CN118028538A - Primer and probe combination for detecting various avian viruses, kit and application thereof - Google Patents

Primer and probe combination for detecting various avian viruses, kit and application thereof Download PDF

Info

Publication number
CN118028538A
CN118028538A CN202410310177.5A CN202410310177A CN118028538A CN 118028538 A CN118028538 A CN 118028538A CN 202410310177 A CN202410310177 A CN 202410310177A CN 118028538 A CN118028538 A CN 118028538A
Authority
CN
China
Prior art keywords
seq
primer
probe
virus
detection
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202410310177.5A
Other languages
Chinese (zh)
Inventor
王晨
张敖
王鑫
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Boruze Biotechnology Shanghai Co ltd
Original Assignee
Boruze Biotechnology Shanghai Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Boruze Biotechnology Shanghai Co ltd filed Critical Boruze Biotechnology Shanghai Co ltd
Priority to CN202410310177.5A priority Critical patent/CN118028538A/en
Publication of CN118028538A publication Critical patent/CN118028538A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701—Specific hybridization probes
    • C12Q1/702—Specific hybridization probes for retroviruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701—Specific hybridization probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Virology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The application provides a primer and probe combination capable of detecting multiple avian viruses simultaneously, which can effectively detect multiple avian viruses and variant strains and subtypes thereof, and has strong specificity and high sensitivity. The application also relates to a kit comprising such a combination and to the use of such a combination and kit for detecting avian viruses.

