CN118056900A

CN118056900A - Carboxylic acid reductase mutant and application thereof

Info

Publication number: CN118056900A
Application number: CN202211453731.2A
Authority: CN
Inventors: 咸漠; 张汝兵; 马翔宇
Original assignee: Qingdao Institute of Bioenergy and Bioprocess Technology of CAS
Current assignee: Qingdao Institute of Bioenergy and Bioprocess Technology of CAS
Priority date: 2022-11-21
Filing date: 2022-11-21
Publication date: 2024-05-21

Abstract

The invention discloses a carboxylic acid reductase mutant and application thereof, belonging to the technical fields of enzyme engineering and genetic engineering. In order to increase the catalytic activity of the carboxylic acid reductase on the short chain fatty acid 2, 4-dihydroxybutyric acid. The invention provides a carboxylic acid reductase mutant, which is obtained by taking carboxylic acid reductase with an amino acid sequence shown as SEQ ID NO.13 as a starting sequence and mutating at least one amino acid in positions 259, 284 and 511. The invention improves the activity of catalyzing 2, 4-dihydroxybutyric acid by the carboxylic acid reductase, provides a new thought for improving the transformation of the carboxylic acid reductase and further improving the catalysis of short-chain fatty acid, and realizes the cascade catalysis of the carboxylic acid reductase and the alcohol dehydrogenase for synthesizing 1,2, 4-butanetriol by the 2, 4-dihydroxybutyric acid.

Description

Carboxylic acid reductase mutant and application thereof

Technical Field

The invention belongs to the technical fields of enzyme engineering and genetic engineering, and particularly relates to a carboxylic acid reductase mutant and application thereof.

Background

The traditional chemical method for catalyzing the reduction reaction of carboxylic acid to aldehyde not only needs noble metal as a catalyst, but also has the defects of harsh reaction conditions, poor tolerance to adjacent functional groups, side reaction and the like. Carboxylate reductase (Carboxylic acid reductase, CAR, EC 1.2.1.30 and EC 1.2.1.31) is a class of multifunctional enzymes widely distributed in organisms such as bacteria, fungi, etc., which can be divided in domains into adenylation domains, thioetherification domains and reduction domains, which perform adenylation, thioetherification, interdomain transport and reduction functions. The carboxylic acid reductase has the advantages of mild reaction conditions, strong functional group specificity, wide substrate spectrum and the like, can solve the environmental protection pressure and energy problems generated by the chemical synthesis method, and obviously reduces the resource and energy consumption in the production process.

The carboxylic acid reductases of different sources have higher catalytic efficiency for aromatic acids and medium-long chain fatty acids, but have very low catalytic efficiency for short chain fatty acids (succinic acid, lactic acid, etc.), which limits their wider application to some extent. With the continuous deep understanding of the structure, function and action mechanism of the carboxylic acid reductase and the continuous development of high-throughput screening technology, the research of modifying the carboxylic acid reductase through directed evolution, semi-rational and rational design is rapidly developed. Fedorchuk and the like mutate carboxylic acid reductase from Mycobacteroides abscessus by a semi-rational design method to finally obtain two mutations of L284W and T285W, wherein compared with wild type enzyme, the mutant is increased by two times as much as (Fedorchuk TP,Khusnutdinova AN,Flick R,et al.Site-directed mutagenesis and stability of the carboxylic acid reductase MAB4714from Mycobacterium abscessus.Journal of Biotechnology,2019,303:72-79.).Qu in succinate activity, and the like, the two mutants, namely K524W and A937V, are obtained by mutating Segniliparus rugosus-source carboxylic acid reductase by MD simulation and site-directed saturation mutation, the conversion capability of benzoic acid is obviously enhanced (Qu G,Guo J,Yang D,Sun Z,et al.Biocatalysis of carboxylic acid reductases:phylogenesis,catalytic mechanism and potential applications.Green Chem,2018,20,777-792.).Wang, and the like, and saturated mutation and virtual combination mutation are carried out on Mycobacterium smegmatis-source carboxylic acid reductase 505 and 506-site to obtain optimal mutant R505I/N506K, and the catalytic activity of the mutant to benzoic acid is improved by 6.57 times (Wang L,Sun Y,Diao S,et al.Rational hinge engineering of carboxylic acid reductase from Mycobacterium smegmatis enhances its catalytic efficiency in biocatalysis.Biotechnology Journal,2022,17:210044).

In addition, the carboxylic acid reductase can be used for cascade catalysis of enzymes such as alcohol dehydrogenase and the like to generate high-added-value downstream compounds such as alcohols and the like, and can be used in the fields of additives, clean energy, fine chemical engineering, biological medicine and the like. Has important research significance and wide market application prospect. Therefore, the carboxylic acid reductase capable of efficiently converting 2, 4-dihydroxybutyric acid into 2, 4-dihydroxybutyraldehyde is screened and modified, and has important significance for biocatalysis synthesis of polyfunctional short-chain fatty aldehyde.

Disclosure of Invention

The invention aims to improve the catalytic activity of carboxylic acid reductase on short-chain fatty acid 2, 4-dihydroxybutyric acid.

The invention provides a carboxylic acid reductase mutant, which is obtained by taking carboxylic acid reductase with an amino acid sequence shown as SEQ ID NO.13 as a starting sequence and mutating at least one amino acid in positions 259, 284 and 511.

Further defined, the mutant is any one or more of the following (a) - (c):

(a) Replacement of serine 259 in the amino acid sequence shown in SEQ ID NO.13 with tryptophan;

(b) Substitution of leucine 284 of the amino acid sequence shown in SEQ ID NO.13 with tryptophan;

(c) The 511 th valine in the amino acid sequence shown in SEQ ID NO.13 is replaced by glutamic acid.

The present invention provides a gene encoding the above mutant.

The invention provides a recombinant vector carrying the coding gene.

Further defined, the starting vector of the recombinant vector is any one of pET series, duet series, pGEX series, pHY300PLK, pPIC3K or pPIC9K series.

The invention provides a recombinant microbial cell carrying the above gene or expressing the above mutant.

Further defined, the microbial cells are prokaryotic microbial cells or eukaryotic microbial cells.

The invention provides the mutant, the coding gene and the application of the recombinant vector in catalyzing 2, 4-dihydroxybutyric acid.

The invention provides a method for synthesizing 1,2, 4-butanetriol, which comprises the steps of adding the mutant and alcohol dehydrogenase into an aqueous solution of 2, 4-dihydroxybutyric acid, and reacting at 30 ℃ for at least 12 hours.

The invention provides a method for improving the catalytic activity of catalyzing 2, 4-dihydroxybutyric acid, which comprises the steps of adding the mutant into an aqueous solution of 2, 4-dihydroxybutyric acid, and reacting for at least 12 hours at 30 ℃.

The beneficial effects are that: the invention is based on the carboxylic acid reductase MabCAR from Mycobacteroides abscessus, the corresponding mutation site is designed in a semi-rational way, the molecular structure of the carboxylic acid reductase is modified by a site-directed mutagenesis technology to obtain three carboxylic acid reductase mutants MabCAR-S259W, mabCAR-L284W and MabCAR-V511E, and the activity of the three mutants is respectively improved by 50%, 30% and 240% compared with the activity of the wild type carboxylic acid reductase. The invention improves the activity of catalyzing 2, 4-dihydroxybutyric acid by the carboxylic acid reductase, provides a new thought for improving the transformation of the carboxylic acid reductase and further improving the catalysis of short-chain fatty acid, and realizes the cascade catalysis of the carboxylic acid reductase and the alcohol dehydrogenase for synthesizing 1,2, 4-butanetriol by the 2, 4-dihydroxybutyric acid.

Drawings

FIG. 1 is a diagram showing the construction of plasmid pET-28a (+) -mabCAR containing a carboxylic acid reductase MabCAR gene;

FIG. 2 is a diagram showing the structure of plasmid pACYCDuet-1-Sfp containing the Sfp gene of the carboxylic acid reductase;

FIG. 3 is a diagram showing the structure of plasmid pET-28a (+) -adhP containing the alcohol dehydrogenase AdhP gene;

FIG. 4 is a diagram showing the result of SDS-APGE electrophoresis of a purified enzyme solution of a carboxylic acid reductase and a mutant thereof, wherein WT is a purified enzyme solution of a wild-type carboxylic acid reductase MabCAR; S259W is mutant MabCAR-S259 enzyme solution; S284W is mutant MabCAR-S284 enzyme solution; V511E is mutant MabCAR-V511E enzyme solution; m is Marker;

FIG. 5 is a graph showing the relative activity of a carboxylic acid reductase and its mutant in catalyzing 2, 4-dihydroxybutyric acid, wherein the enzyme activity is 6.6X10 ^-2 U/mg, based on the wild type enzyme activity of the carboxylic acid reductase;

FIG. 6 is a GC-MS detection chart of the synthesis of 1,2, 4-butanetriol by the cascade catalysis of a carboxylic acid reductase and an alcohol dehydrogenase, wherein A is a total ion flow chromatogram of a pure enzyme cascade fermentation broth, and B is a corresponding fragment ion peak when the retention time is 9.92 min.

Detailed Description

The invention is further illustrated by the following specific examples. The present invention is not limited to the following examples.

The experimental methods used in the following examples are conventional methods unless otherwise specified.

Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.

The enzyme reagent used was purchased from Semerle Feishi technologies (China) Co., ltd., the kit used for extracting plasmids and the kit used for recovering DNA fragments were purchased from OMEGA Co., USA, and the kit used for enzyme mutation was purchased from Nanjinopran biotechnology Co., ltd. The corresponding operation steps are carried out according to the product specifications; all media were formulated with deionized water unless otherwise indicated.

1) The formula of the culture medium comprises:

LB Medium: 5g/L yeast extract, 10g/L tryptone, 10g/L NaCl, and the balance water, wherein 18g/L agarose is added for preparing LB solid medium, and sterilization is performed at 121 ℃ for 20 min.

