CN117965640A - COL17A1 transgenic zebra fish and construction and application thereof - Google Patents

Abstract

The invention discloses COL17A1 transgenic zebra fish and construction and application thereof. The human COL17A1 gene sequence is knocked into the zebra fish chromosome by using CRISPR-Cas9 technology, so that COL17A1 transgenic zebra fish is constructed, and human XVII type collagen (180 kDa) is expressed. The invention uses CRISPR-Cas9 gene editing technology to integrate human COL17A1 gene sequence into zebra fish genome for the first time, and uses zebra fish as carrier to express human XVII type collagen for the first time, so as to provide high-quality and safe collagen materials in the fields of biomedicine, medical cosmetology, cosmetics, food and the like.

Description

COL17A1 transgenic zebra fish and construction and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to COL17A1 transgenic zebra fish and construction and application thereof.

Background

Collagen is one of the most abundant structural proteins in mammals, and is mainly distributed in different connective tissues. The special triple helix structure endows collagen with various biological characteristics, so that the collagen is widely applied to the fields of biomedicine, medical cosmetology, cosmetics, food and the like. More than 20 different types of collagen have been found, of which the human COL17A1 gene encodes type XVII collagen (180 kDa), a transmembrane collagen, which is mainly found in epithelial cells and has a number of important physiological functions, such as: promoting wound healing and repairing, maintaining skin stability, resisting skin aging, and preventing canities and alopecia.

At present, there are few reports on research on products using recombinant full-length human XVII type collagen at home and abroad, and research on the collagen is more on a gene level. Thus, if the collagen can be successfully produced and obtained, the collagen may be helpful for promoting further development in biomedical and other related fields. However, there are many limitations to extracting or using genetically engineered collagen by conventional methods, and thus, when selecting a collagen source, factors such as safety, quality, and economic benefit are comprehensively considered to ensure effective application in various fields. Zebra fish, in contrast, is a more advantageous collagen expression system. The method is characterized in that:

(1) In contrast to terrestrial animal sources: zebra fish is a freshwater fish, collagen obtained from the zebra fish has lower immunogenicity and rejection reaction and higher safety.

(2) In contrast to marine sources: the use of collagen is limited by its thermal stability, which is related to the body temperature and the living environment of the organism. In most cases, this limitation affects the use of collagen by marine organisms. Zebra fish is a tropical freshwater fish with an optimal growth temperature of 28.5 ℃. Therefore, the collagen extracted from zebra fish has higher thermal stability and has application advantages compared with the collagen extracted from marine organisms.

(3) In contrast to heterologous expression systems such as mammalian cells, microorganisms, transgenic plants, etc.: firstly, although the recombinant collagen technology is widely used in different expression hosts, the produced recombinant collagen has poor structural stability. To form a relatively stable triple helix structure, it is often necessary to express it in combination with a hydroxylase, which increases the difficulty and cost of constructing the expression system; secondly, even if a hydroxylase from a non-self source is introduced, the host metabolism can be stimulated, and the collagen yield is reduced, for example, a pichia pastoris expression system; thirdly, the conventional expression system has lower life level, the problem of difficult production of full-length collagen is also limited to further application of recombinant collagen, and mammals can express the full-length collagen, but the culture cost is higher. In contrast, zebra fish is a vertebrate animal with smaller body size, the expression system is relatively easy to construct, and the collagen produced by the zebra fish has higher structural stability and also has the possibility of producing full-length human collagen. The characteristics reduce the difficulty and cost of strain construction, and are expected to promote large-scale industrial production. Therefore, zebra fish has great potential as a collagen expression system based on various superior characteristics of the zebra fish.

(4) In contrast to synthetic sources: the molecular weight of the collagen material obtained by adopting the chemical synthesis method is generally smaller, and the synthesis cost is higher, so that the collagen material can be only used for laboratory researches. The zebra fish can be bred in four seasons, the spawning quantity is large, and if the zebra fish strain expressing the human collagen can be successfully constructed, the human collagen can be produced with higher production efficiency and lower cost in the future, and the zebra fish strain makes an important contribution to scientific research and society.

Based on the method, the zebra fish is firstly utilized as the collagen expression system, and the CRISPR-Cas9 gene editing technology is used for constructing the COL17A1 transgenic zebra fish strain, so that a brand new collagen expression system is developed; zebra fish is used as carrier to express human XVII type collagen, so as to provide high-quality and safe collagen materials in the fields of biomedicine, medical cosmetology, cosmetics, food and the like.

Disclosure of Invention

The invention aims to provide COL17A1 transgenic zebra fish and construction and application thereof.

In order to achieve the above purpose, the invention adopts the following technical scheme;

A construction method of COL17A1 transgenic zebra fish capable of expressing XVII type collagen is characterized in that a CRISPR-Cas9 gene editing technology is utilized to knock a human COL17A1 gene sequence into a zebra fish chromosome, and the human COL17A1 gene sequence is shown as SEQ ID NO. 6.

The construction method comprises the following steps:

s1: selecting a target sequence on the zebra fish genome;

S2: constructing a donor plasmid pBluescript SK-COL17A1; the donor plasmid pBluescript SK-COL17A1 comprises an original skeleton vector and an insertion fragment, wherein the insertion fragment comprises a PAM2 region sequence, a left arm 5'arm sequence, a CMV promoter sequence, a human COL17A1 gene sequence, a PolyA signal sequence, a right arm 3' arm sequence and a PAM2 region sequence which are connected in sequence;

s3: determining specific target sites of COL17A1 genes, and obtaining Cas9 mRNA, sgRNA1 and sgRNA2 by means of in vitro transcription;

S4: microinjection of donor plasmids pBluescript SK-COL17A1, cas9 mRNA, sgRNA1 and sgRNA2 into zebra fish fertilized eggs;

s5: PCR screening to obtain COL17A1 transgenic zebra fish strain.

In the step S1, the sequence of the target sequence is shown as SEQ ID NO. 1.

In the step S2, the PAM2 region sequence is shown in SEQ ID No.4, the left arm 5'arm sequence is shown in SEQ ID No.2, the CMV promoter sequence is shown in SEQ ID No.5, the poly a signal sequence is shown in SEQ ID No.7, and the right arm 3' arm sequence is shown in SEQ ID No. 3.

In the step S3, the Cas9 mRNA sequence is shown in SEQ ID No.13, the sgRNA1 sequence is shown in SEQ ID No.10, and the sgRNA2 sequence is shown in SEQ ID No. 11.

In the step S4, the microinjection system includes: donor plasmid pBluescript SK-COL17A1300 ng/. Mu.L, cas9 mRNA 100 ng/. Mu.L, sgRNA150 ng/. Mu.L, sgRNA250 ng/. Mu.L.

COL17A1 transgenic zebra fish constructed by the construction method.

The application of the COL17A1 transgenic zebra fish comprises one or more of the following:

1) The application in the preparation of XVII type collagen;

2) Use in the preparation of a product for promoting wound healing;

3) Use in the preparation of a product for promoting skin repair.

The invention has the remarkable advantages that:

the invention utilizes CRISPR-Cas9 gene editing technology to successfully knock a humanized COL17A1 gene sequence into a zebra fish chromosome for the first time, constructs COL17A1 transgenic zebra fish, and uses the zebra fish as a carrier to express humanized XVII type collagen. Donor plasmids pBluescript SK-COL17A1, cas9 mRNA, sgRNA1 and sgRNA2 were microinjected into zebra fish. As shown in fig. 1, sgRNA1 with guiding function guides Cas9 endonuclease to cut in PAM1 region of target spot on chromosome, so that DNA is subjected to double strand break, and then cells are induced to generate DNA damage repair; whereas sgRNA2 directs Cas9 endonuclease cleavage on pBluescript SK-COL17A1, allowing the gene fragment of interest to be isolated from the plasmid. The DNA double-strand break region on the chromosome is complementary and paired with the homologous arm base on the target gene segment, and the chromosome uses the exogenous target gene segment as a template to carry out homologous recombination repair, so that the target gene COL17A1 full-length sequence is integrated on the zebra fish chromosome, and the COL17A1 transgenic zebra fish is obtained. COL17A1 transgenic zebra fish is used as a carrier to express human XVII type collagen, and compared with other sources, the collagen has higher economical efficiency, safety and wide application value. The research of hemolysis experiments and mouse skin wound healing experiments by using total collagen extracted from COL17A1 transgenic zebra fish shows that the invention can provide a novel collagen material for skin wound healing.