Description

Primer and probe combination for detecting various avian viruses, kit and application thereof
Technical Field
The application relates to the fields of biological medicine, fermentation engineering and the like, in particular to the field of detection of avian viruses.
Background
In the production of biologicals, avian-derived cell matrices, such as chicken fibroblasts, or raw materials, such as SPF (specific pathogen free, no specific pathogen) chicken flocks, SPF eggs are also the primary exogenous virus monitor. Among them, SPF eggs are important raw materials for preparing vaccines such as influenza vaccines. The production flow of medicines and specific foods using SPF eggs or SPF chicken flocks as raw materials is in accordance with GMP (Good Manufacturing Practice of Medical Products, pharmaceutical production quality control Specification) standard, and related avian viruses need to be detected.
In the existing industry specification, in the section of preparation and quality control of animal cell matrix for production and detection of biological products in the third section of Chinese pharmacopoeia 2020, exogenous virus detection is carried out on cells and raw materials of avian origin, and the detection method comprises an animal in-vivo experiment method and a serology method; in European pharmacopoeia 5.2.2, the related products of SPF chicken flock are required to be detected by an enzyme immunoassay or a fluorescence immunoassay; the fourth section 3308 of chinese pharmacopoeia 2020 describes methods for detecting exogenous avian adenoviruses I, II and leukemia virus in influenza virus vaccine preparations using quantitative PCR methods.
The pharmacopoeia mainly uses animal in vivo experiment method and serological method for detecting avian virus. The animal experiment method requires expensive experimental animals, and has long culture time, complex influencing factors and large interference. Serological methods include enzyme immunization or fluorescence immunization, which require cell culture, animal culture or chick embryo inoculation, and have high requirements for conditions, long culture time, poor specificity, and susceptibility to false positives. In recent years, avian virus detection technology based on PCR and quantitative PCR is gradually introduced into pharmacopoeia detection methods, and exogenous virus detection is performed on biological products related to avian raw materials such as vaccines under a GMP system. However, in the prior art, only a single virus can be detected, and multiple avian viruses cannot be detected simultaneously. Therefore, a new detection device and method that is simple to operate, short in detection period, and capable of detecting multiple avian viruses simultaneously is needed.
Disclosure of Invention
This section presents in simplified form the option of inventive concepts, which will be further apparent from the detailed description below. This section is not intended to identify key features or essential features of the claimed subject matter, nor is it intended to be used as an aid in determining the scope of the claimed subject matter.
Aiming at the problems in the prior art, the application provides a primer and probe combination for simultaneously detecting a plurality of avian viruses, wherein the primer and probe combination comprises at least any two of the following primer and probe groups:
a first primer and probe set comprising primers shown as SEQ ID NO.1 and SEQ ID NO.2, and a probe shown as SEQ ID NO. 3;
a second primer and probe set comprising primers shown as SEQ ID NO.4 and SEQ ID NO.5, and a probe shown as SEQ ID NO. 6;
a third primer and probe set comprising primers shown as SEQ ID NO.7 and SEQ ID NO.8, and a probe shown as SEQ ID NO. 9;
A fourth primer and probe set comprising primers shown as SEQ ID NO.10 and SEQ ID NO.11, and a probe shown as SEQ ID NO. 12;
and a fifth primer and probe set comprising primers shown as SEQ ID NO.13 and SEQ ID NO.14, and a probe shown as SEQ ID NO. 15.
Preferably, the 5 'end of each of SEQ ID No.3, SEQ ID No.6, SEQ ID No.9, SEQ ID No.12, SEQ ID No.15 is modified with a FAM group and the 3' end is modified with an MGB group.
The application also provides a kit for simultaneously detecting a plurality of avian viruses, which comprises the primer and probe combination as claimed in claim 1 or 2.
Preferably, the kit comprises a detection well plate provided with a positive reference area, a negative reference area, a sample area and a blank area, wherein three detection wells are arranged for each virus in the positive reference area, the negative reference area, the sample area and the blank area.
Preferably, the detection wells for each virus in the detection well plate contain a first primer and probe set, a second primer and probe set, a third primer and probe set, a fourth primer and probe set, and a fifth primer and probe set, respectively.
Preferably, the positive reference region further comprises a positive control nucleic acid for the target virus in the detection well for each virus.
Preferably, the kit further comprises a PCR reaction liquid component, wherein the PCR reaction liquid component comprises nuclease-free water, quantitative PCR reaction premix, external reference premix and external reference DNA.
Preferably, the external reference premix comprises primers shown as SEQ ID NO.17 and SEQ ID NO.18, and a probe shown as SEQ ID NO.19, and the sequence of the external reference DNA is shown as SEQ ID NO. 16.
Preferably, the 5 'end of SEQ ID NO.19 is modified with HEX groups and the 3' end is modified with MGB groups.
The application also provides a primer and probe combination according to the principle of the application or application of the kit according to the principle of the application in detecting avian viruses.
Drawings
Other or additional features, advantages and details are presented in the following detailed description of the embodiments by way of example only. In the drawings:
FIG. 1 shows the results of performance tests of primer and probe sets against chicken anemia virus;
FIG. 2 shows the results of performance testing of primer and probe sets against avian reovirus;
FIG. 3 shows the results of performance tests of primer and probe sets against avian encephalomyelitis virus;
FIG. 4 shows the results of performance testing of primer and probe sets against avian adenoviruses;
FIG. 5 shows performance test results for avian leukosis virus primer and probe sets;
FIG. 6 illustrates a detection aperture plate in accordance with the principles of the present application;
FIG. 7 shows the results of a kit according to the principles of the present application for detecting chicken anemia virus;
FIG. 8 shows the results of a kit according to the principles of the present application for detecting avian reovirus;
FIG. 9 shows the results of a kit according to the principles of the present application for detecting avian encephalomyelitis virus;
FIG. 10 shows the results of a kit according to the principles of the present application for detecting avian adenoviruses;
FIG. 11 shows the results of a kit according to the principles of the present application for detecting avian leukemia virus; and
FIG. 12 shows a reference DNA amplification curve for a kit according to the principles of the present application.
Detailed Description
The following description is merely exemplary in nature and is not intended to limit the present disclosure, application, or uses. Furthermore, there is no intention to be bound by any expressed or implied theory presented in the preceding technical field, background, and brief summary or the following detailed description. It should be understood that throughout the drawings, corresponding reference numerals indicate like or corresponding parts or features.
The application will now be further elucidated. In the following paragraphs, the different aspects of the application are defined in more detail. Each aspect so defined may be combined with any other aspect(s) unless clearly indicated to the contrary. In particular, any feature indicated as being preferred or advantageous may be combined with any other feature(s) indicated as being preferred or advantageous.
In response to the problems of the prior art, the present inventors designed primer and probe sets for PCR amplification for common avian viruses as shown in Table 1.
TABLE 1 avian virus species
Chinese name English name Abbreviations (abbreviations) Genome type
Chicken anaemia virus Chicken Anemia Virus CAV ssDNA
Avian reovirus Avian Reovirus ARO dsRNA
Avian encephalomyelitis virus Avian Encephalomyelitis Virus AEV ssRNA
Avian adenovirus Fowl Adenovirus FAdV dsDNA
Avian leukemia virus Avian leukosis virus ALV ssRNA
The inventor adopts biological analysis technology to classify and compare all nucleic acid information of avian viruses in Genebank as shown in table 1, extracts a conserved region which can cover specific avian viruses and variants or subtypes thereof to the greatest extent, and uses the conserved region for primer and probe design, thereby designing primer pairs and probe groups for PCR amplification systems for each avian virus, wherein the primers and probes corresponding to each avian virus are shown in table 2:
TABLE 2 primer and Probe set for avian-derived Virus
To verify the detection performance of the above-mentioned primer and probe set for each avian virus, the inventors performed performance tests on the above-mentioned primer and probe set by a PCR amplification procedure according to the requirements of MIQE (Minimum Information for Publication of Quantitative Real-Time PCR Experiments: release of minimum information for quantitative real-time PCR experiments), wherein the requirements of the performance tests are as follows:
1. The square (R 2) value of the regression coefficient R must be greater than 0.980;
2. the amplification efficiency is in the range of 80% -120% (only for reference);
3. The slope is in the range of-2.8 to-4.0.
If the above requirements are satisfied, it is shown that the primer and probe set have good test performance.
The test experiment method comprises the following steps:
Nucleic acid standards (DNA viruses using artificially synthesized DNA fragments and RNA viruses using in vitro transcribed RNA of artificially synthesized DNA fragments) corresponding to the respective virus detection primers and probe sets were diluted 10-fold in sequence from a concentration of 2X 10 6 copies/mu.l to 6 gradients of 2X 10 6,2×105,2×104,2×103,2×102,2×101, respectively, and then subjected to quantitative PCR reaction at 5. Mu.l to draw a quantitative standard curve. Wherein, the PCR reaction system and the reaction program for DNA viruses and RNA viruses are set as follows:
DNA virus
(1) The quantitative PCR reaction system for each tube of DNA virus is shown in Table 3:
TABLE 3 quantitative PCR reaction System for DNA Virus
Composition of the components Volume (mu L)
Nuclease-free water 2.8
Quantitative PCR reaction premix 10
Upstream primer (10. Mu.M) 0.5
Downstream primer (10. Mu.M) 1.5
Probe (5 mu M) 0.2
Standard substance solution 5
Total volume of 20
(2) The PCR reaction procedure set up is shown in table 4, with fluorescence channel selection FAM:
TABLE 4 DNA Virus PCR reaction procedure
RNA Virus
(1) The quantitative PCR reaction system for each tube of RNA virus is shown in Table 5:
TABLE 5 quantitative PCR reaction System for RNA viruses
Composition of the components Volume (mu L)
Nuclease-free water 7.8
One-step quantitative PCR reaction premix 5
Upstream primer (10. Mu.M) 0.5
Downstream primer (10. Mu.M) 1.5
Probe (5 mu M) 0.2
Standard substance solution 5
Total volume of 20
(2) The PCR reaction procedure set up is shown in table 6, with fluorescence channel selection FAM:
TABLE 6 quantitative PCR reaction System for RNA viruses
3. Amplification curves and standard curves for each avian source virus were obtained by the PCR reaction system and reaction procedure described above and are shown in figures 1-5.
4. Lower detection limit
The lower detection limit of each virus is determined by the following method:
(1) Testing 10 copies, 50 copies and 100 copies of nucleic acid standard substances according to each virus detection system, and repeating the test for 3 times for each nucleic acid standard substance;
(2) According to the result of the previous step, selecting the lowest copy number of all 3 repetitions with Ct or Cq value smaller than 38, and testing 24 repetitions; 23 out of 24 replicates could be detected and CV for Ct or Cq values of all replicates was < 20%, confirming that the copy number was the lower limit of detection for the virus detection.
5. By the above experiments, the performance of the probe and primer set for each virus was tested as shown in table 7:
TABLE 7 primer and Probe Performance test results for each Virus
As can be seen from Table 7, the amplification efficiency of the primer and probe set for each avian source virus was 80% or more, the linear value (R2) of the standard curve was greater than 0.980, and the slope of the standard curve was in the range of-2.8 to-4.0, indicating that the primer and probe set according to the principles of the present application were able to effectively detect the corresponding avian source virus.