During the actual culture, antibiotics may be added to the above medium at a concentration to maintain the stability of the plasmid, such as 34. Mu.g/mL chloramphenicol and 30. Mu.g/mL kanamycin.

2) Imidazole buffer solution

0MM imidazole buffer: 20mM Tris-HCl,300mM NaCl,pH 7.5;

500mM imidazole buffer: 20mM Tris-HCl,300mM NaCl,500mM imidazole, pH 7.5; the imidazole buffer solution with other concentration is obtained by mixing 0mM and 500mM imidazole buffer solution according to a proportion.

3) The formulation of 0.01M phosphate buffer (ph=7.5) is as follows: 8g/L NaCl,0.2g/L KCl,1.44g/L Na ₂HPO₄ and 0.24g/L KH ₂PO₄.

4) The formulation of 0.05mM Tris-HCl buffer (pH=7.5) was as follows: 6g/L Tris-base, HCl was added to adjust to 7.5.

Example 1: construction of recombinant bacterium containing Gene sequence of Carboxylic acid reductase MabCAR and Gene sequence of alcohol dehydrogenase AdhP

1) Construction of vector pET-28a (+) -mabCAR

In the example, a gene mabCAR (GenBank protein accession number is CAM 64782.1) is obtained by PCR amplification (primers: 5'-ccaattgagatctgccatatgATGACCGAAACCATTAGCACCG-3' (SEQ ID NO. 1) and 5'-tcatcaccacagccaggatccTTACACCAGGCCCAGCAGC-3' (SEQ ID NO. 2)), and a target fragment is recovered by using a gel recovery kit, wherein the target fragment has a size of 3537bp, and the obtained fragment is a gene mabCAR fragment.

Plasmid pET-28a (+) was digested with NdeI and BamH I, the plasmid digested product was recovered, plasmid vector pET-28a (+) and mabCAR gene fragment were ligated in a molar ratio of 1:3 using a rapid cloning kit from Nanjinouzan Biotechnology Co., ltd, the ligation product transformed E.coli DH 5. Alpha. Competent cells, and then plated on LB solid plates containing 30. Mu.g/mL kanamycin, and positive clones were PCR screened. The recombinant plasmid pET-28a (+) -mabCAR is extracted from the positive clone and then is identified by enzyme digestion and sequencing. The construction of vector pET-28a (+) -mabCAR is shown in FIG. 1.

2) Construction of vector pACYCDuet-1-sfp

The thiolation domain of the carboxylate reductase requires post-transcriptional modification, i.e., covalent attachment of the phosphopantetheine group to a conserved serine under the catalysis of an ancillary phosphopantetheine transferase (phosphopantetheinyl transferase, PPTase), which in turn achieves maximum catalytic activity of the holoenzyme.

In the example, gene sfp (GenBank protein accession number is AOR 96727.1) is obtained by PCR amplification (primers: 5'-taataaggagatataccatggCCAAAATTTATGGCATTTATATGGA-3' (SEQ ID NO. 3) and 5'-gcattatgcggccgcaagcttTTACAGCAGTTCTTCATAGCTCACAA-3' (SEQ ID NO. 4)), and then a target fragment is recovered by using a gel recovery kit, wherein the size of the target fragment is 678bp, and the obtained fragment is the gene sfp fragment.

Plasmid pACYCDuet-1 was digested with NcoI and HindII, the plasmid digested product was recovered, plasmid vector pACYCDuet-1 and sfp gene fragment were ligated in a molar ratio of 1:3 using a rapid cloning kit from Nanjinouzan Biotechnology Co., ltd., and the ligation product transformed E.coli DH 5. Alpha. Competent cells, which were then plated on LB solid plates containing 34. Mu.g/mL chloramphenicol, and positive clones were screened by PCR. Recombinant plasmid pACYCDuet-1-sfp was extracted from the positive clone and then identified by digestion and sequencing. The construction of vector pACYCDuet-1-sfp is shown in FIG. 2.

3) Construction of vector pET-28a (+) -adhP

In the example, the gene adhP (GenBank protein accession number is AAG 56291.1) is obtained by PCR amplification (primers: 5'-cagcaaatgggtcgcggatccATGAAGGCTGCAGTTGTTACGA-3' (SEQ ID NO. 5) and 5'-ttgtcgacggagctcgaattcTTAACGGCGGAAATCAATCAC-3' (SEQ ID NO. 6)), and then a target fragment is recovered by using a gel recovery kit, wherein the size of the target fragment is 1011bp, and the obtained fragment is the gene adhP fragment.

Plasmid pET-28a (+) is digested with BamH I and EcoR I, the plasmid digestion product is recovered, plasmid vector pET-28a (+) and adhP gene fragment are connected according to the mol ratio of 1:3 by using a rapid cloning kit of Nanjinouzan biotechnology Co., ltd, the connection product is transformed into E.coli DH5 alpha competent cells, and then the plasmid is coated on LB solid plate containing 30 mug/mL kanamycin, and positive clones are screened by PCR. The recombinant plasmid pET-28a (+) -adhP is extracted from the positive clone and then is identified by enzyme digestion and sequencing. The construction of vector pET-28a (+) -adhP is shown in FIG. 3.

4) Transformation

Two recombinant plasmids pET-28a (+) -mabCAR and pACYCDuet-1-sfp were transformed into competent cells of E.coli BL21 (DE 3) to obtain E.coli BL21 (DE 3)/pET-28 a (+) -mabCAR/pACYCDuet-1-sfp (thiolated modified), and the transformed cells were plated on LB plates containing 34. Mu.g/mL chloramphenicol and 30. Mu.g/mL kanamycin for culture at 37 ℃. Recombinant plasmid pET-28a (+) -adhP was transformed into competent cells of E.coli BL21 (DE 3), and the transformed cells were plated on LB plates containing 0. Mu.g/mL kanamycin for culture at 37 ℃. Obtaining recombinant genetic engineering bacteria E.coli BL21 (DE 3)/pET-28 a (+) -mabCAR/pACYCDuet-1-sfp/pET-28a (+) -adhP containing recombinant plasmids.

Example 2: recombinant plasmid containing carboxylic acid reductase mutant gene and recombinant bacterium construction

The recombinant strain (E.coli BL21 (DE 3)/pET-28 a (+) -mabCAR/pACYCDuet-1-sfp) in the example 1 is taken as an original strain, the carboxylic acid reductase is semi-rationally designed, and the catalytic activity of the carboxylic acid reductase on the substrate 2, 4-dihydroxybutyric acid is improved by reducing the active center cavity and the substrate inlet and outlet channels of the carboxylic acid reductase.

The following sites were selected: 259, 284 and 511.

The mutation was performed using site-directed single mutation kit from the biosciences of Nanjinopran, inc., and the primers were designed as follows:

Ser(S)259Trp(W)：

Upstream primer 1:5'-ATCTATACGtggGGCAGCACCGGCACCCCGAA-3' (SEQ ID NO. 7);

Downstream primer 3:5'-CTGCCccaCGTATAGATCAGCAGGCGCAGCGC-3' (SEQ ID NO. 8);

Leu(L)284Trp(W)：

upstream primer 1:5'-AATGGtgGACCGATGATGTGATTCCGAGCATTG-3' (SEQ ID NO. 9);

Downstream primer 3:5'-CATCATCGGTCcaCCATTTTTTCTGCCACAGGTTC-3' (SEQ ID NO. 10);

Val(V)511Glu(E)：

Upstream primer 1:5'-GGATCGCgaaAAAAACGTGCTGAAACTGGCGC-3' (SEQ ID NO. 11);

Downstream primer 3:5'-CGTTTTTttcGCGATCCAGATATTTCAGATGATCC-3' (SEQ ID NO. 12); the mutation sites are underlined.

The mutation was introduced by PCR using a plasmid DNA containing mabCAR gene as a template, and the PCR reaction procedure was as follows: 3min at 95 ℃; repeating 30 cycles at 95℃for 15s,60℃for 15s, and 72℃for 7 min; the extension was continued for 5min at 72 ℃. The PCR product was digested with Dpn I enzyme at 37℃for 2 hours and ligated using homologous arm recombinases. Recombination to obtain pET-28a (+) -mabCAR mutant plasmids, the three mutant plasmids are respectively: pET-28a (+) -mabCAR-Ser (S) 259Trp (W) mutant plasmid, pET-28a (+) -mabCAR-Leu (L) 284Trp (W) mutant plasmid and pET-28a (+) -mabCAR-Val (V) 511Glu (E) mutant plasmid.

The ligation product was transformed into E.coli DH 5. Alpha. Competent cells, which were then plated on LB solid plates containing 30. Mu.g/mL kanamycin, and positive clones were PCR-screened. The recombinant plasmid of pET-28a (+) -mabCAR mutant is extracted from positive clone, and then is identified by enzyme digestion and sequencing.

Three pET-28a (+) -mabCAR mutant recombinant plasmids with correct sequence are respectively transformed into escherichia coli BL21 (DE 3) receptor bacteria together with pACYCDuet-1-sfp, coated on LB solid plates of kanamycin and chloramphenicol, cultured for 12 hours at 37 ℃ to obtain recombinant strains expressing carboxylic acid reductase mutants (E.coli BL21(DE3)/pET-28a(+)-mabCAR-S259W/pACYCDuet-1-sfp,E.coli BL21(DE3)/pET-28a(+)-mabCAR-L284W/pACYCDuet-1-sfp、E.coli BL21(DE3)/pET-28a(+)-mabCAR-V511E/pACYCDuet-1-sfp).

Example 3: expression and purification of carboxylic acid reductases and alcohol dehydrogenases

1) Carboxylic acid reductase MabCAR purification:

Obtaining recombinant bacteria of over-expression carboxylic acid reductase and mutant thereof: recombinant E.coli (recombinant E.coli BL21 (DE 3)/pET-28 a (+) -mabCAR/pACYCDuet-1-sfp) containing the recombinant carboxylic acid reductase wild-type (E.coli BL21 (DE 3)/pET-28 a (+) -mabCAR (WT, S259W, L284W, V E)/pACYCDuet-1-sfp) obtained in example 1,2 was inoculated into LB liquid medium containing chloramphenicol at a final concentration of 34. Mu.g/mL and kanamycin resistance of 30. Mu.g/mL, cultured at 37℃at 200rpm, then inoculated into fresh LB liquid medium containing chloramphenicol at a final concentration of 34. Mu.g/mL and kanamycin resistance of 30. Mu.g/mL at 1% (v/v), cultured at 37℃at 200rpm until cell OD ₆₀₀ reaches 0.6-0.8, and after induction at 26℃for 20 hours, centrifugation at 4℃at 8000rpm was carried out, the supernatant was discarded, and the two supernatant-time washed with PBS solution of recombinant carboxylic acid was obtained, and the recombinant carboxylic acid-containing recombinant was washed. The thallus can be directly used as a biocatalyst or used for protein purification. Recombinant E.coli cells containing mutants expressing carboxylic acid reductase were prepared in the same manner.

Carboxylic acid reductase MabCAR purification: and adding a proper amount of PBS solution into the wet thalli, so that the OD ₆₀₀ =20 of the resuspended thalli is crushed by using a high-pressure cell crusher, wherein the pressure is 34.7kpsi, and the crushed thalli is crushed once to obtain a crude enzyme solution of the carboxylic acid reductase. The obtained crude enzyme solution of the carboxylic acid reductase is centrifuged for 30min at 12000rpm at 4 ℃ to obtain a crude enzyme solution supernatant, impurities are removed by 0.22 mu m membrane filtration, 1mL of the crude enzyme solution after membrane filtration is used for SDS-PAGE electrophoresis, the rest crude enzyme solution is purified by adopting an affinity medium to fill a chromatographic nickel column (HISTRAP HP mL), a 20mM imidazole buffer solution with 5 times of column volume is adopted to balance the nickel column before loading, the mixed protein is eluted by 50mM imidazole buffer solution after loading, the target protein is eluted by 100mM imidazole buffer solution, and the solution collected in a centrifuge tube after elution is subjected to ultrafiltration tube ultrafiltration to obtain the pure enzyme solution. The purified enzyme solution was heated in a water bath at 100℃for 10min with a volume ratio of 5 Xprotein loading buffer solution of 4:1, and after inactivation, protein verification was performed by SDS-PAGE, and the verification results are shown in FIG. 4. Wild-type ones of MabCAR-S259W, mabCAR-L284W and MabCAR-V511E mutant carboxylate reductases MabCAR and MabCAR were obtained.

2) Alcohol dehydrogenase AdhP purification

Obtaining recombinant bacteria over-expressing alcohol dehydrogenase: recombinant E.coli (recombinant E.coli BL21 (DE 3)/pET-28 a (+) -adhP) containing the gene expressing alcohol dehydrogenase obtained in example 1 was inoculated into LB liquid medium containing 30. Mu.g/mL kanamycin resistance at a final concentration, cultured at 37℃for 8 hours at 200rpm, then inoculated into fresh LB liquid medium containing 30. Mu.g/mL kanamycin resistance at a final concentration of 1% of inoculum size (v/v), cultured at 37℃at 200rpm until the cell OD ₆₀₀ reached 0.6-0.8, added with IPTG at a final concentration of 0.5mM, induced at 16℃for 20 hours, centrifuged at 4℃for 10 minutes at 8000rpm, the supernatant was discarded, washed twice with PBS solution in equal volume, and the supernatant was discarded to obtain recombinant E.coli wet cell containing the gene expressing alcohol dehydrogenase. The thallus can be directly used as a biocatalyst or used for protein purification.

And adding a proper amount of PBS solution into the wet thalli, so that the OD ₆₀₀ =20 of the resuspension bacterial liquid, carrying out cell disruption by using a high-pressure cell disruption instrument, and obtaining an alcohol dehydrogenase crude enzyme liquid after the disruption, wherein the pressure is 34.7 kpsi. The obtained alcohol dehydrogenase crude enzyme solution is centrifuged for 30min at 12000rpm at 4 ℃ to obtain crude enzyme solution supernatant, impurities are removed by 0.22 mu m membrane filtration, 1mL of crude enzyme solution after membrane filtration is used for SDS-PAGE electrophoresis, the rest crude enzyme solution is purified by adopting an affinity medium to fill a chromatographic nickel column (HISTRAP HP mL), a 20mM imidazole buffer solution with 5 times of column volume is adopted to balance the nickel column before loading, the impurity protein is eluted by 40mM imidazole buffer solution after loading, the target protein is eluted by 250mM imidazole buffer solution, and the solution collected in a centrifuge tube after elution is subjected to ultrafiltration tube ultrafiltration to obtain pure enzyme solution. The purified enzyme solution was heated in a water bath at 100℃for 10min with a volume ratio of 5 Xprotein loading buffer solution of 4:1, and after inactivation, protein verification was performed by SDS-PAGE, and the verification results are shown in FIG. 4. Obtaining alcohol dehydrogenase.

Example 4: study of enzymatic Properties of Carboxylic acid reductase MabCAR and mutants thereof

1) The pure enzyme solution of wild-type carboxylate reductase obtained in example 3 was subjected to an enzymatic property study.

Protein concentration was determined by Bradford microanalysis. The enzyme activity was measured using an ultraviolet spectrophotometer. The enzyme activity of the carboxylic acid reductase was measured using 200. Mu.L of a reaction system containing 50mM Tris-HCl (pH=7.5), 10mM 2, 4-dihydroxybutyric acid, 10mM MgCl ₂, 300mM NaCl,2mM ATP,0.4mM NADPH,20. Mu.g enzyme, at a wavelength of 340nm, once every 20s for 20min, and a blank control without enzyme.

One enzyme activity unit the enzyme activity unit (U) is defined as the amount of enzyme required to consume l. Mu. Mol NADPH per minute at 30 ℃. Detecting absorbance values of NADPH at 340nm at different concentrations, and obtaining the carboxylic acid reductase catalytic rate in unit time through absorbance change at 340nm for a certain time:

V＝ΔC/ΔT

wherein: v is the reaction rate; delta C is the change in NADPH concentration over time; Δt is the reaction time.

A carboxylic acid reductase enzyme kinetic profile was made at different 2, 4-dihydroxybutyric acid concentrations.

TABLE 1 enzymatic Properties of Carboxylic acid reductase MabCAR

Substrate(s)	Km，mM	Kcat，s^-1	kcat/Km，M^-1s^-1
				2, 4-Dihydroxybutyric acid	91.15±44.33	0.20±0.09	2.2×10¹

The enzymatic properties of the purified enzyme are shown in Table 1, and the results of the assay are shown in Table 1, where the carboxylic acid reductase purified enzyme Km=91.15 mM and Vmax= 0.1540. Mu.M/s, and kcat=Vmax/[ Et ] =0.2 (s ^-1). The specific enzyme activity is 6.6X10 ^-2 U/mg.

2) Relative enzyme activity detection of carboxylic acid reductase mutant

The enzyme activity of the different mutants was examined, and the enzyme activity mutation effect was examined by comparing the specific enzyme activities of the different mutants, and it was found that MabCAR-S259W, mabCAR-L284W and MabCAR-V511E were improved by 50%, 30% and 240% respectively compared with the wild type of MabCAR, as shown in FIG. 5.

Example 5: application of carboxylic acid reductase MabCAR in preparation of 1,2, 4-butanetriol

1) Pure enzyme cascade catalytic reaction

The wild-type and mutant carboxylic acid reductases obtained in example 3 are respectively in enzymatic cascade with alcohol dehydrogenase-pure enzyme to catalyze 2, 4-dihydroxybutyric acid;

The specific reaction system is constructed as follows: 1ml of a reaction system (pH=7.5) containing 50mM Tris-HCl buffer, 10mM MgCl2,5mM NADPH,5mM NADH,10mM ATP,10mM DHB,200. Mu.g of carboxylic acid reductase MabCAR (wild-type or mutant carboxylic acid reductase), 300. Mu.g of alcohol dehydrogenase AdhP. The reaction was carried out at 30℃and 200rpm for 12 hours, and the reaction mixture was used for detecting the product. The control group was without adding carboxylic acid reductase. The experiment was repeated three times. And taking a reaction liquid for detecting a product. The results of the product gas detection are shown in FIG. 6.

2) Detection of the product 1,2, 4-butanetriol

After the pure enzyme catalytic reaction is finished, 500 mu L of reaction solution is taken, the reaction solution is heated in a water bath kettle at 100 ℃ for 5min to inactivate enzymes, supernatant is centrifugally taken, after vacuum centrifugal drying, 40 mu L of Dimethylformamide (DMF) is added for suspension, 80 mu L of 'N, O-bis (trimethylsilyl) trifluoroacetamide BSTFA (the volume percentage is 99%) +trimethylchlorosilane (the volume percentage is 1%)' silylating reagent is added, and the mixture is placed for 30min at 70 ℃ after uniform mixing. Centrifuging for 5min, collecting supernatant, filtering with 0.22 μm filter membrane, and detecting filtrate by gas chromatography-mass spectrometry. 2, 4-dihydroxybutyric acid and1, 2, 4-butanetriol standard with the concentration of 10mM are prepared by taking N, N-dimethylformamide DMF as a solvent, and silanization treatment is carried out in the same method after adding a silanization reagent.

Gas chromatography mass spectrometry conditions: rtx-5SIL column (column length is 30 m), no split ratio is set, sample injection amount is 1 mu L, and mass-to-charge ratio range is 30-500 m/z. The sample inlet temperature was set at 280 ℃. Helium was used as a carrier gas, and the flow rate was set to 1.0mL/min. The gas temperature raising program is set as follows: maintaining at 80deg.C for 1.5min, heating to 140deg.C at 10deg.C/min, and maintaining for 3min; heating to 280 ℃ at a speed of 50 ℃/min, and keeping for 12min.

The result is: according to detection, the yield of 1,2, 4-butanetriol produced by the cascade of wild-type carboxylic acid reductase and alcohol dehydrogenase is 56mg/L, and the yields of mutants MabCAR-S259W, mabCAR-L284W and MabCAR-V511E and alcohol dehydrogenase are 103mg/L, 78mg/L and 194mg/L respectively.

The foregoing description is only illustrative of the present invention and is not intended to limit the scope of the invention, and all equivalent structures or equivalent processes or direct or indirect application in other related arts are included in the scope of the present invention.

(1) MabCAR amino acid sequence 1178 amino acids, (SEQ ID NO. 13), wild-type carboxylate reductase ：MTETISTAAVPTTDLEEQVKRRIEQVVSNDPQLAALLPEDSVTEAVNEPDLPLVEVIRRLLEGYGDRPALGQRAFEFVTGDDGATVIALKPEYTTVSYRELWERAEAIAAAWHEQGIRDGDFVAQLGFTSTDFASLDVAGLRLGTVSVPLQTGASLQQRNAILEETRPAVFAASIEYLDAAVDSVLATPSVRLLSVFDYHAEVDSQREALEAVRARLESAGRTIVVEALAEALARGRDLPAAPLPSADPDALRLLIYTSGSTGTPKGAMYPQWLVANLWQKKWLTDDVIPSIGVNFMPMSHLAGRLTLMGTLSGGGTAYYIASSDLSTFFEDIALIRPSEVLFVPRVVEMVFQRFQAELDRSLAPGESNSEIAERIKVRIREQDFGGRVLSAGSGSAPLSPEMTEFMESLLQVPLRDGYGSTEAGGVWRDGVLQRPPVTDYKLVDVPELGYFTTDSPHPRGELRLKSETMFPGYYKRPETTADVFDDEGYYKTGDVVAELGPDHLKYLDRVKNVLKLAQGEFVAVSKLEAAYTGSPLVRQIFVYGNSERSFLLAVVVPTPEVLERYADSPDALKPLIQDSLQQVAKDAELQSYEIPRDFIVETVPFTVESGLLSDARKLLRPKLKDHYGERLEALYAELAESQNERLRQLAREAATRPVLETVTDAAAALLGASSSDLAPDVRFIDLGGDSLSALSYSELLRDIFEVDVPVGVINSVANDLAAIARHIEAQRTGAATQPTFASVHGKDATVITAGELTLDKFLDESLLKAAKDVQPATADVKTVLVTGGNGWLGRWLVLDWLERLAPNGGKVYALIRGADAEAARARLDAVYESGDPKLSAHYRQLAQQSLEVIAGDFGDQDLGLSQEVWQKLAKDVDLIVHSGALVNHVLPYSQLFGPNVAGTAEIIKLAISERLKPVTYLSTVGIADQIPVTEFEEDSDVRVMSAERQINDGYANGYGNSKWAGEVLLREAHDLAGLPVRVFRSDMILAHSDYHGQLNVTDVFTRSIQSLLLTGVAPASFYELDADGNRQRAHYDGVPGDFTAASITAIGGVNVVDGYRSFDVFNPHHDGVSMDTFVDWLIDAGYKIARIDDYDQWLARFELALKGLPEQQRQQSVLPLLKMYEKPQPAIDGSALPTAEFSRAVHEAKVGDSGEIPHVTKELILKYASDIQLLGLV;

(2) Mutant carboxylic acid reductase MabCAR-S259W (SEQ ID NO. 14):

MTETISTAAVPTTDLEEQVKRRIEQVVSNDPQLAALLPEDSVTEAVNEPDLPLVEVIRRLLEGYGDRPALGQRAFEFVTGDDGATVIALKPEYTTVSYRELWERAEAIAAAWHEQGIRDGDFVAQLGFTSTDFASLDVAGLRLGTVSVPLQTGASLQQRNAILEETRPAVFAASIEYLDAAVDSVLATPSVRLLSVFDYHAEVDSQREALEAVRARLESAGRTIVVEALAEALARGRDLPAAPLPSADPDALRLLIYTWGSTGTPKGAMYPQWLVANLWQKKWLTDDVIPSIGVNFMPMSHLAGRLTLMGTLSGGGTAYYIASSDLSTFFEDIALIRPSEVLFVPRVVEMVFQRFQAELDRSLAPGESNSEIAERIKVRIREQDFGGRVLSAGSGSAPLSPEMTEFMESLLQVPLRDGYGSTEAGGVWRDGVLQRPPVTDYKLVDVPELGYFTTDSPHPRGELRLKSETMFPGYYKRPETTADVFDDEGYYKTGDVVAELGPDHLKYLDRVKNVLKLAQGEFVAVSKLEAAYTGSPLVRQIFVYGNSERSFLLAVVVPTPEVLERYADSPDALKPLIQDSLQQVAKDAELQSYEIPRDFIVETVPFTVESGLLSDARKLLRPKLKDHYGERLEALYAELAESQNERLRQLAREAATRPVLETVTDAAAALLGASSSDLAPDVRFIDLGGDSLSALSYSELLRDIFEVDVPVGVINSVANDLAAIARHIEAQRTGAATQPTFASVHGKDATVITAGELTLDKFLDESLLKAAKDVQPATADVKTVLVTGGNGWLGRWLVLDWLERLAPNGGKVYALIRGADAEAARARLDAVYESGDPKLSAHYRQLAQQSLEVIAGDFGDQDLGLSQEVWQKLAKDVDLIVHSGALVNHVLPYSQLFGPNVAGTAEIIKLAISERLKPVTYLSTVGIADQIPVTEFEEDSDVRVMSAERQINDGYANGYGNSKWAGEVLLREAHDLAGLPVRVFRSDMILAHSDYHGQLNVTDVFTRSIQSLLLTGVAPASFYELDADGNRQRAHYDGVPGDFTAASITAIGGVNVVDGYRSFDVFNPHHDGVSMDTFVDWLIDAGYKIARIDDYDQWLARFELALKGLPEQQRQQSVLPLLKMYEKPQPAIDGSALPTAEFSRAVHEAKVGDSGEIPHVTKELILKYASDIQLLGLV;

(3) Mutant carboxylic acid reductase MabCAR-L284W (SEQ ID NO. 15):

MTETISTAAVPTTDLEEQVKRRIEQVVSNDPQLAALLPEDSVTEAVNEPDLPLVEVIRRLLEGYGDRPALGQRAFEFVTGDDGATVIALKPEYTTVSYRELWERAEAIAAAWHEQGIRDGDFVAQLGFTSTDFASLDVAGLRLGTVSVPLQTGASLQQRNAILEETRPAVFAASIEYLDAAVDSVLATPSVRLLSVFDYHAEVDSQREALEAVRARLESAGRTIVVEALAEALARGRDLPAAPLPSADPDALRLLIYTSGSTGTPKGAMYPQWLVANLWQKKWWTDDVIPSIGVNFMPMSHLAGRLTLMGTLSGGGTAYYIASSDLSTFFEDIALIRPSEVLFVPRVVEMVFQRFQAELDRSLAPGESNSEIAERIKVRIREQDFGGRVLSAGSGSAPLSPEMTEFMESLLQVPLRDGYGSTEAGGVWRDGVLQRPPVTDYKLVDVPELGYFTTDSPHPRGELRLKSETMFPGYYKRPETTADVFDDEGYYKTGDVVAELGPDHLKYLDRVKNVLKLAQGEFVAVSKLEAAYTGSPLVRQIFVYGNSERSFLLAVVVPTPEVLERYADSPDALKPLIQDSLQQVAKDAELQSYEIPRDFIVETVPFTVESGLLSDARKLLRPKLKDHYGERLEALYAELAESQNERLRQLAREAATRPVLETVTDAAAALLGASSSDLAPDVRFIDLGGDSLSALSYSELLRDIFEVDVPVGVINSVANDLAAIARHIEAQRTGAATQPTFASVHGKDATVITAGELTLDKFLDESLLKAAKDVQPATADVKTVLVTGGNGWLGRWLVLDWLERLAPNGGKVYALIRGADAEAARARLDAVYESGDPKLSAHYRQLAQQSLEVIAGDFGDQDLGLSQEVWQKLAKDVDLIVHSGALVNHVLPYSQLFGPNVAGTAEIIKLAISERLKPVTYLSTVGIADQIPVTEFEEDSDVRVMSAERQINDGYANGYGNSKWAGEVLLREAHDLAGLPVRVFRSDMILAHSDYHGQLNVTDVFTRSIQSLLLTGVAPASFYELDADGNRQRAHYDGVPGDFTAASITAIGGVNVVDGYRSFDVFNPHHDGVSMDTFVDWLIDAGYKIARIDDYDQWLARFELALKGLPEQQRQQSVLPLLKMYEKPQPAIDGSALPTAEFSRAVHEAKVGDSGEIPHVTKELILKYASDIQLLGLV

(4) Mutant carboxylic acid reductase MabCAR-V511E (SEQ ID NO. 16):

