CN118005753A - Excrine peptide, recombinant vector, cell and application thereof - Google Patents

Abstract

The invention discloses an exopeptide, a recombinant vector, a cell and application thereof. The amino acid sequence of the exopeptide is shown as SEQ ID NO. 1; the gene sequence is shown as SEQ ID NO. 2. The exopeptide has remarkable exoprotein activity, and after the exopeptide is exogenized to the chitosan enzyme, the chitosan enzyme still has the function of degrading chitosan.

Description

Excrine peptide, recombinant vector, cell and application thereof

Technical Field

The invention relates to the field of genetic engineering, in particular to an exopeptide, a recombinant vector, a cell and application thereof.

Background

Oyster is called as "submarine milk", contains rich protein, fat, phosphorus, iron and other nutrient components, has delicious taste, and is deeply favored by people. Statistically, 2021, the oyster cultivation area in Fujian province reaches 3.7 ten thousand hectares, the yield reaches 211.2 ten thousand tons, and the first place is national. Behind the huge oyster consumer market, hidden is the pollution problem brought by oyster shells. It is calculated that 147.84 ten thousand tons of waste oyster shells are produced only in the Fujian province 2021. The random accumulation of oyster shells not only occupies a large amount of land resources, but also causes great environmental pollution, and the most main reason is that the oyster shells are difficult to degrade and degradation products thereof are difficult to use. Chitosan is one of the oyster shell degradation products, and the oligomeric chitosan produced by further degradation has a plurality of unique biological activities, which are mainly represented by: 1) The chitosan oligosaccharide has broad-spectrum antibacterial activity, and the antibacterial effect on various cocci, bacilli and fungi is known from the antibacterial experimental result of chitosan. 2) The chitosan oligomer has good biocompatibility, and experiments prove that the chitosan oligomer has no toxicity, so the chitosan oligomer is often used as a drug slow-release material to be applied to the field of biological medicine. 3) In addition, the chitosan oligosaccharide has obvious moisturizing performance, and can be applied to moisturizing, sun-screening and other skin care products in combination with the antibacterial function. Thus, the preparation of oligomeric chitosan by degradation of polymeric chitosan is a current research focus.

At present, the degradation of chitosan is mainly carried out by a physical method, a chemical method and an enzymatic method. The physical method and the chemical method break the beta-1, 4 glycosidic bond of the chitosan by mainly using mechanical force or strong acid and other chemical reagents with extremely strong oxidizing property, so as to obtain the chitosan oligomer, but the methods still have a plurality of problems, such as difficult control of the reaction, serious environmental pollution, low product yield, incomplete reaction and the like. The enzymatic degradation of chitosan mainly degrades high-polymer chitosan by a biocatalytic method, the reaction temperature is lower, the reaction environment is close to pH7.0, and the molecular weight of the product is controllable, so that compared with other two degradation modes, the enzymatic degradation has the advantages of higher cost and complex purification process.

Chitosan hydrolase is an enzyme produced by bacteria and fungi that catalyzes the production of chitosan to chitosan oligosaccharides, mainly from Glycoside Hydrolase (GH) families 8, 46, 75 and 80, where the mechanism of binding of the GH8 family of chitosanase to glycosyl has been extensively studied, such as charged amino acids and hydrophobic amino acids in the active structural region of the ChoK enzyme are capable of specifically recognizing Glc and GlcN residues. However, chitosan hydrolase is used as an intracellular enzyme, the purification process is complicated, the purification cost is high, and the industrial preparation and application of the chitosan hydrolase are limited.

Vibrio natrii is a gram-negative bacterium of marine origin, the growth rate of which is one time that of escherichia coli, and is the fastest growing nonpathogenic bacterium at present, and therefore, is widely paid attention to and studied. The development and use of vibrio natrii chassis cells has achieved preliminary results, but the development and use of functional elements in their genomes remains a focus of attention.

Based on genome information of vibrio natrii, the polypeptide with an exocrine function is excavated, and exocrine production of chitosan hydrolase is combined, and the polypeptide is applied to hydrolysis of chitosan, so that the problem of high cost of degrading chitosan by an enzyme method is solved, and the polypeptide has a good application prospect.

Disclosure of Invention

The invention aims to provide an exopeptide with higher exocrine activity.

In order to achieve the aim, the invention provides an exopeptide with an exocrine function, which is characterized in that the amino acid sequence of the exopeptide is shown as SEQ ID NO. 1.

The invention also provides a gene sequence for encoding the exopeptide, which is characterized in that the gene sequence is shown as SEQ ID NO. 2.