Drawings

Fig. 1: principle of human COL17A1 gene knock-in.

Fig. 2: PCR identification of the donor plasmid pBluescript SK-COL17A 1.

Fig. 3: and identifying the COL17A1 transgenic zebra fish. A: PCR amplifying a two-sided mutation position product electrophoresis chart; b: PCR amplification of the flanking mutation site product sequencing results.

Fig. 4: detection of human XVII type collagen (180 kDa) from F0×WT zebra fish. F0×wt is the offspring zebra fish of the F0-generation positive zebra fish and the wild-type zebra fish, and wt×wt is the offspring zebra fish of the wild-type zebra fish and the wild-type zebra fish. The internal reference is Tublin (52 kDa).

Fig. 5: total collagen extracted from COL17A1 transgenic zebra fish was used for the study of hemolysis experiments. A: each group of hemolysis at different time points; b: the results of the hemolysis rate detection of each group. Each set of data is expressed as mean±standard deviation (mean±sd), n=3.

Fig. 6: total collagen extracted from COL17A1 transgenic zebra fish is used in mouse skin wound healing experiment. A: healing of skin wound of mice at different time points; b: skin wound area diagrams of mice at different time points; c: quantitative analysis of skin wounds of mice at different time points. * P <0.05, < p <0.01 and p <0.001 are significant based on the ANOVA analysis of the NS group. Each set of data is expressed as mean±standard deviation (mean±sd), n=6.

Detailed Description

In order to make the contents of the present invention more easily understood, the technical scheme of the present invention will be further described with reference to the specific embodiments, but the present invention is not limited thereto.

Example 1: efficient target selection on zebra fish genome

Following prediction and validation of target specificity from target, the non-protein coding region on the zebra fish chromosome, 5'-ACAGCTATTCTTTACAGTGTAGG-3' (SEQ ID NO. 1) was selected as the target sequence, designated as the PAM1 region. Sequences with two sides of 134bp and 156bp are selected near the target sequence and used as homologous arms for homologous recombination repair, which are respectively called a left arm 5'arm and a right arm 3' arm, and the sequences are shown as follows:

left arm 5' arm sequence:

5'-

GCCCACATCTCCATTTGAGAGGAATAGAATAAACAGCCATAATATGAAATATAGCAACAG

TGTTGTTTAAGATCAACATTTACGGTCATTGTGACTTGTGGGGATGTTTGGTCCACGCAA TCACACACACACAC-3 (SEQ ID NO. 2), right arm 3' arm sequence:

5'-

GCACATGCACACACACACTCACAATGCAAATAAATTTTATTGTGATATTCGAAAGGAAAT

TTACCAGCAATGATGTAAAATTGGCCAGTAATACTGTAAAATTTACCAGTGCACTAAGTT AACAATTACAACTGTTGTAGTTTTACAGTACAAGTG-3'(SEQ ID NO.3).

