh Jain et al.;《British Journal of Haematology》;第180卷;第33–40页 *

Also Published As

Publication number Publication date
CN116445478A (en) 2023-07-18

Similar Documents

Publication Publication Date Title
CN111440896B (en) Novel beta coronavirus variation detection method, probe and kit
CN107699957B (en) DNA-based fusion gene quantitative sequencing library construction, detection method and application thereof
CN110853708B (en) Design method of nucleic acid capture probe for HLA typing
CN108060227B (en) Amplification primer, kit and detection method for detecting PAH gene mutation
CN113817725A (en) HLA gene amplification primer, kit, sequencing library construction method and sequencing method
CN112795654A (en) Method and kit for organism fusion gene detection and fusion abundance quantification
CN109295500B (en) Single cell methylation sequencing technology and application thereof
CN110846409A (en) Primer combination for detecting TNNI3K gene mutation and application thereof
CN108374047B (en) Kit for detecting bladder cancer based on high-throughput sequencing technology
CN109280696B (en) Method for splitting mixed sample by SNP detection technology
CN116445478B (en) Primer combination for constructing IGHV gene library and application thereof
CN113025702B (en) Early screening method and kit for ankylosing spondylitis susceptibility genes
CN110600082B (en) Nucleic acid capture probe for HLA typing and design method thereof
CN114250269A (en) Probe composition, second-generation sequencing library based on probe composition and application of second-generation sequencing library
CN111235270B (en) Tumor antigen expression detection primer and kit based on high-throughput sequencing method
CN112662759A (en) Probe composition for detecting 3 lumen organ tumors
CN114317685B (en) Kit for detecting mRNA variable shear variation, library building method and sequencing method
CN114032298B (en) Probe set for detecting genetic bilirubin metabolic abnormality and intrahepatic cholestasis related gene variation, kit and application thereof
CN117512085B (en) Primer group and kit for detecting HLA-DPB1 genotyping
CN115323051B (en) Acute myeloid leukemia detection probe composition and application thereof
CN117363722A (en) Primer combination for detecting IGK and IGL genes and application thereof
CN117587099A (en) Amplicon library construction method based on capture probe and application thereof
Wei et al. CRISPR/Cas13a-based single-nucleotide polymorphism detection for reliable determination of ABO blood group genotypes
CN114369663A (en) Marker and probe composition for liver cancer screening and application thereof
EP4373971A1 (en) Diagnosing inflammatory bowel diseases

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant