CN118064482A

CN118064482A - Recombinant bacterium for heterologously expressing hemoglobin gene and method for fermenting salinomycin

Info

Publication number: CN118064482A
Application number: CN202311331142.1A
Authority: CN
Inventors: 葛庆燕; 李霞; 李学鹏; 张鄂; 邵俊熙; 孟敏; 李阳; 赵钰函; 蔡作新
Original assignee: Shandong Qilu King Phar Pharmaceutical Co ltd
Current assignee: Shandong Qilu King Phar Pharmaceutical Co ltd
Priority date: 2023-10-13
Filing date: 2023-10-13
Publication date: 2024-05-24

Abstract

The invention belongs to the technical fields of bioengineering and industrial microorganisms, and particularly relates to a method for improving salinomycin yield by a genetic engineering means, and more particularly relates to recombinant bacteria for heterologously expressing a hemoglobin gene and a method for improving the fermentation level of salinomycin based on the recombinant bacteria. According to the method for improving the salinomycin fermentation level by heterologously expressing the hemoglobin gene, disclosed by the invention, the constructed genetically engineered bacteria are utilized for fermentation, and the respiration and metabolism of bacteria can be promoted by promoting oxygen transportation under low exogenous oxygen concentration, so that the oxygen limitation is relieved, and the biosynthesis of the salinomycin is further promoted. The final yield of the engineering strain salinomycin obtained by the invention is improved by 30%, and the laboratory shake flask level reaches 8g/L.

Description

Recombinant bacterium for heterologously expressing hemoglobin gene and method for fermenting salinomycin

Technical Field

The invention belongs to the technical fields of bioengineering and industrial microorganisms, and particularly relates to a method for improving salinomycin yield by a genetic engineering means, and more particularly relates to recombinant bacteria for heterologously expressing a hemoglobin gene and a method for improving the fermentation level of salinomycin based on the recombinant bacteria.

Background

Salinomycin is a polyether antibiotic produced by streptomyces albus (Streptomyces albus), has a wide anticoccidial spectrum, has a remarkable inhibition effect of only 50mg/kg, and is widely applied as an anticoccidial agent worldwide. In addition, salinomycin can inhibit the growth of most gram-positive bacteria, and plays a role in bacteriostasis. The mechanism of action of salinomycin is reported to be substantially the same as that of other polyether antibiotics, and is a chelating carrier of sodium-potassium ions, which changes the cell ion gradient by binding sodium-potassium ions, resulting in cell death. At present, researches show that salinomycin can kill epithelial tumor stem cells efficiently and specifically, and the activity of the salinomycin is 100 times of that of paclitaxel clinically applied at present, which fully shows that the salinomycin has great medical application prospect.

In the traditional salinomycin fermentation process, the problems of high oxygen consumption and insufficient dissolved oxygen exist, and become an important factor for limiting the fermentation level. Researches show that the main function of the vitreoscilla hemoglobin (Vitreoscilla hemoglobin, VHb) is to combine and transfer oxygen to terminal respiration oxidase, especially under the condition of oxygen deficiency, the thallus respiration and oxidative phosphorylation can be enhanced, and the utilization efficiency of the thallus to oxygen is improved. At present, VHb has realized heterologous expression in a plurality of hosts such as streptomyces cinnamomum, streptomyces hygroscopicus, streptomyces diastatochromogenes, streptomyces luteus, and the like, and can promote the growth of thalli and the synthesis of products under the condition of hypoxia. Researchers found that over-expression smhb in Streptomyces LIVIDANS TK was more efficient at increasing secondary metabolic yield than vhb, and that over-expression smhb by oxidative stress, a significant increase in NADPH yield could be observed, which speculated to activate the pentose phosphate pathway.

Therefore, attempts to improve the fermentation yield of salinomycin by heterologous expression of hemoglobin genes through promoters are expected in the art, and effective references are provided for the expansion of the industrial scale of salinomycin and the reduction of the production cost.

Disclosure of Invention

Therefore, the technical problem to be solved by the invention is to provide a recombinant bacterium for heterologously expressing hemoglobin genes, wherein the recombinant bacterium is respectively inserted with hemoglobin genes vhb from transparent vibrio and hemoglobin genes smhb from sinorhizobium on white streptomycin Y21-122 (Streptomyces albus) chromosomes through an integrated vector pSET152, so that the recombinant bacterium can promote respiration and metabolism of bacteria under low exogenous oxygen concentration by promoting oxygen delivery so as to relieve oxygen limitation, promote biosynthesis of salinomycin and effectively improve fermentation level of salinomycin;

the second technical problem to be solved by the invention is to provide a method for efficiently fermenting salinomycin by recombinant bacteria based on the heterologous expression hemoglobin gene.

In order to solve the technical problems, the invention discloses a recombinant plasmid I, which contains Pkasop x-vhb genes; the Pkasop x-vhb gene has a nucleotide sequence shown as SEQ ID NO. 1;

preferably, the expression vector of the recombinant plasmid I is plasmid pSET152;

Preferably, the construction method of the recombinant plasmid I comprises the step of inserting an EcoRI/XbaI fragment of the Pkasop x-VHB gene from the PUC57-KASOP-VHB plasmid at the EcoRI/XbaI site of the plasmid pSET 152.

The invention discloses a recombinant plasmid II, which contains Psco7677 gene and vhb gene; the Psco7677 gene fragment has a nucleotide sequence shown as SEQ ID NO. 2; the vhb gene fragment has a nucleotide sequence shown as SEQ ID NO. 3;

preferably, the expression vector of the recombinant plasmid II is plasmid pSET152;

Preferably, the construction method of the recombinant plasmid II comprises the step of inserting PCR fragments of Psco7677 and VHB genes from pUC57-7677-smhb plasmid and pUC57-KASOP-VHB plasmid at EcoRI/XbaI sites of the plasmid pSET 152.

The invention discloses a recombinant plasmid III, which contains Psco7677-smhb genes; the Psco7677-smhb gene has a nucleotide sequence shown as SEQ ID NO. 4;

Preferably, the expression vector of the recombinant plasmid III is plasmid pSET152;

Preferably, the construction method of the recombinant plasmid III comprises the step of inserting EcoRI/XbaI fragment of Psco7677-smhb gene from pUC57-7677-smhb plasmid into EcoRI/XbaI site of the plasmid pSET 152.

The invention discloses a recombinant plasmid IV, which contains Pkasop genes and smhb genes; the Pkasop gene fragment has a nucleotide sequence shown as SEQ ID NO. 5; the smhb gene has a nucleotide sequence shown as SEQ ID NO. 6;

Preferably, the expression vector of the recombinant plasmid IV is plasmid pSET152;

Preferably, the construction method of the recombinant plasmid IV comprises the step of inserting PCR fragments of Pkasop and smhb genes from the PUC57-KASOP-VHB and pUC57-7677-smhb at EcoRI/XbaI sites of the plasmid pSET 152.

The invention also discloses a genetically engineered bacterium, which contains at least one of the recombinant plasmid I of claim 1, the recombinant plasmid II of claim 2, the recombinant plasmid III of claim 3, or the recombinant plasmid IV of claim 4;

Preferably, the genetic engineering is streptomyces albus;

Preferably, the genetic engineering comprises at least one of a Psco7677-smhb gene insertion mutant, a Pkasop x-vhb gene insertion mutant, a Psco7677-vhb gene insertion mutant or a Pkasop x-smhb gene insertion mutant.

The invention also discloses a construction method of the genetically engineered bacterium, which comprises the steps of transferring at least one of the recombinant plasmid I, the recombinant plasmid II, the recombinant plasmid III or the recombinant plasmid IV into a recipient bacterium for homologous recombination;

Preferably, the recipient bacteria include Streptomyces albus Y21-122.

The invention also discloses a method for efficiently fermenting salinomycin based on the heterologous expression hemoglobin gene, which comprises the step of inoculating the genetic engineering bacteria into a proper fermentation culture medium for fermentation culture.

Specifically, the method for efficiently fermenting salinomycin based on heterologous expression of hemoglobin genes comprises the following components in mass content: 0.5 to 2 weight percent of wheat germ powder, 0.5 to 1 weight percent of soybean cake powder, 0.1 to 0.3 weight percent of potassium chloride, 0.05 to 0.2 weight percent of sodium chloride, 0.1 to 0.3 weight percent of urea, 0.1 to 0.3 weight percent of tartaric acid, 0.01 to 0.02 weight percent of magnesium sulfate, 0.01 to 0.02 weight percent of dipotassium hydrogen phosphate, 0.3 to 0.8 weight percent of calcium carbonate and 10 to 15 weight percent of soybean oil;

preferably, the fermentation medium comprises the following components in mass content: 1wt% of wheat germ powder, 0.8wt% of soybean cake powder, 0.2wt% of potassium chloride, 0.1wt% of sodium chloride, 0.2wt% of urea, 0.2wt% of tartaric acid, 0.01wt% of magnesium sulfate, 0.01wt% of dipotassium hydrogen phosphate, 0.5wt% of calcium carbonate and 13wt% of soybean oil;

The conditions of the fermentation culture step include: controlling the rotation speed to be 200-250rpm, and fermenting and culturing for 8-12 days at 28-32 ℃.

Specifically, the method for efficiently fermenting salinomycin based on heterologous expression of hemoglobin genes further comprises the step of inoculating the genetically engineered bacteria into a seed culture medium for seed liquid culture;

the seed culture medium comprises the following components in mass content: 3-5wt% of glucose, 2-4wt% of soybean meal, 0.5-2wt% of wheat germ meal and 0.1-0.3wt% of calcium carbonate;

preferably, the seed culture medium comprises the following components in percentage by mass: 4wt% of glucose, 3wt% of soybean meal, 1wt% of wheat germ meal and 0.2wt% of calcium carbonate;

the conditions of the seed liquid culture step include: the rotation speed is controlled to be 200-250rpm, and the seed liquid culture is carried out for 26-32h at 28-32 ℃.

The invention also discloses a method for efficiently fermenting salinomycin based on heterologous expression of the hemoglobin genes, which comprises the steps of respectively inserting the hemoglobin genes vhb and smhb from the transparent vibrio on the chromosome of the streptomyces albus;

preferably, the method further comprises the step of selecting a high efficiency promoter Pkasop and Psco7677 for heterologous expression enhancement.

The genetically engineered bacterium for heterologously expressing the hemoglobin gene disclosed by the invention is characterized in that an integrated vector pSET152 is used for respectively inserting a hemoglobin (vhb) gene from a transparent vibrio and a hemoglobin (smhb) gene from a sino-rhizobium on a white streptomycin Y21-122 (Streptomyces albus) chromosome, and 2 efficient promoters Pkasop and Psco7677 are selected to enhance the expression level of the hemoglobin gene, so that the utilization rate of oxygen of streptomycin is improved, and finally the aim of improving the yield of salinomycin is fulfilled.

The construction method of the genetically engineered bacterium for the heterologous expression of the hemoglobin gene is formed by constructing corresponding recombinant plasmids respectively and carrying out homologous recombination construction; wherein, the integrated recombinant plasmid I and the recombinant plasmid II for inserting the hemoglobin gene vhb from the hyaluronidase are designed and constructed; and designing and constructing an integrated recombinant plasmid III and a recombinant plasmid IV for inserting the hemoglobin gene smhb derived from rhizobia; and then the recombinant plasmids I, II, III and IV obtained by the construction are subjected to conjugation transfer and introduced into the recipient strain Streptomyces albus Y21-122 for homologous recombination.

In the genetically engineered bacterium for the heterologous expression of the hemoglobin gene, the recombinant plasmid I is obtained by inserting Pkasop x-VHB gene fragment EcoRI/XbaI of 623bp fully synthesized from a PUC57-KASOP-VHB plasmid into the EcoRI/XbaI site of a plasmid pSET 152; the recombinant plasmid II is obtained by inserting Psco7677 and VHB gene PCR fragments from pUC57-7677-smhb and pUC57-KASOP-VHB into EcoRI/XbaI sites of plasmid pSET 152; the recombinant plasmid III is obtained by inserting a Psco7677-smhb gene fragment EcoRI/XbaI of complete synthesis 1,719 bp from pUC57-7677-smhb plasmid into EcoRI/XbaI site of plasmid pSET 152; the recombinant plasmid IV was a Pkasop and smhb gene PCR fragment from pUC57-KASOP-VHB and pUC57-7677-smhb inserted at the EcoRI/XbaI site of plasmid pSET 152.

The method for improving the salinomycin fermentation level by the heterologous expression of the hemoglobin genes is characterized in that an integrated vector pSET152 is used for respectively inserting a hemoglobin gene vhb from transparent vibrio and a hemoglobin gene smhb from sinorhizobium on a streptomyces albus Y21-122 (Streptomyces albus) chromosome, and 2 high-efficiency promoters Pkasop and Psco7677 are selected to enhance the expression level of the hemoglobin genes, so that a genetic engineering bacterium capable of efficiently fermenting the salinomycin is constructed, the utilization rate of oxygen of streptomyces albus can be improved in the fermentation process, and the aim of improving the salinomycin yield is finally achieved.

According to the method for improving the salinomycin fermentation level by heterologously expressing the hemoglobin gene, disclosed by the invention, the constructed genetically engineered bacteria are utilized for fermentation, and the respiration and metabolism of bacteria can be promoted by promoting oxygen transportation under low exogenous oxygen concentration, so that the oxygen limitation is relieved, and the biosynthesis of the salinomycin is further promoted. The final yield of the engineering strain salinomycin obtained by the invention is improved by 30%, and the laboratory shake flask level reaches 8g/L.

Drawings

In order that the invention may be more readily understood, a more particular description of the invention will be rendered by reference to specific embodiments thereof which are illustrated in the appended drawings, in which,

FIG. 1 shows the construction scheme of the insertion of the vhb gene (plasmid pSET 152-I, plasmid pSET 152-II) and smhb gene (plasmid pSET 152-III, plasmid pSET 152-IV) in example 1;

FIG. 2 is a graph showing the results of PCR identification of colonies of the insertion mutant described in example 2;

FIG. 3 shows the results of salinomycin fermentation yields of the gene insert mutant strain described in example 3 and an empty control (vector containing no gene fragment of interest).

Detailed Description

In order to make the objects, technical solutions and advantages of the embodiments of the present invention more clear, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention.

In the following examples of the present invention, the strain Streptomyces albus Y21-122 was an industrial strain stored by Shandong zier pharmaceutical Co., ltd.

In the following examples of the invention, the plasmid pSET152 is described in NCBI database, access: AJ414670.1, GI:17974209.

In the following examples, the sequence of Pkasop x-vhb gene is shown as SEQ ID NO. 1; the sequence of the amplified Psco7677 gene fragment is shown in SEQ ID NO. 2; the sequence of the amplified vhb gene fragment is shown as SEQ ID NO. 3; the sequence of the Psco7677-smhb gene is shown as SEQ ID NO. 4; the sequence of the amplified Pkasop gene fragment is shown in SEQ ID NO. 5; the sequence of the amplified smhb gene fragment is shown as SEQ ID NO. 6.

Example 1

As shown in the inserted plasmid construction flow chart of FIG. 1, the present example is used for constructing the desired plasmids pSET 152-I, pSET 152-II, pSET 152-III and pSET 152-IV, wherein the plasmids pSET 152-I and pSET 152-II are vhb gene inserted plasmids, and the plasmids pSET 152-III and pSET 152-IV are smhb gene inserted plasmids.

As shown in the scheme of FIG. 1, the gene KASOP-VHB, 7677-smhb (cloned into the universal vector PUC 57) was synthesized by the entrusted gene company, plasmids PUC57-KASOP-VHB and pUC57-7677-smhb were taken, double digested with EcoRI/XbaI, and the Pkasop x-VHB gene (EcoRI/XbaI) shown in SEQ ID NO.1 and the Psco7677-smhb gene (EcoRI/XbaI) shown in SEQ ID NO.3 were inserted into the EcoRI/XbaI sites of plasmid pSET152, respectively, to obtain plasmids pSET 152-I and pSET 152-III, respectively, by the above-mentioned method.

The specific operation steps are as follows:

(1) Enzyme cutting system

The vector pSET152 and the gene fragment were digested according to the system shown in Table 1;

TABLE 1 enzyme digestion system (50. Mu.L)

10x Buffer	5μL
		Vector/gene fragment	10μL
Xba I	5μL
		EcoR I	5μL
ddH2O	25μL

Adding samples according to the system, mixing uniformly, and then performing constant-temperature water bath at 37 ℃ for 15min, and running gel to determine the size of the bands (about 5.3kb of vector, about 0.6kb of gene fragment 1 and about 1.7kb of gene fragment 3); recovering the enzyme section according to TIANGEN general agar gel DNA recovery kit instructions;

(2) T4 connection

Reaction conditions: the reaction system is shown in the following table 2 at 25 ℃ for 1 h;

TABLE 2 reaction system (20. Mu.L)

Carrier body	5μL
		Fragment 1/3	10μL
5x T4 Ligase Reaction Buffer	4μL
		T4 DNA Ligase	1μL

(3) Transformation of E.coli DH 5. Alpha

Taking 100 mu L of competent, adding a connecting liquid, carrying out ice bath for 30min, carrying out heat shock at 42 ℃ for 90s, carrying out ice bath for 2min, adding 900 mu L of LB culture medium, incubating at 37 ℃ for 1h at 200rpm, and coating on an LB solid culture medium containing Apr;

(4) Colony PCR

Colony PCR system is shown in Table 3 below.

TABLE 3 colony PCR System (10. Mu.L)

2x Taq mix	5μL
		Primer F	0.2μL
Primer R	0.2μL
		template	Monoclonal antibodies
ddH2O	Up to 10μL

Reaction conditions: pre-denaturation at 98℃for 5min, denaturation at 98℃for 20s, annealing at 67℃for 20s, extension at 72℃for 2min,25 cycles, extension at 72℃for 5min,4 ℃;

pSET 152-I: using primer 152Pkaso-F/152vhb-R (see Table 4 below), the fragment was amplified at about 0.6kb;

pSET 152-III: using 152Psco7677-F/152SmHb-R (see Table 4 below), the amplified fragment was about 1.7kb;

(5) Enzyme digestion verification

The positive transformants were selected and cultured overnight in LB medium, plasmids were extracted according to TIGEN plasmid miniprep kit instructions, and the plasmids were verified by double digestion with XbaI and EcoRI, and the enzyme fragments were approximately 0.6kb and 1.7kb, which were confirmed to be correct.

As shown in the scheme of FIG. 1, the total synthetic plasmids PUC57-KASOP-VHB and pUC57-7677-smhb were used as templates, and Psco7677 promoter fragment (SEQ ID NO. 2), VHB gene fragment (SEQ ID NO. 3), pkasop. Sup. Th. Promoter fragment (SEQ ID NO. 5), smhb gene fragment (SEQ ID NO. 6) were obtained by PCR amplification using four sets of primers 152 Psco-7677-F/sco 7677-R, VHB-7677-F/152VHB-R, 152Pkaso-F/Kaso-R, smHb-Kaso-F/152SmHb-R in Table 4, respectively, and Psco7677 promoter fragment (SEQ ID NO. 2), VHB gene fragment (SEQ ID NO. 3) and Pkasop. Sup. Th. Promoter fragment (SEQ ID NO. 5), smhb gene fragment (SEQ ID NO. 6) were inserted into the I/XbaI site of plasmid pS152, respectively, by the above-described methods, and pSET 152-ET 152 were obtained by the one-step cloning kit.

In this example, the PCR reaction system for gene fragment preparation was as follows: 30ng of DNA template, 100pmol,Prime star Max 50 mu L of primer and adding ultrapure water to fill up to 100 mu L;

In this example, the conditions for the PCR reaction for gene fragment preparation were as follows: pre-denaturation at 98℃for 5min, denaturation at 98℃for 20s, annealing at 67℃for 20s, extension at 72℃for 0.5min,27 cycles, and complete extension at 72℃for 5min.

Table 4 design primers

Primer name	Base sequence
		152Pkaso-F	acagctatgacatgattacgaattcGGGGTCAGCACCGTTTCTGCGGACTG
152vhb-R	gcttgggctgcaggtcgactctagaTCACTCGACCGCCTGGGCGT
		152SmHb-R	gcttgggctgcaggtcgactctagaTCACTCGGCAAACAGATCGG
Kaso-R	AACTCCCCCAGTCCTGCACG
		SmHb-Kaso-F	cgtgcaggactgggggagttATGCTCACTCAGAAGACCAAGG
152Psco7677-F	acagctatgacatgattacgaattcCCGGAACCCTCCCGAAGCCGTC
		sco7677-R	GTCCGTACCTCCGTTGCTCGgc
vhb-7677-F	cgagcaacggaggtacggacATGCTGGACCAGCAGACCAT

In this example, the amplified gene fragment was purified and recovered by QIAquick PCR Purification Kit kit;

In this example, cleavage and recovery of pSET152 vector is described in the above-described construction of pSET 152-I and pSET 152-III.

In this example, ligation of vector and fragment was performed by TIANGEN single step cloning kit, the system is as shown in Table 5 below.

TABLE 5 reaction system (10. Mu.L)

In this example, specific transformation, colony PCR, plasmid extraction, and digestion verification procedures were described in the above-described construction of pSET 152-I and pSET 152-III.

In this example, it was further shown by sequencing that the desired plasmid was constructed correctly.

Example 2

In this example, the recombinant plasmid constructed in example 1 was used to construct the desired genetically engineered bacteria.

In this example, four hemoglobin integrating plasmids pSET 152-I, pSET 152-II, pSET 152-III, and pSET 152-IV obtained as described above and empty plasmid were introduced into industrial strain Streptomyces albus Y21-122 by the conjugative transfer method, and mutants having apramycin resistance, which characterize the insertion of hemoglobin genes, were selected.

In this embodiment, the specifically adopted bonding transfer method specifically operates as follows: pSET 152-I, pSET 152-II, pSET 152-III, and pSET 152-IV constructed for gene insertion were transformed into host ET12567 (containing pUZ8002 plasmid). ET12567 was taken and cultured overnight at 37 ℃ in LB medium containing three antibiotics of Amp, kan and Chl, the overnight culture was transferred once at a ratio of 10% with the same medium and cultured for 2.5 hours, and then the cells were rinsed with fresh LB solution to remove the antibiotics in the culture. Meanwhile, about 10 ¹⁰ fresh spores of industrial strain Y12-122 were prepared, after rinsing 2-3 times with TES solution, spores were suspended with 2mL of TES solution, heat-shocked at 50℃for 10min, cooled to room temperature again, and after adding an equal volume of 2X spore pre-germination medium, cultured at 37℃for 3 hours. The pre-germinated spore liquid and host bacteria ET12567 prepared before are uniformly mixed (the proportion of spores to host bacteria is about 100:1), then the mixture is coated on an ISP4 flat plate, the flat plate is transferred to a 30 ℃ incubator for positive culture for 17 hours after being dried, the flat plate is taken out, 15 mu L and 12 mu L of storage solutions of two antibiotics of the enramycin and the nalidixic acid are respectively added into 1mL of sterile water, the mixture is covered on the ISP4 flat plate after being uniformly mixed, and the flat plate is transferred to the 30 ℃ incubator for culture after being dried.

The single colony zygote was grown on the plate after 3-5 days, and the zygote was verified by mycelium PCR and resistance verification, wherein the hemoglobin gene inserted mutant was PCR verified by using primers 152Pkaso-F/152vhb-R, 152Psco7677-F/152SmHb-R, 152Pkaso-F/152SmHb-R, respectively, as designed in Table 1 above.

In this example, the PCR system for selection of the zygote and mutant for gene insertion was as follows: 10-100ng of DNA template, 30pmol,Prime star Max 15 mu L of primer and adding pure water to fill up to 30 mu L;

In this example, PCR conditions for selection of the zygote and the mutant for gene insertion were as follows: pre-denaturation at 98℃for 5min, denaturation at 98℃for 20s, annealing at 67℃for 20s, extension at 72℃for 1min,27 cycles, and complete extension at 72℃for 5min.

In this example, the colony of the insertion mutant strain was subjected to slant expansion and preservation, and a small amount of mycelium was selected for PCR identification, and the result is shown in FIG. 2, and it can be seen that the target gene was successfully inserted into the strain in this example, and the strain was named as Psco7677-smhb mutant, pkasop x-vhb mutant, psco7677-vhb mutant and Pkasop x-smhb mutant, respectively.

EXAMPLE 3 fermentation culture

In this example, the salinomycin fermentation levels of the gene insertion mutant, industrial strain Y21-122 and empty control strain (transferred into pSET152 empty vector only, without the target gene sequence) selected in example 2 were used, respectively, for detection.

In this example, the seed medium composition of the strain culture is as follows: 4wt% of glucose, 3wt% of soybean meal, 1wt% of wheat germ powder, 0.2 wt% of calcium carbonate and the balance of water.

In this example, the fermentation medium for strain culture had the following composition: 1wt% of wheat germ powder, 0.8wt% of soybean cake powder, 0.2wt% of potassium chloride, 0.1wt% of sodium chloride, 0.2wt% of urea, 0.2wt% of tartaric acid, 0.01wt% of magnesium sulfate, 0.01wt% of dipotassium hydrogen phosphate, 0.5wt% of calcium carbonate, 13wt% of soybean oil and the balance of water.

In this example, the above-mentioned gene insertion mutant strain, industrial strain Y21-122 and empty control strain were respectively taken and activated, and inoculated into the seed culture medium in an inoculum size of 10%, and seed solution culture was carried out at a rotation speed of 220rpm and a temperature of 30℃for 30 hours to obtain a seed solution. And inoculating the obtained seed solution into the fermentation culture medium according to the inoculation amount of 10%, and continuing fermentation culture for 10 days. And respectively collecting each group of fermentation liquor, and detecting the fermentation yield of salinomycin.

In this example, the fermentation yield of salinomycin was measured by HPLC, using Shimadzu LC-2030C type HPLC, using an ELSD detector (drift tube temperature: 75 ℃ C., carrier gas flow rate 1.8L/min). Chromatographic column parameters: thermo ODS, 4.6X105 mm,5 μm; the flow rate of the mobile phase is 1.0mL/min; mobile phase (v/v): a (HPLC grade acetonitrile): b (2% aqueous acetic acid) =92: 8, 8; column temperature: 30 ℃; the sample injector was 20. Mu.l.

FIG. 3 shows the results of the fermentation level detection of salinomycin of the gene insertion mutant strain, the industrial strain Y21-122 and the empty control strain. The results show that the yields of the four mutants screened by the method are improved in different degrees, wherein the yields of the mutants inserted by Psco7677-smhb genes are improved most obviously, compared with no-load control, the yields are improved by 30%, and the final yield of the laboratory shake flask fermentation salinomycin reaches 8.0g/L; in addition, pkasop x-vhb gene insert mutant yield increased by 20%, final yield reached 7.4g/L, psco7677-vhb, pkasop x-smhb gene insert mutant yield increased by 10%, final yield reached 6.8g/L.

Example 4

In this example, the above-constructed Psco7677-smhb mutant, pkasop x-vhb mutant, psco7677-vhb mutant and Pkasop x-smhb mutant were used for fermentation, respectively.

In this example, the seed medium composition of the strain culture is as follows: 3wt% of glucose, 4wt% of soybean meal, 0.5wt% of wheat germ powder, 0.3wt% of calcium carbonate and the balance of water.

In this example, the fermentation medium for strain culture had the following composition: 0.5wt% of wheat germ powder, 1wt% of soybean cake powder, 0.1wt% of potassium chloride, 0.2wt% of sodium chloride, 0.1wt% of urea, 0.3wt% of tartaric acid, 0.01wt% of magnesium sulfate, 0.02wt% of dipotassium hydrogen phosphate, 0.3wt% of calcium carbonate, 15wt% of soybean oil and the balance of water.

In this example, the above mutants were individually activated and inoculated into the seed medium at an inoculum size of 10%, followed by seed liquid culture at 220rpm and 30℃for 30 hours to obtain seed liquid. And inoculating the obtained seed solution into the fermentation culture medium according to the inoculation amount of 10%, and continuing fermentation culture for 10 days. Each group of fermentation broths was collected and tested for fermentation yield of salinomycin, and the results are shown in Table 6 below.

TABLE 6 fermentation yield results of salinomycin

Numbering device	Salinomycin yield (g/L)
		Y21-122	6.15
No-load control	6.2
		Psco7677-smhb	8
Pkasop*-vhb	7.4
		Psco7677-vhb	6.8
Pkasop*-smhb	6.81

The foregoing has outlined rather broadly the more detailed description of embodiments of the invention, wherein the principles and embodiments of the invention are explained in detail using specific examples, the above examples being provided solely to facilitate the understanding of the method and core concepts of the invention; meanwhile, as those skilled in the art will have variations in the specific embodiments and application scope in accordance with the ideas of the present invention, the present description should not be construed as limiting the present invention in view of the above.

Sequence listing

SEQ ID NO.1: sequence of fully synthesized Pkasop x-vhb gene

SEQ ID NO.2: sequence of amplified Psco7677 Gene

SEQ ID NO.3: amplified sequence of vhb Gene

SEQ ID NO.4: sequence of fully synthesized Psco7677-smhb gene

/>

SEQ ID NO.5: sequence of amplified Pkasop gene

SEQ ID NO.6: sequence of amplified smhb Gene

/>

Claims

1. A recombinant plasmid I, wherein said recombinant plasmid I comprises Pkasop x-vhb genes; the Pkasop x-vhb gene has a nucleotide sequence shown as SEQ ID NO. 1;

2. A recombinant plasmid II, which is characterized in that the recombinant plasmid II contains Psco7677 gene and vhb gene; the Psco7677 gene fragment has a nucleotide sequence shown as SEQ ID NO. 2; the vhb gene fragment has a nucleotide sequence shown as SEQ ID NO. 3;

3. A recombinant plasmid III, which is characterized in that the recombinant plasmid III contains Psco7677-smhb gene; the Psco7677-smhb gene has a nucleotide sequence shown as SEQ ID NO. 4;

Preferably, the expression vector of the recombinant plasmid III is plasmid pSET152; ;

4. A recombinant plasmid iv, wherein the recombinant plasmid iv comprises Pkasop x gene and smhb gene; the Pkasop gene fragment has a nucleotide sequence shown as SEQ ID NO. 5; the smhb gene fragment has a nucleotide sequence shown as SEQ ID NO. 6;

5. A genetically engineered bacterium comprising at least one of the recombinant plasmid i of claim 1, the recombinant plasmid ii of claim 2, the recombinant plasmid iii of claim 3, or the recombinant plasmid iv of claim 4;

Preferably, the genetic engineering is streptomyces albus;

6. A method for constructing a genetically engineered bacterium according to claim 5, comprising the step of transferring at least one of the recombinant plasmid I, the recombinant plasmid II, the recombinant plasmid III, and the recombinant plasmid IV into a recipient bacterium for homologous recombination;

Preferably, the recipient bacteria include Streptomyces albus Y21-122.

7. A method for efficiently fermenting salinomycin based on heterologous expression of hemoglobin genes, which is characterized by comprising the step of inoculating the genetically engineered bacterium of claim 5 into a proper fermentation medium for fermentation culture.

8. The method for efficient fermentation of salinomycin based on heterologous expression of hemoglobin genes according to claim 7, wherein the fermentation medium comprises the following components in mass content: 0.5 to 2 weight percent of wheat germ powder, 0.5 to 1 weight percent of soybean cake powder, 0.1 to 0.3 weight percent of potassium chloride, 0.05 to 0.2 weight percent of sodium chloride, 0.1 to 0.3 weight percent of urea, 0.1 to 0.3 weight percent of tartaric acid, 0.01 to 0.02 weight percent of magnesium sulfate, 0.01 to 0.02 weight percent of dipotassium hydrogen phosphate, 0.3 to 0.8 weight percent of calcium carbonate and 10 to 15 weight percent of soybean oil;

9. The method for efficient fermentation of salinomycin based on heterologous expression of hemoglobin gene according to claim 7 or 8, further comprising the step of inoculating the genetically engineered bacterium into a seed medium for seed liquid culture;

10. A method for efficiently fermenting salinomycin based on heterologously expressed hemoglobin genes is characterized by comprising the steps of respectively inserting a hemoglobin gene vhb derived from vitreoscilla and a hemoglobin gene smhb derived from sinorhizobium on a streptomyces albus chromosome;