example 2: design and preparation of pBluescript SK-COL17A1 donor plasmid

The construction process of the donor plasmid pBluescript SK-COL17A1 is as follows: firstly, designing a primer, and obtaining a pBluescript SK (-) skeleton fragment, a PAM2 region sequence, a left arm 5'arm sequence, a CMV promoter sequence, a human COL17A1 gene sequence, a PolyA signal sequence and a right arm 3' arm sequence required by a donor plasmid pBluescript SK-COL17A1 through a PCR technology, wherein the pBluescript SK (-) skeleton fragment is obtained by using an original skeleton vector pBluescript SK (-) as a template and using 5'-GCTGGCAGCTTTTGTTCCCTTTAGTGAGGG-3' and 5'-GAGATGGCAACCGGACTACCAATTCGCCCTATAGTGAGTCG-3' as primers for amplification; purifying and recovering PAM2 region sequence, right arm 3'arm sequence and PolyA signal sequence, connecting the sequences by overlapping PCR technology after the sequences are correct, and assembling into PAM2-3' arm Poly (A) segment; purifying and recovering the CMV promoter sequence, the left arm 5'arm sequence and the PAM2 region sequence, and connecting the sequences by an overlap PCR technology after the sequences are correct to assemble a CMV-5' arm-PAM2 fragment; the PAM2-3'arm Poly (A) fragment, the pBluescript SK (-) skeleton fragment and the CMV-5' arm-PAM2 fragment are purified and recovered, and are connected through a seamless cloning kit (CU 101, beijing full-scale gold biotechnology Co., ltd.) after the sequencing is correct, so as to obtain a PAM2-3'arm Poly (A) -pBluescript-CMV-5' arm-PAM2 skeleton vector; the human COL17A1 gene sequence is purified and recovered, after the sequencing is correct, the sequence is inserted into the downstream of the CMV promoter of the PAM2-3'arm Poly (A) -pBlueScript-CMV-5' arm-PAM2 skeleton vector through a seamless cloning kit (CU 101, beijing full gold biotechnology Co., ltd.), and then transferred into an escherichia coli Trans1-T1 competent cell (Beijing full gold biotechnology Co., ltd.), recombinants are picked up and used for PCR verification (figure 2) by using 5'-ATGGGTGGAGTATTTACGGTAAACTG-3' and 5'-TGGGGAGTGTGTTGGAGGAATT-3' as primers, and the sequencing is carried out, if the PCR verification result of the recombinants is that: the electrophoresis band appeared at 1054bp, indicating successful construction of the donor plasmid pBluescript SK-COL17A 1.

As shown in FIG. 1, the donor plasmid pBluescript SK-COL17A1 finally obtained by the construction method comprises an original skeleton vector and an insert, wherein the original skeleton vector is a pBluescript SK (-) plasmid vector, and the insert is formed by sequentially connecting a PAM2 region sequence, a left arm 5'arm sequence, a CMV promoter sequence, a human COL17A1 gene sequence, a PolyA signal sequence, a right arm 3' arm sequence and a PAM2 region sequence; the PAM2 region sequence is shown as SEQ ID NO.4, the left arm 5'arm sequence is shown as SEQ ID NO.2, the CMV promoter sequence is shown as SEQ ID NO.5, the human COL17A1 gene sequence is shown as SEQ ID NO.6, the PolyA signal sequence is shown as SEQ ID NO.7, and the right arm 3' arm sequence is shown as SEQ ID NO. 3.

Example 3: preparation of sgrnas and Cas9 mRNA

Double-stranded DNA of the sgRNA with the T7 promoter upstream was obtained by PCR amplification:

5'-

AAATTAATACGACTCACTATAGGGACAGCTATTCTTTACAGTGTGTTTTAGAGCTAGAAAT AGC-3' (double-stranded DNA1, SEQ ID NO. 8),

5'-

GAAATTAATACGACTCACTATAGGGTAGTCCGGTTGCCATCTCGCGTTTTAGAGCTAGAA ATAGC-3' (double-stranded DNA2, SEQ ID NO. 9).

In vitro transcription is carried out by using a transcription kit to obtain sgRNA1:

5'-

GAAAUUAAUACGACUCACUAUAGGGACAGCUAUUCUUUACAGUGUGUUUUAGAGCU AGAAAUAGC-3'(SEQ ID NO.10)，

sgRNA2：

5'-

GAAAUUAAUACGACUCACUAUAGGGUAGUCCGGUUGCCAUCUCGCGUUUUAGAGCU AGAAAUAGC-3'(SEQ ID NO.11)。

the Cas9 DNA sequence with the SP6 promoter on the upstream and the nuclear localization sequences on both sides is obtained through PCR amplification and is shown as SEQ ID NO. 12. And (3) carrying out in vitro transcription by using a transcription kit to obtain the Cas9 mRNA, wherein the sequence of the Cas9 mRNA is shown as SEQ ID NO. 13. The sgrnas and Cas9 mRNA were purified and recovered and split-packaged and frozen at-80 ℃.

Example 4: microinjection of pBluescript SK-COL17A1 donor plasmid, sgRNA and Cas9 mRNA into zebra fish fertilized eggs were mixed in a final concentration ratio of donor plasmid pBluescript SK-COL17A1300 ng/. Mu. L, cas9 mRNA 100 ng/. Mu. L, sgRNA150 ng/. Mu.L, sgRNA250 ng/. Mu.L to prepare microinjection samples, each zebra fish embryo injected with 1nL. Injected embryos are raised to sexual maturity.