The invention also provides a recombinant vector which is characterized by comprising a gene sequence of the exopeptide; or a gene sequence containing the exopeptide and a chitosan hydrolase sequence.

The invention also provides a recombinant strain which is characterized by comprising the recombinant vector.

The invention also provides a host cell, which is characterized by comprising the strain.

The invention also provides an application method of the exopeptide in whole cell catalytic degradation, which is characterized in that after the recombinant vector containing the gene sequence of the exopeptide and the chitosan hydrolase sequence is induced to express, chitosan is added into a culture medium to react, so that the chitosan can be degraded.

Further, the working concentration of the chitosan is 1-4g/L; the reaction condition is 30-37 ℃, and the reaction pH is 7.0+/-1; the time is 70+/-10 hours.

The exopeptide is derived from vibrio natrii ATCC14048 and is a polypeptide sequence with exocrine function which is not found in other microorganisms.

The exopeptide of the invention has higher exocrine activity, which is 5 times higher than that of the reported exocrine peptide Aly.

In the present invention, various vectors known in the art, such as plasmids, phages, retroviruses and the like, may be used.

The recombinant expression vectors of the invention may be introduced into host cells by methods well known in the art, including: calcium chloride heat shock, spot transformation, PEG mediated, gene gun, and the like.

When the function of the exopeptide is verified, the anti-GFP antibody is used for detecting the his-GFP secreted in the filtered supernatant of the escherichia coli bacterial liquid carrying the pET-28a (+) -ZYL-his-GFP plasmid, and the exopeptide provided by the invention has the exofunction through a western blotting method.

In summary, the invention has the following effective benefits:

1. According to the invention, the potential polypeptide sequence with the exocrine function in vibrio natrii is predicted through SignalP5.0 screening, and is recombined and expressed in escherichia coli to obtain the recombined escherichia coli engineering strain E.coil pET-28a (+) -ZYL capable of expressing the exocrine polypeptide sequence, so that the resource is widened for the excavation and application of exocrine peptide.

2. When the extracted exopeptide sequence is connected with green fluorescent protein to perform exocrine function characterization, the exocrine efficiency of the extracted exocrine peptide sequence is improved by 4.8 times compared with that of the reported exocrine peptide Aly.

3. The exopeptide-linked chitosan hydrolase recombinant strain E.coil pET-28a (+) -ZYL-ChoK provided by the invention has the function of catalyzing and degrading chitosan by whole cells, and the optimal catalysis condition is that the chitosan addition amount is 2g/L, the reaction temperature is 37 ℃, the reaction pH is 7.0, and the catalytic activity of the exochitosan hydrolase reaches 0.257U/ml.

Drawings

FIG. 1 is a predictive view of the ectopeptide ZYL screened by SignalP5.0 software against the Vibrio natriuretic genome sequence.

FIG. 2 is a DNA gel electrophoresis of the extracellular peptide ZYL linked to a green fluorescent protein sequence.

FIG. 3 is a graph showing the efficiency of exopeptide ZYL and the reported exopeptide Aly in exo-protein by Western blotting.

FIG. 4 is a graph showing the effect of whole cell catalytic chitosan hydrolysis after exogenously linked to chitosan hydrolase.

Detailed Description

Embodiments of the present invention are described in detail below, examples of which are illustrated in the accompanying drawings, wherein like or similar reference numerals refer to like or similar elements or elements having like or similar functions throughout. The embodiments described below by referring to the drawings are illustrative and intended to explain the present invention and should not be construed as limiting the invention. The specific techniques or conditions are not identified in the examples and are performed according to techniques or conditions described in the literature in this field or according to the product specifications. The reagents or apparatus used were conventional products commercially available without the manufacturer's attention.

Coli E.coil BL21 (DE 3) was purchased from Shanghai Bioengineering Co., ltd; the sequence of the chitosan hydrolase gene (ChoK) (PDB: 1V 5D), and the sequence of the Green Fluorescent Protein (GFP) (NCBI: WP-012569506.1) were all synthesized by the company Kirschner.

Example 1: excavating and exocrine function characterization experiments of exocrine peptides

The potential exopeptide genes in the genomic DNA of Vibrio natriurus ATCC14048 were selected using SignalP5.0 based on the genomic sequence from Vibrio natriurus ATCC14048 found from NCBI. The signal peptide ZYL of the cell membrane transferase (Lytic murein transglycosylase) after a series of comparison was predicted to have an exocrine function, and the predicted results of the signal peptide are shown in table 1 and fig. 1. Meanwhile, the signal peptide is used for delivering the protein to a designated place, and the cleavage site is between 19 th amino acid and 20 th amino acid of the signal peptide: AFA-SS.

TABLE 1 predicted results for exopeptides

Construction of pET-28a (+) -ZYL-his-GFP plasmid: ZYL-his-GFP gene fragment (wherein ZYL nucleic acid sequence is shown as SEQ ID NO:2, amino acid sequence is shown as SEQ ID NO:1, histidine tag (his) sequence is shown as SEQ ID NO:3, GFP nucleic acid sequence is shown as NCBI number: WP_ 012569506.1) is connected between two restriction endonucleases of pET-28a plasmid NdeI and XhoI to obtain pET-28a (+) -ZYL-his-GFP plasmid, which is sent to Kirschner bioengineering Co., ltd.

Meanwhile, a reported Aly01 exopeptide (the nucleic acid sequence of which is shown as SEQ ID NO: 4) is selected as a comparison, and a pET-28a (+) -Aly01-his-GFP plasmid is constructed: the Aly-his-GFP gene fragment was ligated between the two restriction endonucleases NdeI and XhoI of pET-28a plasmid, and was synthesized by Ginsry Bioengineering Co.

The plasmid synthesized above was transformed into competent cell E.coil BL21 (DE 3), the transformed product was spread on LB solid medium, cultured in an incubator at 37℃for 12-16 hours, and then 5 single colonies were picked up on a plate for colony PCR.

Wherein, the PCR result verification is carried out by using a T7 universal primer, and the primer sequences are as follows:

T7F：TAATACGACTCACTATAGGG。SEQ ID NO:5。

T7R：TGCTAGTTATTGCTCAGCGG。SEQ ID NO:6。

the PCR system is as follows: PRIMERSTART Mix12.5. Mu.L, 1. Mu.L (10. Mu.M) of each of the upstream and downstream primers, a few cells, and ddH ₂ O were added to 25. Mu.L.

The PCR amplification conditions were: (1) denaturation at 95℃for 5min, (2) denaturation at 95℃for 30s, (3) annealing at 55℃for 30s, (4) extension at 72℃for 30s, repeating steps (2) to (4) for 25-30 cycles, finally extension at 72℃for 10min, and preservation of the PCR product at 4 ℃.

The PCR amplified products were detected by 0.8% agarose gel electrophoresis, and the detection results were shown in FIG. 2, to obtain a positive clone strain carrying BL21-pET-28a (+) -ZYL-his-GFP plasmid.

Coli harboring pET-28a (+) -Aly-his-GFP and E.coli harboring pET-28a (+) -ZYL-his-GFP were added to 10mL LB medium containing 100. Mu. Mol/L IPTG and 40. Mu.g/mL kanamycin at 37℃and cultured at 200rpm for 12 hours in 1% inoculum size. Chloramphenicol was added to the overnight culture broth at a final concentration of 12.5. Mu.g/mL to stop bacterial growth. Then, 800. Mu.L of the bacterial liquid was mixed with 100. Mu.L of 10 XNaN 3 (final concentration 20 mM) and 100. Mu. L M9 of the medium solution to terminate the excretion. 100. Mu.L of the mixture was taken to determine whether his-GFP was synthesized, and the remaining 900. Mu.L of the mixture was centrifuged at 6000rpm for 3min, followed by taking the supernatant as a Western Blot (0.22 μm).

The above-mentioned membrane-coated sample was subjected to SDS-PAGE. After electrophoresis, the protein gel and a Nitrocellulose (NC) membrane are soaked in precooled Western transfer membrane liquid (Biyun Tian, china), and the protein gel is stuck on one surface of the NC membrane and is kept stand in the transfer membrane liquid for 5min. The albumin glue is placed at the center of a sandwich structure of the gel bracket transfer clamp facing the negative electrode and the NC film, and is clamped after removing bubbles. Will be small-sizedTransfer tank (Bio-Rad, USA) is placed/>And transferring the film for 1h at a constant pressure and a low temperature of 100V in a Tetra electrophoresis tank. The albumin glue was discarded, the NC membrane was removed and placed in a blocking solution (1 XTBST with 5% skimmed milk powder) for blocking at room temperature for 1h or overnight at 4 ℃. After washing the NC membrane with 1×tbst, the NC membrane was placed in an antibody incubation bag, and a primary anti-diluent 1:1000 volume ratio of diluted primary antibody (Anti-GFP Mouse Monoclonal Antibody, transGen, china) incubated for 1-2h at room temperature. Rinse for 10min using 1×tbst and repeat three times. NC membranes were placed in antibody incubation bags and 1×tbst 1 was used with the addition: secondary antibodies diluted at 5000 (Goat Anti-Mouse HRP Conjugate, transGen, china) were incubated for 1-2h at room temperature. After rinsing for 10min with 1 XTBST and repeating three times, NC membrane was again placed in antibody incubation bag. Will/>Buffer A and Buffer B1 of Western Blot Kit (TransGen, china): 1 mix and develop, the results were observed on an AI600 imager (GE, usa).