MTETISTAAVPTTDLEEQVKRRIEQVVSNDPQLAALLPEDSVTEAVNEPDLPLVEVIRRLLEGYGDRPALGQRAFEFVTGDDGATVIALKPEYTTVSYRELWERAEAIAAAWHEQGIRDGDFVAQLGFTSTDFASLDVAGLRLGTVSVPLQTGASLQQRNAILEETRPAVFAASIEYLDAAVDSVLATPSVRLLSVFDYHAEVDSQREALEAVRARLESAGRTIVVEALAEALARGRDLPAAPLPSADPDALRLLIYTSGSTGTPKGAMYPQWLVANLWQKKWLTDDVIPSIGVNFMPMSHLAGRLTLMGTLSGGGTAYYIASSDLSTFFEDIALIRPSEVLFVPRVVEMVFQRFQAELDRSLAPGESNSEIAERIKVRIREQDFGGRVLSAGSGSAPLSPEMTEFMESLLQVPLRDGYGSTEAGGVWRDGVLQRPPVTDYKLVDVPELGYFTTDSPHPRGELRLKSETMFPGYYKRPETTADVFDDEGYYKTGDVVAELGPDHLKYLDREKNVLKLAQGEFVAVSKLEAAYTGSPLVRQIFVYGNSERSFLLAVVVPTPEVLERYADSPDALKPLIQDSLQQVAKDAELQSYEIPRDFIVETVPFTVESGLLSDARKLLRPKLKDHYGERLEALYAELAESQNERLRQLAREAATRPVLETVTDAAAALLGASSSDLAPDVRFIDLGGDSLSALSYSELLRDIFEVDVPVGVINSVANDLAAIARHIEAQRTGAATQPTFASVHGKDATVITAGELTLDKFLDESLLKAAKDVQPATADVKTVLVTGGNGWLGRWLVLDWLERLAPNGGKVYALIRGADAEAARARLDAVYESGDPKLSAHYRQLAQQSLEVIAGDFGDQDLGLSQEVWQKLAKDVDLIVHSGALVNHVLPYSQLFGPNVAGTAEIIKLAISERLKPVTYLSTVGIADQIPVTEFEEDSDVRVMSAERQINDGYANGYGNSKWAGEVLLREAHDLAGLPVRVFRSDMILAHSDYHGQLNVTDVFTRSIQSLLLTGVAPASFYELDADGNRQRAHYDGVPGDFTAASITAIGGVNVVDGYRSFDVFNPHHDGVSMDTFVDWLIDAGYKIARIDDYDQWLARFELALKGLPEQQRQQSVLPLLKMYEKPQPAIDGSALPTAEFSRAVHEAKVGDSGEIPHVTKELILKYASDIQLLGLV.

① MabCAR wild-type coding gene 3537bp (SEQ ID NO. 17):

ATGACCGAAACCATTAGCACCGCGGCGGTGCCGACCACCGATCTGGAAGAACAAGTGAAACGCCGCATTGAACAAGTGGTGAGCAACGATCCGCAGCTGGCGGCGCTGCTGCCGGAAGATAGCGTGACCGAAGCGGTGAACGAACCGGATCTGCCGCTGGTGGAAGTGATTCGCCGCCTGCTGGAAGGCTATGGCGATCGCCCGGCGCTGGGTCAGCGCGCGTTTGAATTTGTGACCGGCGATGATGGCGCGACCGTGATTGCGCTGAAACCGGAATACACCACCGTGAGCTATCGCGAACTGTGGGAACGCGCGGAAGCGATTGCGGCCGCGTGGCATGAACAAGGCATTCGCGATGGCGATTTTGTGGCGCAGCTGGGCTTTACGAGCACCGATTTTGCGAGCCTGGATGTGGCCGGCCTGCGCCTGGGTACGGTTAGCGTGCCACTGCAGACCGGCGCGAGCCTGCAGCAGCGCAACGCGATTCTGGAAGAAACCCGCCCGGCGGTGTTTGCGGCGAGCATTGAATATCTGGATGCGGCGGTGGATAGCGTGCTGGCGACCCCGAGCGTGCGCTTACTGAGCGTGTTTGATTATCATGCGGAAGTGGACAGTCAGCGCGAAGCCTTAGAAGCGGTTCGTGCGCGCCTGGAAAGCGCGGGTCGTACCATTGTGGTGGAGGCGTTAGCCGAGGCGTTAGCCCGTGGCCGCGATTTACCGGCGGCGCCACTGCCAAGCGCCGATCCGGATGCGCTGCGCCTGCTGATCTATACGAGCGGCAGCACCGGCACCCCGAAAGGCGCGATGTATCCGCAGTGGCTGGTGGCGAACCTGTGGCAGAAAAAATGGCTGACCGATGATGTGATTCCGAGCATTGGCGTGAACTTTATGCCGATGAGCCATCTGGCGGGCCGCCTGACCCTGATGGGCACCCTGAGCGGCGGTGGCACCGCGTATTATATTGCGAGCAGCGATTTAAGCACCTTTTTTGAAGATATTGCGTTAATTCGCCCGAGCGAAGTGCTGTTTGTGCCGCGCGTGGTGGAAATGGTGTTTCAGCGCTTTCAAGCGGAACTGGATCGCAGCCTGGCGCCGGGCGAAAGCAACAGCGAAATTGCGGAACGCATTAAAGTGCGCATTCGCGAACAAGATTTTGGCGGCCGCGTGCTGAGCGCGGGCAGCGGCAGCGCGCCGCTGAGCCCGGAAATGACCGAATTTATGGAAAGCCTGCTGCAAGTGCCGCTGCGCGATGGCTATGGTAGCACCGAAGCGGGCGGCGTGTGGCGCGATGGCGTGCTGCAGCGCCCGCCGGTGACCGATTATAAACTGGTGGATGTTCCGGAACTGGGCTATTTTACCACCGATAGCCCGCATCCGCGCGGCGAACTGCGCCTGAAAAGCGAAACCATGTTTCCGGGCTATTATAAACGCCCGGAAACCACCGCGGATGTTTTTGACGATGAAGGCTATTATAAGACCGGCGATGTGGTGGCGGAACTGGGCCCGGATCATCTGAAATATCTGGATCGCGTGAAAAACGTGCTGAAACTGGCGCAAGGCGAATTTGTGGCGGTGAGCAAACTGGAAGCGGCGTATACCGGCAGCCCGCTGGTGCGTCAGATTTTTGTGTATGGCAATAGCGAACGCAGCTTTCTGCTGGCGGTGGTTGTGCCGACCCCGGAAGTGCTGGAACGCTATGCGGATAGCCCGGATGCGTTAAAACCGCTGATTCAAGATAGCCTGCAACAAGTGGCGAAAGATGCGGAACTGCAGAGCTATGAAATTCCGCGCGATTTTATTGTGGAAACCGTGCCGTTTACCGTGGAAAGCGGCCTGCTGAGCGATGCGCGCAAACTGCTGCGCCCGAAACTGAAAGATCATTATGGCGAACGCCTGGAAGCGCTGTATGCGGAACTGGCGGAAAGCCAAAATGAACGCCTGCGTCAGTTAGCGCGTGAAGCCGCGACGCGTCCGGTGCTGGAAACGGTTACGGATGCCGCGGCCGCGTTACTGGGTGCGAGCAGCAGTGATCTGGCGCCGGATGTGCGCTTTATTGATCTGGGCGGCGATAGCCTGAGCGCGCTGAGCTATAGCGAACTGCTGCGCGATATTTTTGAAGTGGACGTGCCGGTTGGCGTGATTAACAGCGTGGCGAACGATCTGGCGGCGATTGCGCGCCATATTGAAGCGCAGCGCACCGGCGCGGCGACGCAGCCGACCTTTGCGAGCGTGCATGGCAAAGATGCCACCGTGATTACGGCGGGCGAACTGACCCTGGATAAATTTCTGGATGAGAGCCTGCTGAAGGCGGCGAAAGATGTGCAGCCGGCGACCGCCGATGTGAAAACCGTGTTAGTGACCGGCGGCAACGGCTGGTTAGGCCGTTGGCTGGTGCTGGATTGGCTGGAACGCCTGGCGCCGAACGGCGGCAAAGTGTATGCGCTGATTCGCGGCGCGGATGCGGAAGCGGCGCGCGCGCGCCTGGATGCGGTGTATGAAAGTGGCGATCCGAAACTGAGCGCGCATTATCGTCAGCTGGCGCAACAAAGCCTGGAAGTGATTGCGGGCGATTTTGGCGATCAAGATCTGGGCCTGAGCCAAGAAGTGTGGCAGAAATTAGCGAAAGACGTGGACCTGATTGTGCATAGCGGCGCGCTGGTGAACCATGTGCTGCCGTATAGTCAGCTGTTTGGCCCGAACGTGGCGGGCACCGCGGAAATTATTAAACTGGCGATTAGCGAACGCCTGAAACCGGTGACCTATCTGAGCACCGTGGGCATTGCGGATCAGATTCCGGTGACCGAATTTGAAGAAGATAGCGATGTGCGCGTGATGAGCGCGGAACGTCAGATTAACGATGGCTATGCGAACGGCTATGGCAACAGCAAATGGGCGGGCGAAGTGCTGCTGCGCGAAGCGCATGATTTAGCGGGCCTGCCGGTGCGCGTGTTTCGCAGCGATATGATTCTGGCGCATAGCGATTATCATGGTCAGCTGAACGTGACCGATGTGTTTACCCGCAGCATTCAGAGCCTGTTACTGACCGGCGTGGCGCCGGCGAGCTTTTATGAACTGGATGCGGATGGCAACCGTCAGCGCGCGCATTATGATGGCGTGCCGGGCGATTTTACCGCGGCGAGCATTACCGCGATTGGCGGCGTGAACGTGGTGGATGGCTATCGCAGCTTTGATGTGTTTAACCCGCATCATGATGGCGTGAGCATGGATACCTTTGTGGATTGGCTGATTGATGCGGGCTATAAAATTGCGCGCATTGATGATTATGATCAGTGGCTGGCGCGCTTTGAACTGGCGCTGAAAGGCCTGCCGGAACAGCAGCGTCAGCAGAGCGTGCTGCCGCTGCTGAAAATGTATGAAAAACCGCAGCCGGCGATTGATGGCAGCGCGCTGCCGACCGCGGAATTTAGCCGCGCGGTGCATGAAGCGAAAGTGGGCGATAGCGGCGAAATTCCGCATGTGACCAAAGAACTGATTCTGAAATATGCGAGCGATATTCAGCTGCTGGGCCTGGTGTAA;

② MabCAR-S259W coding gene 3537bp (SEQ ID NO. 18):

ATGACCGAAACCATTAGCACCGCGGCGGTGCCGACCACCGATCTGGAAGAACAAGTGAAACGCCGCATTGAACAAGTGGTGAGCAACGATCCGCAGCTGGCGGCGCTGCTGCCGGAAGATAGCGTGACCGAAGCGGTGAACGAACCGGATCTGCCGCTGGTGGAAGTGATTCGCCGCCTGCTGGAAGGCTATGGCGATCGCCCGGCGCTGGGTCAGCGCGCGTTTGAATTTGTGACCGGCGATGATGGCGCGACCGTGATTGCGCTGAAACCGGAATACACCACCGTGAGCTATCGCGAACTGTGGGAACGCGCGGAAGCGATTGCGGCCGCGTGGCATGAACAAGGCATTCGCGATGGCGATTTTGTGGCGCAGCTGGGCTTTACGAGCACCGATTTTGCGAGCCTGGATGTGGCCGGCCTGCGCCTGGGTACGGTTAGCGTGCCACTGCAGACCGGCGCGAGCCTGCAGCAGCGCAACGCGATTCTGGAAGAAACCCGCCCGGCGGTGTTTGCGGCGAGCATTGAATATCTGGATGCGGCGGTGGATAGCGTGCTGGCGACCCCGAGCGTGCGCTTACTGAGCGTGTTTGATTATCATGCGGAAGTGGACAGTCAGCGCGAAGCCTTAGAAGCGGTTCGTGCGCGCCTGGAAAGCGCGGGTCGTACCATTGTGGTGGAGGCGTTAGCCGAGGCGTTAGCCCGTGGCCGCGATTTACCGGCGGCGCCACTGCCAAGCGCCGATCCGGATGCGCTGCGCCTGCTGATCTATACGTGGGGCAGCACCGGCACCCCGAAAGGCGCGATGTATCCGCAGTGGCTGGTGGCGAACCTGTGGCAGAAAAAATGGCTGACCGATGATGTGATTCCGAGCATTGGCGTGAACTTTATGCCGATGAGCCATCTGGCGGGCCGCCTGACCCTGATGGGCACCCTGAGCGGCGGTGGCACCGCGTATTATATTGCGAGCAGCGATTTAAGCACCTTTTTTGAAGATATTGCGTTAATTCGCCCGAGCGAAGTGCTGTTTGTGCCGCGCGTGGTGGAAATGGTGTTTCAGCGCTTTCAAGCGGAACTGGATCGCAGCCTGGCGCCGGGCGAAAGCAACAGCGAAATTGCGGAACGCATTAAAGTGCGCATTCGCGAACAAGATTTTGGCGGCCGCGTGCTGAGCGCGGGCAGCGGCAGCGCGCCGCTGAGCCCGGAAATGACCGAATTTATGGAAAGCCTGCTGCAAGTGCCGCTGCGCGATGGCTATGGTAGCACCGAAGCGGGCGGCGTGTGGCGCGATGGCGTGCTGCAGCGCCCGCCGGTGACCGATTATAAACTGGTGGATGTTCCGGAACTGGGCTATTTTACCACCGATAGCCCGCATCCGCGCGGCGAACTGCGCCTGAAAAGCGAAACCATGTTTCCGGGCTATTATAAACGCCCGGAAACCACCGCGGATGTTTTTGACGATGAAGGCTATTATAAGACCGGCGATGTGGTGGCGGAACTGGGCCCGGATCATCTGAAATATCTGGATCGCGTGAAAAACGTGCTGAAACTGGCGCAAGGCGAATTTGTGGCGGTGAGCAAACTGGAAGCGGCGTATACCGGCAGCCCGCTGGTGCGTCAGATTTTTGTGTATGGCAATAGCGAACGCAGCTTTCTGCTGGCGGTGGTTGTGCCGACCCCGGAAGTGCTGGAACGCTATGCGGATAGCCCGGATGCGTTAAAACCGCTGATTCAAGATAGCCTGCAACAAGTGGCGAAAGATGCGGAACTGCAGAGCTATGAAATTCCGCGCGATTTTATTGTGGAAACCGTGCCGTTTACCGTGGAAAGCGGCCTGCTGAGCGATGCGCGCAAACTGCTGCGCCCGAAACTGAAAGATCATTATGGCGAACGCCTGGAAGCGCTGTATGCGGAACTGGCGGAAAGCCAAAATGAACGCCTGCGTCAGTTAGCGCGTGAAGCCGCGACGCGTCCGGTGCTGGAAACGGTTACGGATGCCGCGGCCGCGTTACTGGGTGCGAGCAGCAGTGATCTGGCGCCGGATGTGCGCTTTATTGATCTGGGCGGCGATAGCCTGAGCGCGCTGAGCTATAGCGAACTGCTGCGCGATATTTTTGAAGTGGACGTGCCGGTTGGCGTGATTAACAGCGTGGCGAACGATCTGGCGGCGATTGCGCGCCATATTGAAGCGCAGCGCACCGGCGCGGCGACGCAGCCGACCTTTGCGAGCGTGCATGGCAAAGATGCCACCGTGATTACGGCGGGCGAACTGACCCTGGATAAATTTCTGGATGAGAGCCTGCTGAAGGCGGCGAAAGATGTGCAGCCGGCGACCGCCGATGTGAAAACCGTGTTAGTGACCGGCGGCAACGGCTGGTTAGGCCGTTGGCTGGTGCTGGATTGGCTGGAACGCCTGGCGCCGAACGGCGGCAAAGTGTATGCGCTGATTCGCGGCGCGGATGCGGAAGCGGCGCGCGCGCGCCTGGATGCGGTGTATGAAAGTGGCGATCCGAAACTGAGCGCGCATTATCGTCAGCTGGCGCAACAAAGCCTGGAAGTGATTGCGGGCGATTTTGGCGATCAAGATCTGGGCCTGAGCCAAGAAGTGTGGCAGAAATTAGCGAAAGACGTGGACCTGATTGTGCATAGCGGCGCGCTGGTGAACCATGTGCTGCCGTATAGTCAGCTGTTTGGCCCGAACGTGGCGGGCACCGCGGAAATTATTAAACTGGCGATTAGCGAACGCCTGAAACCGGTGACCTATCTGAGCACCGTGGGCATTGCGGATCAGATTCCGGTGACCGAATTTGAAGAAGATAGCGATGTGCGCGTGATGAGCGCGGAACGTCAGATTAACGATGGCTATGCGAACGGCTATGGCAACAGCAAATGGGCGGGCGAAGTGCTGCTGCGCGAAGCGCATGATTTAGCGGGCCTGCCGGTGCGCGTGTTTCGCAGCGATATGATTCTGGCGCATAGCGATTATCATGGTCAGCTGAACGTGACCGATGTGTTTACCCGCAGCATTCAGAGCCTGTTACTGACCGGCGTGGCGCCGGCGAGCTTTTATGAACTGGATGCGGATGGCAACCGTCAGCGCGCGCATTATGATGGCGTGCCGGGCGATTTTACCGCGGCGAGCATTACCGCGATTGGCGGCGTGAACGTGGTGGATGGCTATCGCAGCTTTGATGTGTTTAACCCGCATCATGATGGCGTGAGCATGGATACCTTTGTGGATTGGCTGATTGATGCGGGCTATAAAATTGCGCGCATTGATGATTATGATCAGTGGCTGGCGCGCTTTGAACTGGCGCTGAAAGGCCTGCCGGAACAGCAGCGTCAGCAGAGCGTGCTGCCGCTGCTGAAAATGTATGAAAAACCGCAGCCGGCGATTGATGGCAGCGCGCTGCCGACCGCGGAATTTAGCCGCGCGGTGCATGAAGCGAAAGTGGGCGATAGCGGCGAAATTCCGCATGTGACCAAAGAACTGATTCTGAAATATGCGAGCGATATTCAGCTGCTGGGCCTGGTGTAA;

③ MabCAR-L284W coding gene 3537bp (SEQ ID NO. 19):

ATGACCGAAACCATTAGCACCGCGGCGGTGCCGACCACCGATCTGGAAGAACAAGTGAAACGCCGCATTGAACAAGTGGTGAGCAACGATCCGCAGCTGGCGGCGCTGCTGCCGGAAGATAGCGTGACCGAAGCGGTGAACGAACCGGATCTGCCGCTGGTGGAAGTGATTCGCCGCCTGCTGGAAGGCTATGGCGATCGCCCGGCGCTGGGTCAGCGCGCGTTTGAATTTGTGACCGGCGATGATGGCGCGACCGTGATTGCGCTGAAACCGGAATACACCACCGTGAGCTATCGCGAACTGTGGGAACGCGCGGAAGCGATTGCGGCCGCGTGGCATGAACAAGGCATTCGCGATGGCGATTTTGTGGCGCAGCTGGGCTTTACGAGCACCGATTTTGCGAGCCTGGATGTGGCCGGCCTGCGCCTGGGTACGGTTAGCGTGCCACTGCAGACCGGCGCGAGCCTGCAGCAGCGCAACGCGATTCTGGAAGAAACCCGCCCGGCGGTGTTTGCGGCGAGCATTGAATATCTGGATGCGGCGGTGGATAGCGTGCTGGCGACCCCGAGCGTGCGCTTACTGAGCGTGTTTGATTATCATGCGGAAGTGGACAGTCAGCGCGAAGCCTTAGAAGCGGTTCGTGCGCGCCTGGAAAGCGCGGGTCGTACCATTGTGGTGGAGGCGTTAGCCGAGGCGTTAGCCCGTGGCCGCGATTTACCGGCGGCGCCACTGCCAAGCGCCGATCCGGATGCGCTGCGCCTGCTGATCTATACGAGCGGCAGCACCGGCACCCCGAAAGGCGCGATGTATCCGCAGTGGCTGGTGGCGAACCTGTGGCAGAAAAAATGGTGGACCGATGATGTGATTCCGAGCATTGGCGTGAACTTTATGCCGATGAGCCATCTGGCGGGCCGCCTGACCCTGATGGGCACCCTGAGCGGCGGTGGCACCGCGTATTATATTGCGAGCAGCGATTTAAGCACCTTTTTTGAAGATATTGCGTTAATTCGCCCGAGCGAAGTGCTGTTTGTGCCGCGCGTGGTGGAAATGGTGTTTCAGCGCTTTCAAGCGGAACTGGATCGCAGCCTGGCGCCGGGCGAAAGCAACAGCGAAATTGCGGAACGCATTAAAGTGCGCATTCGCGAACAAGATTTTGGCGGCCGCGTGCTGAGCGCGGGCAGCGGCAGCGCGCCGCTGAGCCCGGAAATGACCGAATTTATGGAAAGCCTGCTGCAAGTGCCGCTGCGCGATGGCTATGGTAGCACCGAAGCGGGCGGCGTGTGGCGCGATGGCGTGCTGCAGCGCCCGCCGGTGACCGATTATAAACTGGTGGATGTTCCGGAACTGGGCTATTTTACCACCGATAGCCCGCATCCGCGCGGCGAACTGCGCCTGAAAAGCGAAACCATGTTTCCGGGCTATTATAAACGCCCGGAAACCACCGCGGATGTTTTTGACGATGAAGGCTATTATAAGACCGGCGATGTGGTGGCGGAACTGGGCCCGGATCATCTGAAATATCTGGATCGCGTGAAAAACGTGCTGAAACTGGCGCAAGGCGAATTTGTGGCGGTGAGCAAACTGGAAGCGGCGTATACCGGCAGCCCGCTGGTGCGTCAGATTTTTGTGTATGGCAATAGCGAACGCAGCTTTCTGCTGGCGGTGGTTGTGCCGACCCCGGAAGTGCTGGAACGCTATGCGGATAGCCCGGATGCGTTAAAACCGCTGATTCAAGATAGCCTGCAACAAGTGGCGAAAGATGCGGAACTGCAGAGCTATGAAATTCCGCGCGATTTTATTGTGGAAACCGTGCCGTTTACCGTGGAAAGCGGCCTGCTGAGCGATGCGCGCAAACTGCTGCGCCCGAAACTGAAAGATCATTATGGCGAACGCCTGGAAGCGCTGTATGCGGAACTGGCGGAAAGCCAAAATGAACGCCTGCGTCAGTTAGCGCGTGAAGCCGCGACGCGTCCGGTGCTGGAAACGGTTACGGATGCCGCGGCCGCGTTACTGGGTGCGAGCAGCAGTGATCTGGCGCCGGATGTGCGCTTTATTGATCTGGGCGGCGATAGCCTGAGCGCGCTGAGCTATAGCGAACTGCTGCGCGATATTTTTGAAGTGGACGTGCCGGTTGGCGTGATTAACAGCGTGGCGAACGATCTGGCGGCGATTGCGCGCCATATTGAAGCGCAGCGCACCGGCGCGGCGACGCAGCCGACCTTTGCGAGCGTGCATGGCAAAGATGCCACCGTGATTACGGCGGGCGAACTGACCCTGGATAAATTTCTGGATGAGAGCCTGCTGAAGGCGGCGAAAGATGTGCAGCCGGCGACCGCCGATGTGAAAACCGTGTTAGTGACCGGCGGCAACGGCTGGTTAGGCCGTTGGCTGGTGCTGGATTGGCTGGAACGCCTGGCGCCGAACGGCGGCAAAGTGTATGCGCTGATTCGCGGCGCGGATGCGGAAGCGGCGCGCGCGCGCCTGGATGCGGTGTATGAAAGTGGCGATCCGAAACTGAGCGCGCATTATCGTCAGCTGGCGCAACAAAGCCTGGAAGTGATTGCGGGCGATTTTGGCGATCAAGATCTGGGCCTGAGCCAAGAAGTGTGGCAGAAATTAGCGAAAGACGTGGACCTGATTGTGCATAGCGGCGCGCTGGTGAACCATGTGCTGCCGTATAGTCAGCTGTTTGGCCCGAACGTGGCGGGCACCGCGGAAATTATTAAACTGGCGATTAGCGAACGCCTGAAACCGGTGACCTATCTGAGCACCGTGGGCATTGCGGATCAGATTCCGGTGACCGAATTTGAAGAAGATAGCGATGTGCGCGTGATGAGCGCGGAACGTCAGATTAACGATGGCTATGCGAACGGCTATGGCAACAGCAAATGGGCGGGCGAAGTGCTGCTGCGCGAAGCGCATGATTTAGCGGGCCTGCCGGTGCGCGTGTTTCGCAGCGATATGATTCTGGCGCATAGCGATTATCATGGTCAGCTGAACGTGACCGATGTGTTTACCCGCAGCATTCAGAGCCTGTTACTGACCGGCGTGGCGCCGGCGAGCTTTTATGAACTGGATGCGGATGGCAACCGTCAGCGCGCGCATTATGATGGCGTGCCGGGCGATTTTACCGCGGCGAGCATTACCGCGATTGGCGGCGTGAACGTGGTGGATGGCTATCGCAGCTTTGATGTGTTTAACCCGCATCATGATGGCGTGAGCATGGATACCTTTGTGGATTGGCTGATTGATGCGGGCTATAAAATTGCGCGCATTGATGATTATGATCAGTGGCTGGCGCGCTTTGAACTGGCGCTGAAAGGCCTGCCGGAACAGCAGCGTCAGCAGAGCGTGCTGCCGCTGCTGAAAATGTATGAAAAACCGCAGCCGGCGATTGATGGCAGCGCGCTGCCGACCGCGGAATTTAGCCGCGCGGTGCATGAAGCGAAAGTGGGCGATAGCGGCGAAATTCCGCATGTGACCAAAGAACTGATTCTGAAATATGCGAGCGATATTCAGCTGCTGGGCCTGGTGTAA;

④ MabCAR-V511E encoding gene 3537bp (SEQ ID NO. 20):

ATGACCGAAACCATTAGCACCGCGGCGGTGCCGACCACCGATCTGGAAGAACAAGTGAAACGCCGCATTGAACAAGTGGTGAGCAACGATCCGCAGCTGGCGGCGCTGCTGCCGGAAGATAGCGTGACCGAAGCGGTGAACGAACCGGATCTGCCGCTGGTGGAAGTGATTCGCCGCCTGCTGGAAGGCTATGGCGATCGCCCGGCGCTGGGTCAGCGCGCGTTTGAATTTGTGACCGGCGATGATGGCGCGACCGTGATTGCGCTGAAACCGGAATACACCACCGTGAGCTATCGCGAACTGTGGGAACGCGCGGAAGCGATTGCGGCCGCGTGGCATGAACAAGGCATTCGCGATGGCGATTTTGTGGCGCAGCTGGGCTTTACGAGCACCGATTTTGCGAGCCTGGATGTGGCCGGCCTGCGCCTGGGTACGGTTAGCGTGCCACTGCAGACCGGCGCGAGCCTGCAGCAGCGCAACGCGATTCTGGAAGAAACCCGCCCGGCGGTGTTTGCGGCGAGCATTGAATATCTGGATGCGGCGGTGGATAGCGTGCTGGCGACCCCGAGCGTGCGCTTACTGAGCGTGTTTGATTATCATGCGGAAGTGGACAGTCAGCGCGAAGCCTTAGAAGCGGTTCGTGCGCGCCTGGAAAGCGCGGGTCGTACCATTGTGGTGGAGGCGTTAGCCGAGGCGTTAGCCCGTGGCCGCGATTTACCGGCGGCGCCACTGCCAAGCGCCGATCCGGATGCGCTGCGCCTGCTGATCTATACGAGCGGCAGCACCGGCACCCCGAAAGGCGCGATGTATCCGCAGTGGCTGGTGGCGAACCTGTGGCAGAAAAAATGGCTGACCGATGATGTGATTCCGAGCATTGGCGTGAACTTTATGCCGATGAGCCATCTGGCGGGCCGCCTGACCCTGATGGGCACCCTGAGCGGCGGTGGCACCGCGTATTATATTGCGAGCAGCGATTTAAGCACCTTTTTTGAAGATATTGCGTTAATTCGCCCGAGCGAAGTGCTGTTTGTGCCGCGCGTGGTGGAAATGGTGTTTCAGCGCTTTCAAGCGGAACTGGATCGCAGCCTGGCGCCGGGCGAAAGCAACAGCGAAATTGCGGAACGCATTAAAGTGCGCATTCGCGAACAAGATTTTGGCGGCCGCGTGCTGAGCGCGGGCAGCGGCAGCGCGCCGCTGAGCCCGGAAATGACCGAATTTATGGAAAGCCTGCTGCAAGTGCCGCTGCGCGATGGCTATGGTAGCACCGAAGCGGGCGGCGTGTGGCGCGATGGCGTGCTGCAGCGCCCGCCGGTGACCGATTATAAACTGGTGGATGTTCCGGAACTGGGCTATTTTACCACCGATAGCCCGCATCCGCGCGGCGAACTGCGCCTGAAAAGCGAAACCATGTTTCCGGGCTATTATAAACGCCCGGAAACCACCGCGGATGTTTTTGACGATGAAGGCTATTATAAGACCGGCGATGTGGTGGCGGAACTGGGCCCGGATCATCTGAAATATCTGGATCGCGAAAAAAACGTGCTGAAACTGGCGCAAGGCGAATTTGTGGCGGTGAGCAAACTGGAAGCGGCGTATACCGGCAGCCCGCTGGTGCGTCAGATTTTTGTGTATGGCAATAGCGAACGCAGCTTTCTGCTGGCGGTGGTTGTGCCGACCCCGGAAGTGCTGGAACGCTATGCGGATAGCCCGGATGCGTTAAAACCGCTGATTCAAGATAGCCTGCAACAAGTGGCGAAAGATGCGGAACTGCAGAGCTATGAAATTCCGCGCGATTTTATTGTGGAAACCGTGCCGTTTACCGTGGAAAGCGGCCTGCTGAGCGATGCGCGCAAACTGCTGCGCCCGAAACTGAAAGATCATTATGGCGAACGCCTGGAAGCGCTGTATGCGGAACTGGCGGAAAGCCAAAATGAACGCCTGCGTCAGTTAGCGCGTGAAGCCGCGACGCGTCCGGTGCTGGAAACGGTTACGGATGCCGCGGCCGCGTTACTGGGTGCGAGCAGCAGTGATCTGGCGCCGGATGTGCGCTTTATTGATCTGGGCGGCGATAGCCTGAGCGCGCTGAGCTATAGCGAACTGCTGCGCGATATTTTTGAAGTGGACGTGCCGGTTGGCGTGATTAACAGCGTGGCGAACGATCTGGCGGCGATTGCGCGCCATATTGAAGCGCAGCGCACCGGCGCGGCGACGCAGCCGACCTTTGCGAGCGTGCATGGCAAAGATGCCACCGTGATTACGGCGGGCGAACTGACCCTGGATAAATTTCTGGATGAGAGCCTGCTGAAGGCGGCGAAAGATGTGCAGCCGGCGACCGCCGATGTGAAAACCGTGTTAGTGACCGGCGGCAACGGCTGGTTAGGCCGTTGGCTGGTGCTGGATTGGCTGGAACGCCTGGCGCCGAACGGCGGCAAAGTGTATGCGCTGATTCGCGGCGCGGATGCGGAAGCGGCGCGCGCGCGCCTGGATGCGGTGTATGAAAGTGGCGATCCGAAACTGAGCGCGCATTATCGTCAGCTGGCGCAACAAAGCCTGGAAGTGATTGCGGGCGATTTTGGCGATCAAGATCTGGGCCTGAGCCAAGAAGTGTGGCAGAAATTAGCGAAAGACGTGGACCTGATTGTGCATAGCGGCGCGCTGGTGAACCATGTGCTGCCGTATAGTCAGCTGTTTGGCCCGAACGTGGCGGGCACCGCGGAAATTATTAAACTGGCGATTAGCGAACGCCTGAAACCGGTGACCTATCTGAGCACCGTGGGCATTGCGGATCAGATTCCGGTGACCGAATTTGAAGAAGATAGCGATGTGCGCGTGATGAGCGCGGAACGTCAGATTAACGATGGCTATGCGAACGGCTATGGCAACAGCAAATGGGCGGGCGAAGTGCTGCTGCGCGAAGCGCATGATTTAGCGGGCCTGCCGGTGCGCGTGTTTCGCAGCGATATGATTCTGGCGCATAGCGATTATCATGGTCAGCTGAACGTGACCGATGTGTTTACCCGCAGCATTCAGAGCCTGTTACTGACCGGCGTGGCGCCGGCGAGCTTTTATGAACTGGATGCGGATGGCAACCGTCAGCGCGCGCATTATGATGGCGTGCCGGGCGATTTTACCGCGGCGAGCATTACCGCGATTGGCGGCGTGAACGTGGTGGATGGCTATCGCAGCTTTGATGTGTTTAACCCGCATCATGATGGCGTGAGCATGGATACCTTTGTGGATTGGCTGATTGATGCGGGCTATAAAATTGCGCGCATTGATGATTATGATCAGTGGCTGGCGCGCTTTGAACTGGCGCTGAAAGGCCTGCCGGAACAGCAGCGTCAGCAGAGCGTGCTGCCGCTGCTGAAAATGTATGAAAAACCGCAGCCGGCGATTGATGGCAGCGCGCTGCCGACCGCGGAATTTAGCCGCGCGGTGCATGAAGCGAAAGTGGGCGATAGCGGCGAAATTCCGCATGTGACCAAAGAACTGATTCTGAAATATGCGAGCGATATTCAGCTGCTGGGCCTGGTGTAA;

⑤ sfp coding gene 678bp

ATGGccAAAATTTATGGCATTTATATGGATCGCCCGCTGAGCCAAGAAGAAAACGAACGCTTTATGAGCTTTATTAGCCCGGAAAAACGCGAAAAATGCCGCCGCTTTTATCATAAAGAAGATGCGCATCGCACCCTGCTGGGCGATGTGCTGGTGCGCAGCGTGATTAGCCGTCAGTATCAGCTGGATAAAAGCGATATTCGCTTTAGCACCCAAGAATATGGCAAACCGTGCATTCCGGATCTGCCGGATGCGCATTTTAACATTAGCCATAGCGGCCGCTGGGTGATTGGCGCGTTTGATAGTCAGCCGATTGGCATTGATATTGAAAAAACCAAACCGATTAGCCTGGAAATTGCGAAACGCTTTTTTAGCAAAACCGAATATAGCGATCTGCTGGCGAAAGATAAAGATGAACAGACCGATTATTTTTATCATCTGTGGAGCATGAAAGAGAGCTTTATTAAACAAGAAGGCAAAGGCCTGAGCCTGCCGCTGGATAGCTTTAGCGTGCGCCTGCATCAAGATGGCCAAGTGAGCATTGAACTGCCGGATAGCCATAGCCCGTGCTATATTAAAACCTATGAAGTGGATCCGGGCTATAAAATGGCGGTGTGCGCGGCGCATCCGGATTTTCCGGAAGATATTACCATTGTGAGCTATGAAGAACTGCTGTAA;

⑥ AdhP coding gene 1011bp

ATGAAGGCTGCAGTTGTTACGAAGGATCATCACGTTGACGTTACGGATAAAACACTGCGCTCACTGAAACATGGCGAAGCCCTGCTGAAAATGGAGTGTTGTGGTGTATGTCATACCGATCTTCATGTTAAGAATGGCGATTTTGGTGACAAAACTGGCGTAATTCTGGGCCATGAAGGCATCGGTGTGGTGGCAGAAGTTGGCCCAGGTGTCACCTCATTAAAACCAGGCGATCGTGCCAGCGTGGCGTGGTTCTACGAAGGATGCGGTCATTGCGAATACTGTAATAGTGGTAACGAAACGCTCTGCCGTTCAGTTAAAAATGCCGGATACAGCGTTGATGGCGGGATGGCGGAAGAGTGCATCGTGGTCGCCGATTACGCGGTAAAAGTGCCAGATGGTCTGGACTCGGCGGCGGCCAGCAGCATTACCTGTGCGGGGGTCACCACCTACAAAGCCGTTAAACTGTCAAAAATTCGTCCAGGGCAGTGGATTGCTATCTACGGTCTTGGCGGTCTGGGTAACCTCGCTCTGCAATACGCGAAGAATGTCTTTAACGCGAAAGTGATCGCCATTGATGTCAATGATGAGCAGTTAAAACTGGCAACCGAAATGGGTGCAGATTTAGCGATTAACTCACGCACCGAAGACGCCGCCAAAATTGTGCAGGAGAAAACCGGTGGCGCTCACGCTGCGGTGGTAACAGCAGTTGCTAAAGCTGCGTTTAACTCGGCAGTTGATGCTGTCCGTGCAGGCGGTCGTGTTGTGGCTGTCGGTCTGCCGCCGGAGTCTATGAGCCTGGATATCCCACGCCTTGTGCTGGATGGCATTGAAGTGGTCGGTTCGCTGGTCGGCACGCGCCAGGATCTAACCGAAGCCTTCCAGTTTGCCGCCGAAGGCAAAGTGGTGCCGAAAGTCGCCCTGCGTCCGTTAGCGGACATCAACACCATCTTTACCGAGATGGAAGAAGGCAAAATCCGTGGCCGTATGGTGATTGATTTCCGCCGTTAA.

Claims

1. A carboxylic acid reductase mutant is characterized in that the mutant is obtained by taking carboxylic acid reductase with an amino acid sequence shown as SEQ ID NO.13 as a starting sequence and mutating at least one amino acid in positions 259, 284 and 511.

2. The mutant according to claim 1, wherein the mutant is any one or more of the following (a) to (c):

3. A gene encoding the mutant according to claim 1 or 2.

4. A recombinant vector carrying the coding gene of claim 3.

5. The recombinant vector according to claim 4, wherein the starting vector of the recombinant vector is any one of pET series, duet series, pGEX series, pHY300PLK, pPIC3K or pPIC9K series.

6. A recombinant microbial cell carrying the gene of claim 3 or expressing the mutant of claim 1 or 2.

7. The recombinant microbial cell of claim 6, wherein the microbial cell is a prokaryotic microbial cell or a eukaryotic microbial cell.

8. Use of the mutant according to claim 1 or 2, the coding gene according to claim 3, the recombinant vector according to claim 4 or 5, the recombinant microbial cell according to claim 6 or 7 for catalyzing 2, 4-dihydroxybutyric acid.

9. A method for synthesizing 1,2, 4-butanetriol, wherein the mutant according to claim 1 or 2 and alcohol dehydrogenase are added to an aqueous solution of 2, 4-dihydroxybutyric acid and reacted at 30 ℃ for at least 12 hours.

10. A method for improving the catalytic activity of catalytic 2, 4-dihydroxybutyric acid, which is characterized in that the mutant according to claim 1 or2 is added to an aqueous solution of 2, 4-dihydroxybutyric acid and reacted at 30 ℃ for at least 12 hours.