Based on the above experimental results, in one aspect, the present application provides a primer and probe combination capable of simultaneously detecting a plurality of avian viruses, the combination comprising at least two primer and probe sets: (1) A first primer and a probe set for detecting Chicken Anaemia Virus (CAV), wherein the sequence of an upstream primer is shown as SEQ ID NO.1, the sequence of a downstream primer is shown as SEQ ID NO.2, and the probe is shown as SEQ ID NO. 3; (2) A second primer and a probe set for detecting Avian Reovirus (ARO), wherein the sequence of the upstream primer is shown as SEQ ID NO.4, the sequence of the downstream primer is shown as SEQ ID NO.5, and the probe is shown as SEQ ID NO. 6; (3) A third primer and a probe set for detecting Avian Encephalomyelitis Virus (AEV), wherein the sequence of the upstream primer is shown as SEQ ID NO.7, the sequence of the downstream primer is shown as SEQ ID NO.8, and the probe is shown as SEQ ID NO. 9; (4) A fourth primer and a probe set for detecting the avian adenovirus (FAdV), wherein the sequence of the upstream primer is shown as SEQ ID NO.10, the sequence of the downstream primer is shown as SEQ ID NO.11, and the probe is shown as SEQ ID NO. 12; (5) A fifth primer and a probe set for detecting Avian Leukosis Virus (ALV), wherein the sequence of the upstream primer is shown as SEQ ID NO.13, the sequence of the downstream primer is shown as SEQ ID NO.14, and the probe is shown as SEQ ID NO. 15. In the above probe sequences SEQ ID No.3, SEQ ID No.6, SEQ ID No.9, SEQ ID No.12 and SEQ ID No.15, the 5 '-end of each sequence was modified with a FAM group and the 3' -end of each sequence was modified with an MGB group.
It is easily understood by those skilled in the art that in practical applications, the primer and probe set included in the primer and probe combination may be selected according to the number of kinds of avian viruses to be detected, and the corresponding viruses are detected by PCR amplification experiments using the above primer and probe set.
In another aspect of the application there is also provided a kit for simultaneous detection of multiple avian viruses, the kit comprising a set of primers and probes for detection of each virus according to the principles of the present application. Advantageously, the kit may include a detection well plate 100 as shown in fig. 6, the well plate 100 being a 96-well plate, and a positive reference region, a negative reference region, a sample region, and a blank region may be provided thereon to ensure accuracy of detection results, each region containing a corresponding primer and probe set in a detection well for each virus. The sample area is used for detecting whether avian viruses exist in the sample; the positive reference area is used for detecting a positive reference to verify the effectiveness of the experimental system, if the positive reference can be detected, the experimental system is normal, the experiment is effective, otherwise, the experiment is ineffective; the negative reference area is used for detecting a negative reference to verify the specificity of the experiment, if the negative reference is not detected, false positive is not shown, so that the specificity of the experiment is good, otherwise, the specificity is bad; the blank area is used for ensuring that the experimental system is not polluted, and if the blank area does not detect viruses, the experimental system is not polluted, otherwise, the experimental system is polluted. Advantageously, three detection holes are arranged in the positive reference area, the negative reference area, the sample area and the blank area for each virus, so that the situation that a single hole fails to be amplified in a PCR amplification procedure is avoided, the detection efficiency is improved, and the detection error is reduced.
The 96-well plate 100 according to the principles of the present application is set up as shown in table 8 below for 5 viruses tested on the same pre-assembled well plate, wherein each of the a-E rows is used to test one virus and each cell in each row represents a test well. In Table 8, yang Can represents a detection well containing a positive reference, a sample represents a detection well into which the sample is placed, and a negative reference and a blank represent a negative reference well and a blank well, respectively, neither of which contains any control nucleic acid. Although CAV and FAdV are DNA viruses, the detection performance of CAV and FAdV is not affected under a one-step reverse transcription quantitative PCR system, and for convenience in detection, the same detection system is used for detecting the rest 4 RNA viruses on the same 96-well plate pre-plate.
TABLE 8 detection of functional area distribution of well plates
In each detection well of the detection well plate for each virus, the following substances are preloaded:
(1) All detection wells for each virus contained 5pmol total upstream primer mix, 15pmol total downstream primer mix, and 1pmol total probe mix;
(2) In each detection well for each virus in the positive reference zone, 0.5pg of positive control nucleic acid for the corresponding virus, 500ng of human placental DNA;
(3) The negative reference well, the sample detection well, and the blank detection well do not contain any remaining control nucleic acids.
In alternative embodiments, the assay well plate may be a well plate of other dimensions, such as a 48-well plate or 384-well plate, and may be selected according to the number of virus species to be detected and the specifications of the assay device.
The method for detecting avian viruses using the kit according to the principles of the present application is as follows:
1. Sample pretreatment
The collected sample may be pretreated using any viral pretreatment kit. During pretreatment, a negative control substance provided by the detection device is added, namely, human placenta DNA with the final concentration of 100ng/ul is added into a negative control detection hole.
2. Quantitative PCR detection reaction preparation
(1) The reaction solution for one-step reverse transcription quantitative PCR detection was prepared for the detection well plate, and 15. Mu.L of the prepared reaction solution was dispensed into each detection well, and the composition of the reaction solution was as shown in Table 9:
TABLE 9 quantitative PCR detection of reaction solution Components
Composition of the components Volume (mu L)
Nuclease-free water 805.6
One-step quantitative PCR reaction premix 530
External ginseng premix 212
External reference DNA 42.4
Total volume of 1590
It will be readily appreciated by those skilled in the art that the total volume of quantitative PCR reaction solution in the assay well plate should be greater than the amount required for use to ensure adequate reaction solution storage during use, and that a portion of the quantitative PCR reaction premix contains the buffers, polymerase and four deoxynucleotides dATP, dGTP, dCTP, dTTP required for the reaction, and that the external reference premix contains the upstream primer, downstream primer and probe for the external reference quantitative PCR amplification. The kit according to the principle of the present application may include each of the reaction solution components shown in table 9, which are prepared in advance, and the reaction solution components may be directly mixed and prepared for use.
(2) External reference DNA description