Example 5: PCR screening to obtain COL17A1 transgenic zebra fish strain

When the injected zebra fish embryo is bred to be mature sexually, the zebra fish embryo is hybridized with a wild type, embryo extraction genome DNA is collected as a template, the 5 'end (L, 5' arm-CMV) and 3 'end (R, polyA-3' arm) gene knock-in sites are amplified by using a specific primer in a PCR mode, the PCR products are subjected to electrophoresis and sequencing, the result shows that the sequence is correct (figure 3), the zebra fish fry protein is extracted, a humanized XVII type Collagen band is detected by an Anti-Collagen XVII antibody (6310, british ABcam company), the size of the Collagen band is consistent with the predicted size of 180kDa (figure 4), and finally the transgenic zebra fish with successful COL17A1 gene knock-in is obtained. The primer of the 5' end of PCR amplification is as follows: forward primer 5'-ACTCCACAAGACAGGTTTGTCG-3' and reverse primer 5'-GCGGGCCATTTACCGTAAGTTA-3', PCR amplification product size is 379bp; the primers for PCR amplification of the 3' end are: forward primer 5'-CTGCATTCTAGTTGTGGTTTGTCC-3' and reverse primer 5'-GAACTTTGTGTGTGCTGAATCACC-3', PCR amplification product size 397bp.

Example 6: a hemolysis experiment and a healing and repairing result of the wound surface of the skin of a mouse, which are obtained by using XVII type total collagen in COL17A1 transgenic zebra fish, show that

Extracting zebra fish total collagen by a conventional method:

Taking F1-generation COL17A1 transgenic zebra fish, shearing the zebra fish after sudden death in ice bath, and recording the weight. Removing pigment and fat impurities from tissue by chemical method, swelling collagen, adding 10 times of raw material weight of ultrapure water, and stirring in 45 deg.C constant temperature oil bath for 12 hr. Centrifuging at 4deg.C for 20min, collecting supernatant, and dialyzing for 3 days. And storing the dialyzed supernatant in a refrigerator at the temperature of minus 80 ℃ to prepare a solid sample, and freeze-drying to obtain the total collagen, wherein the total collagen contains the human source XVII type collagen.

Preparing a gel dressing:

3.75mg of COL17A1 transgenic zebra fish freeze-dried total collagen is weighed and dissolved in physiological saline with minimum volume to prepare collagen solution.

Ns+sa dressing: weighing 37.5mg sodium alginate, adding 700 μl physiological saline, stirring for swelling, and sterilizing with high pressure steam to obtain gel dressing.

Ns+sa+wt dressing: weighing 37.5mg of sodium alginate, adding 700 mu L of physiological saline, stirring and swelling, sterilizing by high-pressure steam, cooling to room temperature, adding the wild zebra fish total collagen solution, and mixing uniformly to obtain gel dressing.

Ns+sa+c17 dressing: weighing 37.5mg of sodium alginate, adding 700 mu L of normal saline, stirring and swelling, sterilizing by high-pressure steam, cooling to room temperature, adding COL17A1 transgenic zebra fish total collagen solution, and mixing to obtain gel dressing.

Hemolysis experiment:

After the syringe was rinsed with 2% heparin sodium (anticoagulated), an appropriate amount of blood was withdrawn from the rabbit ear vein of a healthy adult New Zealand white rabbit. After removing fibrin in rabbit blood, preparing 2% erythrocyte suspension with physiological saline, and preparing corresponding system, wherein the specific proportion is shown in table 1. Wherein, the NS group is a negative control group, the ddH ₂ O group is a positive control group, and the rest groups are experimental groups. After the system preparation is completed, the mixture is placed in a constant temperature incubator at 37 ℃ for incubation. Each group was observed for hemocompatibility after 15min,30min,1h,2h, and 3h incubation, respectively. After 3 hours of observation, the supernatant of each group is sucked and the absorbance value is measured at the OD ₅₄₅, and the obtained absorbance value is substituted into a formula to calculate the hemolysis rate. The results showed (fig. 5) that the hemolysis rate of both ns+c17 group and ns+sa+c17 group was less than 5%, indicating that COL17A1 transgenic zebra fish lyophilized total collagen can be used for preparing wound healing dressing.

TABLE 1 preparation of systems for hemolysis experiments

Mouse skin wound healing experiment:

After the mice were anesthetized via the abdominal cavity, a hole with a diameter of about 7mm was constructed in the skin in the middle of the spinal column of the mice using a punch, and a full-thickness skin defect wound was formed. Modeling was recorded as 0 days and was continued for 15 days. During the experiment, different dressings are respectively smeared on the back skin wound surfaces of mice in different groups at D0, D4, D8, D12 and D15, and Tegaderm transparent dressing is adopted as a secondary dressing to prevent self-made gel dressing from falling off. The wound healing condition of different days is recorded, and the wound healing rate is calculated. The dressing sets for the different groups were as follows: ns+sa group, applying ns+sa dressing; ns+sa+wt group, smeared ns+sa+wt dressing; ns+sa+c17 groups, ns+sa+c17 dressing was applied. Negative control group: NS, applying physiological saline. Positive control group: MD, smeared with a commercial gel containing recombinant human type III collagen. The results show (fig. 6) that gel-like dressings prepared from COL17A1 transgenic zebra fish total collagen show better wound healing and skin repair effects.

Claims (8)

1. A construction method of COL17A1 transgenic zebra fish capable of expressing XVII type collagen is characterized by comprising the following steps: knocking in a humanized COL17A1 gene sequence on a zebra fish chromosome by using a CRISPR-Cas9 gene editing technology; the sequence of the humanized COL17A1 gene is shown as SEQ ID NO. 6.

2. The construction method according to claim 1, wherein: the method comprises the following steps:

s1: selecting a target sequence on the zebra fish genome;

S2: constructing a donor plasmid pBluescript SK-COL17A1; the donor plasmid pBluescript SK-COL17A1 comprises an original skeleton vector and an insertion fragment, wherein the insertion fragment comprises a PAM2 region sequence, a left arm 5 'arm sequence, a CMV promoter sequence, a human COL17A1 gene sequence, a PolyA signal sequence, a right arm 3' arm sequence and a PAM2 region sequence which are connected in sequence;

s3: determining specific target sites of COL17A1 genes, and obtaining Cas9 mRNA, sgRNA1 and sgRNA2 by means of in vitro transcription;

S4: microinjection of donor plasmids pBluescript SK-COL17A1, cas9 mRNA, sgRNA1 and sgRNA2 into zebra fish fertilized eggs;

s5: PCR screening to obtain COL17A1 transgenic zebra fish strain.

3. The construction method according to claim 2, wherein: in the step S1, the sequence of the target sequence is shown as SEQ ID NO. 1.

4. The construction method according to claim 2, wherein: in the step S2, the PAM2 region sequence is shown as SEQ ID NO.4, the left arm 5 'arm sequence is shown as SEQ ID NO.2, the CMV promoter sequence is shown as SEQ ID NO.5, the PolyA signal sequence is shown as SEQ ID NO.7, and the right arm 3' arm sequence is shown as SEQ ID NO. 3.

5. The construction method according to claim 2, wherein: in the step S3, the sequence of the Cas9 mRNA is shown as SEQ ID NO.13, the sequence of the sgRNA1 is shown as SEQ ID NO.10, and the sequence of the sgRNA2 is shown as SEQ ID NO. 11.

6. The construction method according to claim 2, wherein: in step S4, the microinjection system includes: donor plasmid pBluescript SK-COL17A1 300 ng/. Mu.L, cas9 mRNA 100 ng/. Mu.L, sgRNA1 50 ng/. Mu.L, sgRNA2 50 ng/. Mu.L.

7. The COL17A1 transgenic zebra fish constructed by the construction method of claim 1.

8. The use of COL17A1 transgenic zebra fish as claimed in claim 7, wherein: including one or more of the following:

1) The application in the preparation of XVII type collagen;

2) Use in the preparation of a product for promoting wound healing;

3) Use in the preparation of a product for promoting skin repair.