As a result, as shown in FIG. 3, the total amount of the fluorescent protein of the E.coli with pET-28a (+) -Aly-his-GFP was significantly lower than that of the E.coli with pET-28a (+) -ZYL-his-GFP, and the ZYL was about 4.8 times as efficient as Aly.

Example 2: application of exopeptide in whole cell catalysis

Based on the verification of the function of the exopeptide, the exopeptide was linked to a chitosan hydrolase (ChoK) derived from Mitsuaria chitosanitabida to construct a pET-28a (+) -ZYL-his-ChoK plasmid: the ZYL-his-ChoK gene fragment was ligated between the two restriction endonucleases NdeI and XhoI of pET-28a plasmid, and was synthesized by the company Chemie Bioengineering, inc. And performing a whole-cell catalytic hydrolysis chitosan experiment.

PET-28a (+) -ZYL-his-ChoK plasmid was transformed into E.coli. Plasmid transformation: taking a tube BL21 (DE 3) from a refrigerator at the temperature of minus 80 ℃, placing the tube BL21 (DE 3) on ice for melting, adding 10 mu l of target plasmid, placing on ice after gently mixing, and incubating for 30min; then taking out the mixture and placing the mixture in a water bath kettle at 42 ℃ for heat shock for 45s; then rapidly transferring to ice and placing for 2min, adding 500 μl of sterile LB culture medium into a centrifuge tube, placing into a shaking table at 37deg.C and 200rpm for culturing for 1 hr, sucking 100 μl, coating onto LB agar plate with kanamycin (1%v/v) resistance, and culturing at 37deg.C for 12-16 hr in a constant temperature incubator. 5 single colonies were picked on the plates and colony PCR was performed to determine positive clone strains.

E.coli carrying pET-28a (+) -ZYL-his-ChoK was added to 10mL LB medium containing 40. Mu.g/mL kanamycin at 37℃and cultured at 200rpm until OD ₆₀₀ reached 0.6-0.8 in accordance with 1% inoculum size, and chitosan hydrolase expression was induced by adding 100. Mu.mol/L IPTG. After 24 hours of induction expression, 1g/L, 2g/L, 3g/L and 4g/L of chitosan are respectively added into the culture medium, and the capability of the exopeptide-added chitosan hydrolase to perform whole cell catalysis is verified.

As shown in FIG. 4, when 2g/L chitosan is added into the culture medium along with the change of time, the exocrine chitosan hydrolase can hydrolyze the chitosan to generate 2.14mg of glucose, the hydrolysis effect is optimal, and along with the increase of the concentration of the chitosan, the hydrolysis effect is reduced to some extent, and the chitosan with too high concentration possibly has a certain inhibition effect on the growth of escherichia coli.

Although embodiments of the present invention have been shown and described above, it will be understood that the above embodiments are illustrative and not to be construed as limiting the invention, and that variations, modifications, alternatives, and variations may be made in the above embodiments by those skilled in the art without departing from the spirit and principles of the invention.

Claims (7)

1. An exopeptide with exocrine function, which is characterized in that the amino acid sequence of the exocrine peptide is shown as SEQ ID NO. 1.

2. A gene sequence encoding the exopeptide of claim 1, wherein the gene sequence is set forth in SEQ ID No. 2.

3. A recombinant vector comprising the gene sequence of the exopeptide of claim 2; or a gene sequence comprising the exopeptide of claim 2 and a chitosan hydrolase sequence.

4. A recombinant strain comprising the recombinant vector of claim 3.

5. A host cell comprising the recombinant strain of claim 4.

6. An application method of exopeptide in whole cell catalytic degradation is characterized in that after the recombinant vector containing the gene sequence of the exopeptide and the chitosan hydrolase sequence of claim 2 is induced to express, chitosan is added into a culture medium to react, so that chitosan can be degraded.

7. The method of claim 6, wherein the chitosan has a working concentration of 1-4g/L; the reaction condition is 30-37 ℃, and the reaction pH is 7.0+/-1; the time is 70+/-10 hours.