The reference DNA (DNA sequences used as external references) shown in table 10 and its corresponding reference premix were used to perform a reference amplification reaction independent of the amplification of the viral sequences of interest. Wherein the external reference premix contains a primer and a probe for specifically detecting a target fragment on the external reference DNA, the probe is marked at the 5 'end by HEX fluorescent groups so as to be different from FAM marking of the virus probe, and the 3' end of the probe is marked by MGB fluorescent groups. Because the fluorescent group amplified by external reference has HEX, the HEX can react with virus amplification in one test well at the same time, and the reaction result can be detected at the same time in different fluorescent channels. The template amount of the reference DNA is fixed so that the detection of the reference fragment in each test well is consistent and can be used to evaluate the homogeneity of the amplification system and whether or not the reaction system or sample has an inhibitor introduced therein, resulting in a false negative result of the detection. The sequence of the reference DNA is shown in Table 10.
TABLE 10 external reference DNA sequences
The sequences of the external reference primers and probes are shown in Table 11:
TABLE 11 sequences of external reference primers and probes
Name of the name 5' Modification Sequence(s) 3' Modification Sequence number
External reference to the forward direction GCTATTTCGCGTCTCGTTCTC SEQ ID NO.17
External parameters reverse direction GCGTATATGCGCTGCTCTCA SEQ ID NO.18
External reference probe HEX CGCGATTCGTACGCG MGB SEQ ID NO.19
3. Loading sample
The loading comprises the following steps:
(1) Adding 5 mu L of matrix solution into each well of a positive reference area of a detection pore plate, wherein the matrix solution comprises eluent, diluent, TE buffer or nuclease-free water after sample pretreatment;
(2) Adding 5 mu L of negative reference substance which is additionally processed in the pretreatment of the sample to each well of the negative reference area of the detection well plate;
(3) Adding 5 mu L of the sample pretreated solution to each well of the sample area of the detection well plate;
(4) Adding 5 mu L of nuclease-free water to each well in the blank area of the detection well plate;
(5) And placing the detection pore plate on a micro-pore plate centrifuge to quickly centrifugally mix the reaction system for 1 minute.
4. Detection reaction
The reaction program shown in Table 12 was set on the quantitative PCR apparatus; the signal acquisition is set in the fourth step, two fluorescent signals are set, one is a detection signal FAM of a virus sequence, and the other is an external reference sequence detection signal HEX.
TABLE 12 quantitative PCR reaction procedure for detection well plate
The assay well plate was placed on a quantitative PCR instrument and the assay was started.
5. Interpretation of results
(1) Experimental effectiveness
The validity of the experiment can be determined according to the following criteria:
a. the standard deviation of Ct or Cq values of all external reference detection on the detection pore plate cannot be larger than 1;
b. the average Ct or Cq value of the positive reference for each virus is less than 25;
c. At least 2 of the 3 duplicate wells for each virus in the negative reference region have a Ct or Cq value greater than 39.9 or N/a;
d. At least 2 of the 3 repeat wells in the blank have a Ct or Cq value greater than 39.9 or N/A.
If the experimental results meet the above 4, the experiment is effective.
(2) Detection result judgment
A. if the average Ct or Cq value for the wells of each virus in the sample area is <35, the corresponding viral nucleic acid is detected as positive;
b. If the average Ct or Cq value of the wells for each virus in the sample area is >35, repeated detection of the virus is required, if the Cq value is still detected
<39.9, The corresponding viral nucleic acid is detected as positive;
c. if the average Ct or Cq value for a well of a virus in the sample region is >39.9 or N/A, then the virus nucleic acid is detected as negative;
6. Detection result
Because of the limitation of virus operation, the inventors replaced viruses with a standard sample for detecting each virus at a lower limit concentration, and detected the performance of the kit by the above method, the amplification curves for the positive reference region, the negative reference region, the sample region and the blank region for each virus were shown in fig. 7 to 11, and the amplification curves for the reference DNA on the detection well plate were shown in fig. 12.
As can be seen from fig. 7-11, within 40 cycles, the positive reference and sample areas exhibited rapidly enhanced fluorescent signals relative to both the negative reference and blank areas, indicating that primer and probe sets and kits according to the principles of the present application were able to effectively detect the corresponding avian viruses. Wherein, the rapid enhanced fluorescence signal in the positive reference area indicates that the detection experiment is effective, and the reagent, the instrument and the like all run normally; the fact that the rapid enhanced fluorescent signal does not appear in the negative reference area of most viruses indicates that false positive does not appear in the detection process, and the fact that the enhancement of the fluorescent signal to a certain extent appears in individual holes in the negative reference area of a small number of viruses is caused by experimental errors indicates that the primer and the probe set kit according to the principle of the application are good in specificity; the blank areas have no fluorescence signal enhancement, which indicates that the experimental environment is uncontaminated and the experimental result is effective. As can be seen from the amplification curves of FIG. 12, the reference DNA amplification curves of the different wells on each assay well plate have substantially the same shape within 40 cycles, indicating good uniformity of the amplification system and absence of inhibitors in the reaction system. The detection result shows that the primer and probe combination and the kit have good detection effect.
While at least one exemplary embodiment has been presented in the foregoing detailed description, it should be appreciated that a vast number of variations exist. It should also be appreciated that the exemplary embodiment or exemplary embodiments described herein are only examples, and are not intended to limit the scope, applicability, or configuration of the application in any way. Rather, the foregoing detailed description will provide those skilled in the art with a convenient road map for implementing the exemplary embodiment or exemplary embodiments. It should be understood that various changes, modifications, or alterations can be made in the function and arrangement of elements without departing from the scope of the application as set forth in the appended claims and the equivalents thereof.

Claims (10)

1. A primer and probe combination for simultaneously detecting a plurality of avian viruses, wherein the primer and probe combination comprises at least any two of the following primer and probe sets:
a first primer and probe set comprising primers shown as SEQ ID NO.1 and SEQ ID NO.2, and a probe shown as SEQ ID NO. 3;
a second primer and probe set comprising primers shown as SEQ ID NO.4 and SEQ ID NO.5, and a probe shown as SEQ ID NO. 6;
a third primer and probe set comprising primers shown as SEQ ID NO.7 and SEQ ID NO.8, and a probe shown as SEQ ID NO. 9;
A fourth primer and probe set comprising primers shown as SEQ ID NO.10 and SEQ ID NO.11, and a probe shown as SEQ ID NO. 12;
and a fifth primer and probe set comprising primers shown as SEQ ID NO.13 and SEQ ID NO.14, and a probe shown as SEQ ID NO. 15.
2. The primer and probe combination of claim 1, wherein each of the 5 'ends of SEQ ID No.3, SEQ ID No.6, SEQ ID No.9, SEQ ID No.12, SEQ ID No.15 is modified with a FAM group and each of the 3' ends is modified with an MGB group.
3. A kit for simultaneous detection of multiple avian viruses, comprising the primer and probe combination of claim 1 or 2.
4. A kit according to claim 3, comprising a detection well plate provided with a positive reference area, a negative reference area, a sample area and a blank area, wherein three detection wells are provided for each virus in the positive reference area, the negative reference area, the sample area and the blank area.
5. The kit according to claim 4, wherein the detection wells for each virus in the detection well plate comprise a first primer and probe set, a second primer and probe set, a third primer and probe set, a fourth primer and probe set, and a fifth primer and probe set, respectively.
6. The kit of claim 5, wherein the positive reference zone further comprises a positive control nucleic acid for the target virus in a detection well for each virus.
7. The kit of claim 6, further comprising PCR reaction solution components comprising nuclease-free water, quantitative PCR reaction premix, external reference premix, and external reference DNA.
8. The kit of claim 7, wherein the external reference premix comprises primers shown as SEQ ID NO.17 and SEQ ID NO.18, and a probe shown as SEQ ID NO.19, and the external reference DNA has a sequence shown as SEQ ID NO. 16.
9. The kit of claim 8, wherein the 5 'end of SEQ ID No.19 is modified with a HEX group and the 3' end is modified with an MGB group.
10. Use of a primer and probe combination as claimed in claim 1 or 2, or a kit as claimed in any one of claims 3 to 9, for detecting avian viruses.
CN202410310177.5A 2024-03-18 2024-03-18 Primer and probe combination for detecting various avian viruses, kit and application thereof Pending CN118028538A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202410310177.5A CN118028538A (en) 2024-03-18 2024-03-18 Primer and probe combination for detecting various avian viruses, kit and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202410310177.5A CN118028538A (en) 2024-03-18 2024-03-18 Primer and probe combination for detecting various avian viruses, kit and application thereof

Publications (1)

Publication Number Publication Date
CN118028538A true CN118028538A (en) 2024-05-14

Family

ID=90995023

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202410310177.5A Pending CN118028538A (en) 2024-03-18 2024-03-18 Primer and probe combination for detecting various avian viruses, kit and application thereof

Country Status (1)

Country Link
CN (1) CN118028538A (en)

Similar Documents

Publication Publication Date Title
CN113502352B (en) EMA-ddPCR primer and probe for detecting infectious ASFV and application
CN105861641A (en) Primer, kit and method for detecting CHO cell DNA residues
CN106868220A (en) A kind of LAMP primer group and kit for expanding MERS CoV
CN112813195A (en) Novel quantitative detection kit for coronavirus nucleic acid based on micro-droplet digital analysis
CN112725475A (en) Mycobacterium tuberculosis detection primer, probe composition, kit and application
CN114134252A (en) Primer and kit for detecting coronavirus
CN114634996B (en) Primer probe combination and kit for detecting bovine respiratory disease and application of primer probe combination and kit
CN113718063A (en) Multi-chip digital PCR primer, kit and detection method for simultaneously detecting ASFV, PCV2 and PRV viruses
CN109762932A (en) Identify the detection primer and probe, kit and application of HP-PRRSV and NADC30-like strain
CN102994650B (en) Multi-gene detection method of encephalitis viruses based on capillary electrophoresis
CN108559789A (en) Cat coronavirus fluorescence EMA detection primers group, kit and detection method
CN118028538A (en) Primer and probe combination for detecting various avian viruses, kit and application thereof
CN113801963B (en) Primer probe combination, kit and method for detecting coronavirus
CN102367494B (en) Primer, probe and kit with primer and probe for multiple real-time fluorescence PCR (polymerase chain reaction) detection of mouse-derived RNA (ribonucleic acid) viruses
CN115976272A (en) TaqMan fluorescent quantitative PCR method for rapidly detecting prawn hemangiocyte iridovirus
CN102329889B (en) Primer and probe and method for detecting poxvirus muris
CN113512611A (en) Gene membrane chip-based method for detecting various respiratory viruses
CN118256658A (en) Primer and probe combination for detecting various insect viruses, kit and application of kit
CN111575403A (en) High-throughput digital PCR kit for detecting RNA virus nucleic acid and detection method
CN113930418A (en) Nucleic acid releasing agent and method for releasing nucleic acid
CN117625851A (en) Primer and probe combination for detecting various simian viruses, kit and application of kit
CN117385104A (en) Primer and probe combination for detecting multiple bovine viruses, kit and application of kit
CN117004747B (en) Primer probe set for multiplex real-time fluorescence PCR, detection method and application
WO2023181694A1 (en) Nucleic acid processing efficiency calculation method, nucleic acid quantitative value correction method using same, and target rna measurement device
CN117551747B (en) QPCR (quantitative polymerase chain reaction) specificity detection method based on multiple TaqMan, kit and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination